ID: 1178702150

View in Genome Browser
Species Human (GRCh38)
Location 21:34842771-34842793
Sequence AAAAACATACAGATGCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 474
Summary {0: 1, 1: 0, 2: 1, 3: 46, 4: 426}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178702150 Original CRISPR AAAAACATACAGATGCAGCT GGG Intronic
900833805 1:4984844-4984866 CAGAACTCACAGATGCAGCTTGG - Intergenic
901188777 1:7391290-7391312 TAAAACATCCAGATACAGCCGGG - Intronic
901705504 1:11070074-11070096 AAAAAGAAACAAATGTAGCTGGG + Intronic
903430655 1:23296272-23296294 ACAGACATACAGATGTTGCTTGG - Intergenic
903957006 1:27032596-27032618 AAAAAAATACAAAAGCAGCCGGG - Intergenic
903964744 1:27080104-27080126 AAAAACACACATTTGCAGCCAGG - Intergenic
906370775 1:45251716-45251738 AAAAACATACCCATGCATATAGG - Intronic
906761173 1:48380745-48380767 AAACACATACACATGCACATTGG - Intronic
906994466 1:50776962-50776984 AAAAATATACAGAATCAGCCAGG + Intronic
907313376 1:53552518-53552540 AAAAACCAACAGATGCATTTGGG + Intronic
908080385 1:60571259-60571281 GAAAAAAGACACATGCAGCTAGG + Intergenic
910249793 1:85184891-85184913 AAAAAGATACATATGTATCTGGG + Intronic
910773594 1:90852909-90852931 AAAAAAATACTGATTCAGCCTGG + Intergenic
911125079 1:94333859-94333881 AAAAAAAGTCAGATGCAGCTGGG + Intergenic
911313791 1:96330790-96330812 AAAACCATACAGCTGAATCTTGG + Intergenic
912100386 1:106196402-106196424 AAAAACATAGGCATGCAGATAGG - Intergenic
912273406 1:108232191-108232213 CAAAACATACAGAGGCTGCCTGG + Intronic
912294814 1:108462131-108462153 CAAAACATACAGAGGCTGCCTGG - Intronic
912843665 1:113060962-113060984 AAAAGCCTACAGGAGCAGCTGGG + Intergenic
915365670 1:155314154-155314176 AAAAACTTACAGGTGAAACTAGG - Intronic
915939224 1:160108148-160108170 AAAAAAATACCGATGCGGCTGGG + Intergenic
916763766 1:167840755-167840777 AAAAACATACAAATGCCTATAGG + Intronic
916858596 1:168778226-168778248 AAAAAGAGACAGAGGCATCTAGG + Intergenic
917065840 1:171092378-171092400 AAAAACAAACAAAATCAGCTGGG - Intronic
917116285 1:171607131-171607153 AAAAACAGACATATGAAGGTTGG - Intergenic
917714206 1:177717599-177717621 AAAAAAATAGAGATGGAGGTGGG + Intergenic
917942643 1:179937903-179937925 AAAAACAGAAAAAGGCAGCTGGG - Intergenic
918023547 1:180718960-180718982 TAAAACATACAGATCCGGCTGGG - Intronic
918289189 1:183090241-183090263 AAAAAAAAGCAGATGCATCTAGG + Intronic
918624733 1:186644448-186644470 AAAAAAATAAAAATGTAGCTAGG + Intergenic
919013814 1:192002090-192002112 AAAAACATACAAAATCAGCTGGG + Intergenic
919245525 1:194978113-194978135 AAAAATACACATATGCGGCTGGG - Intergenic
919384777 1:196907486-196907508 AAGAACTTACATATGCATCTTGG - Exonic
919551027 1:198987806-198987828 AATCACATACAGATGCCCCTCGG + Intergenic
919902365 1:202053650-202053672 AAAAAATAACAGATGCAGCCAGG + Intergenic
920740378 1:208576330-208576352 AAAACCACACTGATGGAGCTTGG + Intergenic
921305643 1:213793666-213793688 AAAAACATCAAAATGCAGGTTGG + Intergenic
921669074 1:217906616-217906638 TAAAAGATACAGAAGCAGGTAGG + Intergenic
923282579 1:232458907-232458929 AAAAGCAGACAGATTCAACTAGG + Intronic
923605719 1:235440688-235440710 AAAAAAATACAGATGCCGGCTGG - Intronic
924228303 1:241941522-241941544 AAAAAAACACAGATGTGGCTGGG - Intergenic
924287235 1:242500228-242500250 AAAAACAAACTCATGCATCTTGG + Intronic
924291046 1:242536724-242536746 AAAAACATACAGATCCTCCTTGG - Intergenic
1063102083 10:2959118-2959140 AAAAACATGCATATGGGGCTGGG - Intergenic
1063239041 10:4149456-4149478 AAGAAGACACAGAGGCAGCTGGG - Intergenic
1063239045 10:4149482-4149504 AAGAAGACACAGAGGCAGCTGGG - Intergenic
1063239049 10:4149508-4149530 AAGAAGACACAGAGGCAGCTGGG - Intergenic
1063239053 10:4149534-4149556 AAGAAGACACAGAGGCAGCTGGG - Intergenic
1063239057 10:4149560-4149582 AAGAAGACACAGAGGCAGCTGGG - Intergenic
1063779585 10:9306135-9306157 AAAAAAATACAGATTCTGGTGGG + Intergenic
1064653550 10:17534337-17534359 AAAAATATACAGATGAGGCTGGG + Intergenic
1065880285 10:30031735-30031757 AAAAAAATACAGATGGGGCTGGG - Intronic
1067074144 10:43163703-43163725 ATAATCATACACATGAAGCTGGG + Intronic
1067124037 10:43500168-43500190 AAAAATATAAAGATGAAGCCAGG - Intergenic
1068999401 10:63246334-63246356 AAAAACATAGAGATTCAATTTGG + Intronic
1070558488 10:77548037-77548059 AAAAACTTTCAGATGTAGTTAGG + Intronic
1071485474 10:86099321-86099343 AAACACATGCAGATGCTGTTGGG + Intronic
1072010636 10:91299966-91299988 AAACACAGACAGCTGCACCTTGG - Intergenic
1072273098 10:93796433-93796455 AAAAGCATAGAGATGCTGGTAGG + Intronic
1072960197 10:99922489-99922511 AAAAAAAAACAGCAGCAGCTAGG - Intronic
1074232320 10:111549732-111549754 AGAAACAAACTGATGCTGCTGGG - Intergenic
1074530908 10:114298080-114298102 AAAAAAATACAGTTCAAGCTGGG + Intronic
1075000236 10:118791532-118791554 AAAAATTTACAAATGCAGCCGGG + Intergenic
1075386452 10:122058877-122058899 AAAAACACACAGAGGGGGCTGGG - Intronic
1075794775 10:125112092-125112114 AAAAAAAGTCAAATGCAGCTGGG - Intronic
1076093724 10:127713170-127713192 ACAAACCTACAGGAGCAGCTGGG - Intergenic
1076263020 10:129085674-129085696 AAAAACATACACATTAACCTAGG - Intergenic
1080083645 11:28252505-28252527 AAACTCATACAGATACAGGTAGG - Intronic
1080658586 11:34277486-34277508 AAAAACAAACAGATTTGGCTGGG + Intronic
1080911697 11:36606702-36606724 AATACCAAACAGATGCAGCCAGG - Intronic
1081563161 11:44237926-44237948 AAAAACATACAAAGTTAGCTGGG + Intronic
1082087825 11:48064586-48064608 AAATAAATACATTTGCAGCTCGG - Intronic
1083442455 11:62686150-62686172 AAAAAAATACAAAATCAGCTGGG + Intergenic
1084076940 11:66786488-66786510 ACAAACATACAAATCCAGATAGG - Intronic
1084103161 11:66963441-66963463 AAAAAAATACAAAATCAGCTGGG + Intergenic
1084906997 11:72356121-72356143 AAAAAAATACAAATTTAGCTGGG + Intronic
1085193879 11:74654210-74654232 TTAAACATAAAGATGCAGATAGG + Intronic
1085311832 11:75521368-75521390 CAATTCAAACAGATGCAGCTTGG + Intronic
1086436223 11:86783540-86783562 GGGAAAATACAGATGCAGCTTGG - Intergenic
1086952284 11:92903576-92903598 ATAAACACACAGATGGAGATGGG + Intergenic
1088214812 11:107496091-107496113 AAAACGATAGAGATGGAGCTAGG + Intergenic
1088576749 11:111279581-111279603 ACAAAGACACAGATGCAGATGGG - Intronic
1089426169 11:118377366-118377388 AAAAAAATACAAAATCAGCTGGG - Intronic
1089485176 11:118839962-118839984 AAAAACATAAACATGCAGGCTGG + Intergenic
1089570509 11:119405532-119405554 AAAAACATACAAAAGTAGCCAGG - Intergenic
1089677383 11:120098917-120098939 AAATGCACACAGATGCAGCTGGG - Intergenic
1089957828 11:122588794-122588816 AAAAACATGCATGTGCACCTAGG + Intergenic
1090337001 11:125976288-125976310 AAAATCATACAGTTGCTCCTGGG + Intronic
1091271010 11:134311955-134311977 AAAAACTTAAAAATGTAGCTGGG - Intronic
1093067669 12:14675370-14675392 AAAAACATACAAATGCAACCAGG + Intronic
1093957737 12:25240732-25240754 AAAAACATACAAATGGAAGTTGG - Intronic
1094426547 12:30322358-30322380 AAAAATAAACATTTGCAGCTGGG - Intergenic
1095174554 12:39076318-39076340 TAAAATATACAAATACAGCTGGG - Intergenic
1095588102 12:43870768-43870790 AAAAGCAAACAGATGCTGGTGGG - Intronic
1095863439 12:46945543-46945565 AAAAATATAAAGCAGCAGCTGGG + Intergenic
1096397916 12:51280528-51280550 AAAAAAATACAAAAGCAGCCGGG - Intergenic
1097392296 12:59030497-59030519 AAACTCAAAGAGATGCAGCTTGG - Intergenic
1097869420 12:64587930-64587952 AGAAACTTAAAGATGCAGCTGGG - Intergenic
1099656459 12:85498464-85498486 AACAGCAAACAGATGCAACTGGG - Intergenic
1099982543 12:89623343-89623365 AAAAAAAAAAAGATGTAGCTTGG - Intronic
1100373991 12:93995307-93995329 TAAAACATACACATGCGGCCAGG + Intergenic
1101638156 12:106564416-106564438 AAAAAGATAAAGATGCAGAGAGG + Intronic
1101644897 12:106622613-106622635 AAAAAAAAAAAAATGCAGCTTGG - Intronic
1102361097 12:112288325-112288347 AAAAAAAAAAAGATGCAGCAAGG + Intronic
1102642963 12:114382819-114382841 AAAAACATACAAATTTAGTTGGG + Intronic
1102839016 12:116097948-116097970 AAAAACATAAAAATGAGGCTGGG + Intronic
1103680825 12:122692284-122692306 AAAACAAAACAGATCCAGCTGGG - Intergenic
1104437321 12:128766401-128766423 AAAAACACACAGAAAGAGCTGGG + Intergenic
1104803026 12:131567673-131567695 AAATACATACTGATGCACCATGG + Intergenic
1106645093 13:31625553-31625575 AAAAACTTTCAAATGCAGTTTGG + Intergenic
1107909626 13:45093216-45093238 AAAAACACAAAAAAGCAGCTGGG + Intergenic
1108403085 13:50068286-50068308 TGAAACATACAAATGCTGCTGGG - Intergenic
1109080253 13:57890552-57890574 AAAAAAAGAAAGATGGAGCTGGG - Intergenic
1109943444 13:69401708-69401730 AAAAATATAAATATGCAGCAAGG + Intergenic
1110003853 13:70240153-70240175 AAAAATATGCACCTGCAGCTGGG - Intergenic
1110181158 13:72619078-72619100 AAATACATACAGAAGCATTTAGG + Intergenic
1110539925 13:76696533-76696555 AAAAACAGACAGATGCCATTAGG + Intergenic
1110810519 13:79807299-79807321 ATAAACATGCAGGTACAGCTAGG - Intergenic
1112742670 13:102492817-102492839 AAAAAAAAAAAGATGCACCTGGG + Intergenic
1114151935 14:20050702-20050724 GATAAAATACAGATTCAGCTAGG - Intergenic
1116283307 14:42938534-42938556 AAAAACATACAAGTGCAGGCTGG - Intergenic
1116847115 14:49875178-49875200 AAAGAAATACAGGTCCAGCTGGG + Intergenic
1117806371 14:59495826-59495848 AAAAACATAGAAATGCAAATAGG + Intronic
1118980387 14:70711431-70711453 AAAAACATACAAATAGGGCTTGG + Intergenic
1120597556 14:86460272-86460294 GACAACATACATATACAGCTGGG + Intergenic
1120988126 14:90351902-90351924 AAATACAAACATATGGAGCTGGG + Intergenic
1121486596 14:94321249-94321271 AAAAAGATGCAGCTGCAGATGGG - Intronic
1121754992 14:96394677-96394699 AAAAAGATACAGATACAGGCTGG + Intronic
1123167130 14:106336109-106336131 AAAAACATACACATGAACCGTGG - Intergenic
1123169746 14:106360820-106360842 AAAAACATACACATGAACCATGG - Intergenic
1123227227 15:17051767-17051789 AAAATCAGACAGAAGCATCTGGG + Intergenic
1123810133 15:23916468-23916490 AAAAACAGACAGATCCGGCCGGG - Intergenic
1124910339 15:33914232-33914254 ATAAACATACAGTAGCAGCTAGG + Intronic
1125099222 15:35890953-35890975 AAAAACACAAAAATGTAGCTGGG + Intergenic
1125885250 15:43224761-43224783 ACAAACATACAAATCAAGCTTGG - Intergenic
1126607378 15:50492152-50492174 AAAAAAATACAGTTCCAGCTGGG - Intronic
1127559627 15:60123005-60123027 AAAAATATACAGATTCCTCTGGG + Intergenic
1128019554 15:64378615-64378637 GAAAACATACAGCAGCAGCTGGG + Intronic
1128042148 15:64584610-64584632 ATAAACATAAAGATGGGGCTGGG - Intronic
1128332935 15:66767948-66767970 AAAAAAAAAAAGATGCAGCTTGG - Intronic
1128367860 15:67017396-67017418 AAAAAAGAAAAGATGCAGCTGGG + Intergenic
1129094867 15:73195400-73195422 AAAAACACACAGACGCAGCATGG - Intronic
1131522046 15:93123858-93123880 AAAAAAAAAAAGATCCAGCTAGG - Intergenic
1132077544 15:98834943-98834965 ACAAACATAGAGAAGCATCTGGG - Intronic
1132895264 16:2226099-2226121 AAAAAAAAAAAGATGCAGATTGG + Intronic
1133465684 16:6024994-6025016 AAAATCATACAGTTGAAGGTTGG + Intronic
1134253096 16:12588532-12588554 AAATACATCCAGATCCAGCCAGG + Intergenic
1134259010 16:12635640-12635662 AAAAAAATACACATCCAGCTGGG + Intergenic
1134781172 16:16896766-16896788 AGAAACAGACAGAAGGAGCTCGG + Intergenic
1135035109 16:19070571-19070593 AAAAATATAAAAATGTAGCTGGG + Intronic
1135292334 16:21250713-21250735 CAGAGCATACAAATGCAGCTGGG + Exonic
1135907397 16:26525494-26525516 CCAAAATTACAGATGCAGCTGGG + Intergenic
1137406332 16:48192449-48192471 AAAAAAATAAAAATGAAGCTGGG + Intronic
1137831827 16:51551110-51551132 AAAAAGATACAGTTGCACTTAGG - Intergenic
1138306831 16:55984957-55984979 AAAAAATAACAGATGCGGCTGGG - Intergenic
1138375345 16:56559766-56559788 AAAAACATAATGATGGGGCTGGG + Intergenic
1138404725 16:56781412-56781434 TACAACATACAGAAGCATCTCGG - Intronic
1138635225 16:58332969-58332991 TAAAAAACACAGATGCAGCCGGG - Intronic
1138828439 16:60350474-60350496 AAAAACATATATATATAGCTGGG - Intergenic
1138838178 16:60463814-60463836 AAATACATACAGATGCAATAAGG - Intergenic
1139941631 16:70609867-70609889 CAAAACATCCAGAGGCATCTGGG - Intronic
1140967981 16:79985862-79985884 AAAAACACAAAGATTCAGTTAGG - Intergenic
1141452159 16:84111903-84111925 AAAAAAAAAAAAATGCAGCTGGG + Intronic
1141848044 16:86624364-86624386 ATAAAGAAAAAGATGCAGCTAGG - Intergenic
1141981600 16:87553681-87553703 AAAAAAATAAAGAAGCAGCCAGG - Intergenic
1142585279 17:968410-968432 AAAGATACACAGATGCAGCCCGG + Intronic
1142858445 17:2746665-2746687 AAAAACAAACAGCTGAAGCAGGG - Intergenic
1143284304 17:5777612-5777634 AAAAACATACACCTTGAGCTGGG + Intronic
1143318359 17:6050322-6050344 ATAAATATACATATGCAGCCGGG - Intronic
1143741339 17:8956216-8956238 AAAAAAAAAAAGATGCAGGTTGG + Intronic
1143888999 17:10088009-10088031 AAAAATATATGGATGCAGCCTGG + Intronic
1144786198 17:17833126-17833148 ATAAAAATACAGATCCAGCCGGG + Intronic
1146227204 17:31077508-31077530 TAAAAAATACAGAAGTAGCTGGG + Intergenic
1147851886 17:43450099-43450121 AAAAACCCACAGCTGCTGCTAGG - Intergenic
1148061129 17:44837195-44837217 AAAAAAAAAAAGATGTAGCTGGG + Intergenic
1148100668 17:45088770-45088792 AAAAAAAAAAAGAGGCAGCTTGG + Intronic
1148627775 17:49083150-49083172 AAAAACACCCAGATGCAGCTGGG - Intergenic
1149075103 17:52587405-52587427 GAAAACACACACATGCAGCTGGG + Intergenic
1149202788 17:54207420-54207442 AAAAAATAACAGATGCGGCTGGG + Intergenic
1149768836 17:59303833-59303855 ATAAACATACATATGCAGATCGG - Intergenic
1149912052 17:60575680-60575702 ACAAACACACAAAAGCAGCTTGG - Intronic
1150195452 17:63293624-63293646 AAATATAAACAGCTGCAGCTAGG - Intronic
1150342480 17:64379726-64379748 AAAAAAATATGGATGAAGCTAGG + Intronic
1150372390 17:64651276-64651298 AAAAATATACACATAAAGCTGGG + Intronic
1150921952 17:69493463-69493485 AAAAATACTCAGCTGCAGCTGGG + Intronic
1152840235 17:82562649-82562671 ACAAACATACAAATGTATCTGGG - Intronic
1153308139 18:3651495-3651517 AAAAATAGAAAGATTCAGCTGGG + Intronic
1153768119 18:8394085-8394107 AAAAACATCCATTAGCAGCTGGG - Intronic
1154381213 18:13851756-13851778 AAAAATACAAAGAAGCAGCTAGG + Intergenic
1155816882 18:30323362-30323384 AAGTAGCTACAGATGCAGCTAGG - Intergenic
1157754739 18:50207631-50207653 AAAAATATACAGCTGGGGCTGGG - Intergenic
1158301759 18:56060510-56060532 AAAGACATACAGAGTCAACTAGG - Intergenic
1158816442 18:61103305-61103327 AAAAACATAAACATAAAGCTGGG + Intergenic
1158956480 18:62544960-62544982 TAAAACATACAGATAAAGGTTGG + Intronic
1160217725 18:76947694-76947716 AAAAACATACAGATTCAGAAGGG + Intronic
1160706658 19:533005-533027 AAAAACATCCAGAAACTGCTTGG - Intronic
1161927292 19:7310738-7310760 AAAAATACACACATACAGCTGGG - Intergenic
1162081962 19:8223456-8223478 AAAAAAATACAAAAGTAGCTGGG + Intronic
1162690324 19:12424638-12424660 AAAAAAATAAAGGTCCAGCTGGG + Intronic
1163229261 19:15989048-15989070 ATAGAAATAGAGATGCAGCTGGG - Intergenic
1163467692 19:17478169-17478191 AAAATCACAAAAATGCAGCTGGG + Intronic
1163578835 19:18126059-18126081 AAAAAAAAAAAGATGTAGCTGGG + Intronic
1163764813 19:19157550-19157572 CAAAACTCACTGATGCAGCTGGG + Intronic
1163958792 19:20667763-20667785 TAAAAAAAACCGATGCAGCTGGG - Intronic
1165033688 19:33017562-33017584 ATAAAAATAGAGATGCGGCTGGG + Intronic
1165340829 19:35211026-35211048 TAAGACATGCAGAGGCAGCTGGG + Intergenic
1166431466 19:42731477-42731499 AAAAATATACAAGTGCAGCATGG - Intronic
1166444464 19:42846712-42846734 AAAAACATACGAGTGCAGCATGG - Intronic
1166454353 19:42928136-42928158 AAAAATATACAAGTGCAGCATGG - Intronic
1166523396 19:43495971-43495993 AAAAAGATCCAGAAGCAGGTGGG + Intronic
1166618942 19:44277822-44277844 ATAAACATACTGATGATGCTGGG + Intronic
1167061188 19:47147746-47147768 AAAAAAATACAGTTGAGGCTGGG - Intronic
1167162121 19:47774909-47774931 AAAAAAATAGAGATGGAGCCAGG - Intergenic
1168375520 19:55875874-55875896 AAAAAAATACAGAATTAGCTGGG + Intronic
925767184 2:7247540-7247562 AAAAACAGACAAGTGCAACTGGG - Intergenic
925844426 2:8022755-8022777 ACAATCATACAGATGAAGCTCGG - Intergenic
925850966 2:8081704-8081726 AAAAAAATACAAAATCAGCTGGG + Intergenic
926882595 2:17563567-17563589 AAAAAAATACAGTTTTAGCTGGG + Intronic
927753679 2:25691849-25691871 AAAAAAATACAAAAGTAGCTGGG - Intergenic
928182106 2:29075572-29075594 AAAAACATGCAGTTTCAGCCAGG + Intergenic
928611932 2:32999594-32999616 AAAAAGATCCAGAGGCGGCTGGG + Intronic
929130989 2:38570885-38570907 AAAAAAATACAAAACCAGCTGGG + Intronic
929726119 2:44429412-44429434 AAAGAGATACAGGTCCAGCTAGG - Intronic
930235829 2:48888332-48888354 AAAAGCAGACAAAGGCAGCTGGG - Intergenic
930376327 2:50571828-50571850 AAAAACAAAAAGAGGCAGCTGGG + Intronic
931787448 2:65632871-65632893 AAGAAATTACAAATGCAGCTAGG - Intergenic
933227851 2:79771719-79771741 AAATAAATACAGATGAAGCTTGG + Intronic
933710633 2:85323251-85323273 AAAAAAATACACATGTGGCTGGG - Intronic
934079501 2:88455503-88455525 AAAAATAGACAGTTGCAGATCGG + Intergenic
935517646 2:104062073-104062095 AAAAACAAACAGATTCTACTTGG + Intergenic
936791284 2:116156313-116156335 AAAAAATTACAGATGCTGCAAGG - Intergenic
937532465 2:122845712-122845734 AAATACATACATATGCAGTATGG + Intergenic
938016051 2:127868033-127868055 CAAAAAATACAAATTCAGCTGGG - Intronic
941084418 2:161100071-161100093 AAAAACATAAATATGCAGACAGG + Intergenic
942069995 2:172307811-172307833 AAAAAAATAGAATTGCAGCTGGG - Intergenic
942794235 2:179797468-179797490 AAAAACATGCAGATGAAAATTGG - Intronic
943459842 2:188158782-188158804 AAAAGCATACAGAATTAGCTGGG - Intergenic
945507665 2:210661275-210661297 ACCATCATACTGATGCAGCTAGG - Intronic
945991144 2:216396318-216396340 AAAAAAATAAAGATGTAGCTGGG + Intergenic
947660720 2:231864742-231864764 GAAAACATACAAAAGGAGCTTGG - Intergenic
1169495348 20:6109738-6109760 AAAAAAATACAAATTTAGCTGGG + Intronic
1170333993 20:15248268-15248290 AAACACAGACAGATGCAGGGAGG - Intronic
1171414948 20:24971581-24971603 AAAAACAAACAGATGGGGATTGG + Intronic
1172065040 20:32213475-32213497 AAAAATATAAAGATGAGGCTGGG + Intronic
1172243093 20:33426463-33426485 AAAAAGATTCAGCTGCAGGTTGG + Intronic
1172989528 20:39023045-39023067 AAAAACAGACATAAGCATCTGGG - Intronic
1173283616 20:41651029-41651051 TAAAACATCCAGATCCAGCCTGG - Intergenic
1173550510 20:43930001-43930023 AAAAATACTCAGAAGCAGCTGGG - Intronic
1174316149 20:49703591-49703613 TAAAACATACAGATTCAGCCGGG + Intronic
1174669076 20:52289079-52289101 AAATACACAGAGATGTAGCTTGG - Intergenic
1174740684 20:53011115-53011137 AAAAATATACTGATCCAGCTTGG + Intronic
1175112077 20:56655489-56655511 AAAAAGATACATATGTAGCTGGG + Intergenic
1175163426 20:57025451-57025473 TAAAACAAACAGATGAAACTTGG + Intergenic
1175638358 20:60604305-60604327 AACAACATACAGGTGTAGCAAGG - Intergenic
1175698888 20:61123335-61123357 AAAAACACACAGAAGCATCAGGG + Intergenic
1177047738 21:16191266-16191288 AAAAACAGAAAGTTGCAGCGAGG - Intergenic
1177049520 21:16214835-16214857 AAAAAAATACAAAATCAGCTCGG - Intergenic
1178074903 21:29005946-29005968 TTAAAGATACATATGCAGCTAGG - Exonic
1178702150 21:34842771-34842793 AAAAACATACAGATGCAGCTGGG + Intronic
1179597937 21:42455651-42455673 ACAAACATACAGATACAGGCTGG + Intergenic
1179614593 21:42573615-42573637 AAAAACATACAATTGCTCCTGGG + Intronic
1180927036 22:19562510-19562532 AATAAAATACAGACTCAGCTGGG - Intergenic
1181341777 22:22186687-22186709 AAAAACATACAGAAGCACAGTGG + Intergenic
1182702504 22:32251932-32251954 GAAAATAGACAGATGTAGCTGGG + Intronic
1184983004 22:48107527-48107549 AAAAACACAAAGATGCTTCTTGG - Intergenic
1185152983 22:49177039-49177061 ACAAACACACACATGCAGCAGGG + Intergenic
1185353321 22:50349825-50349847 AAAAACAGAAAAAAGCAGCTGGG + Intronic
950079713 3:10212715-10212737 AGCAAGATACAGATGGAGCTGGG + Intronic
950337156 3:12204783-12204805 ACAAATATACAGGGGCAGCTGGG - Intergenic
951965152 3:28373768-28373790 AAAGACATACAAATGGAGCCAGG - Intronic
952152143 3:30605261-30605283 CAAAACATCCAGAGGCAGCTTGG + Intergenic
952178911 3:30896974-30896996 ACAAACATACATATTCACCTAGG + Intergenic
953316784 3:41935385-41935407 AAAAAAATACAAATTTAGCTGGG - Intronic
953998627 3:47539126-47539148 AAAAGCATGAAGATGCAGCCTGG + Intergenic
955181758 3:56678713-56678735 CAAAACATACAAATGGGGCTGGG + Intronic
955342312 3:58134544-58134566 AAGAAAAGTCAGATGCAGCTGGG + Intronic
956707770 3:72014031-72014053 AAAAACAATCATATGCAGTTGGG + Intergenic
957220738 3:77379239-77379261 AAAAAGATACAGAAGTTGCTGGG - Intronic
957416250 3:79909297-79909319 AAAAAGACACAGATGTAGCTAGG + Intergenic
957444190 3:80293537-80293559 AAAAACTTACAGATGATGCTTGG + Intergenic
958103099 3:89038571-89038593 AAAAACAAAGAGATCCGGCTGGG + Intergenic
958569350 3:95860175-95860197 AAAAAAATACATATGAGGCTGGG - Intergenic
960181909 3:114589848-114589870 AAACACATACACATGCATATAGG - Intronic
960592259 3:119377861-119377883 AAAAAGTTAAAGTTGCAGCTGGG + Intronic
962240939 3:133750408-133750430 AGAAACATCCAGATGCAGCCTGG + Intronic
964929250 3:161996197-161996219 AAAAACTTTCAGATCCTGCTAGG - Intergenic
965260086 3:166471180-166471202 ACAAAAATACAAATGCAGCCAGG - Intergenic
965753796 3:172004946-172004968 AAAAAGTTAAATATGCAGCTGGG + Intergenic
966549914 3:181193543-181193565 ATAAAAATACAGTTGAAGCTTGG + Intergenic
966718939 3:183041921-183041943 ATTAAAAAACAGATGCAGCTTGG + Intronic
966904897 3:184514925-184514947 AAAAACATAAATAAGAAGCTGGG + Intronic
967538538 3:190636667-190636689 AAAAGCATAAAGATGCTGATAGG - Intronic
968072373 3:195793339-195793361 AAAAAAATACAGAAATAGCTGGG + Intronic
968245867 3:197146778-197146800 AAAAACAAAGATATGCAGATGGG + Intronic
968279886 3:197468439-197468461 AAGAAAATAAAGATGCAGCTGGG + Intergenic
968387708 4:157271-157293 AAAAACATACAAAATTAGCTGGG - Intronic
968410228 4:384143-384165 AAAAACACACAGTTCCAGCCTGG + Intronic
969030788 4:4211602-4211624 AAAAACAGACAGTAGAAGCTGGG + Intronic
970230909 4:13909996-13910018 AAAACCCTACAAATGCAGGTGGG + Intergenic
970362369 4:15322673-15322695 AAAGACACACAGAGGTAGCTGGG - Intergenic
971228103 4:24773842-24773864 TAAAAAATACAGATACAGCTGGG + Intergenic
971652115 4:29291509-29291531 AAAAACTTCCAGATGGACCTAGG - Intergenic
972551493 4:40139437-40139459 AAATACATAGACATGCAGTTGGG + Intronic
973368947 4:49229803-49229825 AAAGACATACAGGTACAGCTCGG - Intergenic
973392096 4:49565612-49565634 AAAGACATACAGGTACAGCTCGG + Intergenic
973722660 4:53741121-53741143 GATAACTTACTGATGCAGCTTGG + Intronic
974157412 4:58092243-58092265 AAGAACATACATGTGAAGCTGGG - Intergenic
974454606 4:62110782-62110804 AAAAAGAAACAAATCCAGCTGGG - Intergenic
974783084 4:66580276-66580298 AAAAATATATAGATACAGATAGG + Intergenic
975699956 4:77054833-77054855 TAAAACCTACAGATGTAGCTAGG + Intronic
975989835 4:80247273-80247295 ACCAACACACAGATGCAGCCTGG + Intergenic
977255444 4:94735233-94735255 AAAAACAAACAAAAACAGCTGGG - Intergenic
978282251 4:107033459-107033481 TAAAACATAAAGAAGAAGCTAGG + Intronic
978342482 4:107733457-107733479 AAACACAGCCAGATCCAGCTTGG + Intergenic
978401336 4:108334227-108334249 AATAGCATTCAGATGCAGATTGG - Intergenic
978687862 4:111469535-111469557 AAAAACATACAGAATCAGGAGGG - Intergenic
979280851 4:118866103-118866125 ACAAACATACACATGCATCAAGG - Intronic
979893173 4:126126136-126126158 AAACACTTAGAGATGAAGCTGGG + Intergenic
980127191 4:128785538-128785560 AAAAACATACAGAATAGGCTGGG - Intergenic
980943588 4:139298118-139298140 AAAAACTTATAGATACATCTTGG - Intronic
982052779 4:151518966-151518988 CAAAAAATTAAGATGCAGCTAGG - Intronic
982106461 4:152015737-152015759 AAAAACACAAAGGAGCAGCTGGG - Intergenic
982108830 4:152034578-152034600 AAAAACAAACAAATGCTCCTTGG - Intergenic
982253298 4:153428731-153428753 AAAGACGTACAGAGGCAGGTTGG - Intergenic
982753810 4:159194513-159194535 AAAATCATCCAGTTGGAGCTGGG - Intronic
983079152 4:163364176-163364198 AAAAATAGGCAGATGCGGCTGGG + Intergenic
983506831 4:168562527-168562549 AAAAAGATAAAGATGCAGGCTGG + Intronic
984182453 4:176500548-176500570 AAAAACATATATATGTAGCTGGG - Intergenic
984721877 4:182980127-182980149 TAAAAGATACAGAACCAGCTGGG + Intergenic
986287149 5:6367712-6367734 AAACTCATTCAGATGGAGCTTGG + Intergenic
986996484 5:13613121-13613143 TAAAACATACAGATGGGGTTGGG + Intergenic
987356038 5:17063700-17063722 AAAAACATACAGTTTAGGCTGGG + Intergenic
987540478 5:19248116-19248138 GACACCATACAGGTGCAGCTTGG - Intergenic
988738156 5:34043424-34043446 GAAAACATACACAACCAGCTGGG + Exonic
988746302 5:34142134-34142156 TAAAAGAAACAGAGGCAGCTGGG + Intergenic
989283986 5:39678116-39678138 AAAAAAAAACAGAAACAGCTGGG - Intergenic
989468034 5:41781062-41781084 AAAAAAATACAAAATCAGCTGGG - Intronic
990014827 5:51047140-51047162 AAATACATGCAGATGCCACTAGG + Intergenic
991273648 5:64816997-64817019 AAATAGATTCAGATGCAGATAGG - Intronic
991299225 5:65112689-65112711 AAAAAAAAAAAGATTCAGCTGGG + Intergenic
991404393 5:66287872-66287894 AAAAATATACAAAAGTAGCTGGG + Intergenic
991597156 5:68317309-68317331 AAAAATGTGCAGATGCATCTTGG - Intergenic
992700959 5:79341747-79341769 AAAAACACACAAATTAAGCTGGG - Intergenic
992838243 5:80661090-80661112 AAAACCAGACAAAGGCAGCTGGG - Intronic
992919804 5:81503157-81503179 AAAAAACAACAGATGCAGCTGGG + Intronic
993307170 5:86287890-86287912 CAAAACATACAGAGGCTGCCTGG - Intergenic
994003170 5:94805465-94805487 AAAAACAAAAAAATGTAGCTGGG + Intronic
994705608 5:103202223-103202245 AAAATATTACATATGCAGCTGGG + Exonic
994827255 5:104730220-104730242 AAAAACATGCAGAGGTAGTTAGG + Intergenic
995255922 5:110046524-110046546 AAAACCATACAGAAGGAGTTGGG + Intergenic
996336505 5:122389315-122389337 AACAACACACAGATGATGCTGGG - Intronic
996489264 5:124073474-124073496 TAAAACACACAGATGCAGCCTGG - Intergenic
997950073 5:138235596-138235618 AAAAACATTCAGCTTCAGCTGGG + Intergenic
999332662 5:150687367-150687389 AAAAACAGACTGATGGGGCTGGG + Intergenic
999545004 5:152618182-152618204 AAACATATACAGATGGAGGTGGG - Intergenic
999709068 5:154300381-154300403 AAAACCATCCAGGTGCAGCCAGG - Intronic
999950323 5:156642446-156642468 AAAAAAAGACTGATGCTGCTAGG - Intronic
1001046846 5:168380307-168380329 ATAAAAATACAGAATCAGCTGGG + Intronic
1001224564 5:169932606-169932628 ACAAACATACAAATCCAGCCTGG - Intronic
1001409048 5:171497242-171497264 ACAAACAAACATAAGCAGCTAGG - Intergenic
1001599641 5:172920500-172920522 AAAAACATATAGCTGGAGCCAGG - Intronic
1001623696 5:173111518-173111540 GAAAGAATACAGATTCAGCTGGG - Intronic
1001975996 5:175999175-175999197 TGAAACATACAAATTCAGCTGGG + Intronic
1002177187 5:177407787-177407809 AAAAAAAAAAAGATGCAGATGGG + Intronic
1002241429 5:177844597-177844619 TGAAACATACAAATTCAGCTGGG - Intergenic
1003721170 6:8704103-8704125 AAAAACAAAAAGATGCCACTAGG - Intergenic
1004303210 6:14476931-14476953 AAGAAAATACAGCTGGAGCTGGG + Intergenic
1004682961 6:17914497-17914519 AAAATCATACACATGCAAATGGG + Intronic
1004797421 6:19103143-19103165 AAAAACATCTAGGGGCAGCTAGG + Intergenic
1005228312 6:23669725-23669747 TGAAACATACAGATCCAGCAGGG - Intergenic
1005487344 6:26313614-26313636 AAAAAATTACAGTTGCAGCGAGG + Intergenic
1005544449 6:26850367-26850389 TAAAAGAAACAGAGGCAGCTGGG + Intergenic
1005702732 6:28418825-28418847 AAAAAAAAAAAGATGCAGCTAGG + Intergenic
1005911921 6:30318219-30318241 AAAAACAGACACATGCAGTCTGG - Intergenic
1006475911 6:34253691-34253713 AAAAAAAGACACTTGCAGCTGGG + Intergenic
1006550760 6:34821249-34821271 AAAAACAGACAGAGGGAGCCGGG - Intronic
1007350203 6:41267595-41267617 AAAAACACACACATTAAGCTAGG + Intergenic
1007885037 6:45217913-45217935 AAAAACATATATATGAAGCAAGG + Intronic
1009015237 6:57891995-57892017 TAAAAGAAACAGAGGCAGCTGGG + Intergenic
1009274242 6:61654852-61654874 GAAAAGATACAGCTGCTGCTGGG + Intergenic
1009637785 6:66287882-66287904 AAAAACTTAAAGATTCAGATAGG - Intergenic
1009797616 6:68492060-68492082 AAATACATACAGATATAGCCGGG - Intergenic
1011616813 6:89204855-89204877 AAGAAAATACAGATGCAGAATGG - Intronic
1012898015 6:104974192-104974214 AAAAAAATGCAGATTCAGGTTGG + Intronic
1013262077 6:108454354-108454376 AAAAACTTACAGCTTCATCTGGG - Intronic
1013638807 6:112053677-112053699 GAAAAAATACAGATGGAGCAGGG - Intergenic
1014539886 6:122662632-122662654 AAAAACATAAAGATGAGGCATGG + Intronic
1015716039 6:136192877-136192899 GAAAACATACAGATGAACATGGG - Exonic
1015741578 6:136460784-136460806 AAAAATCTTCAGATGCACCTTGG - Intronic
1015940185 6:138441982-138442004 GACAACATACAGAAGGAGCTAGG - Intronic
1019099454 6:169616868-169616890 AAAAGCATACATCTGAAGCTTGG + Intronic
1019387479 7:765854-765876 AAAAACATACAGAAGTAGCCAGG - Intronic
1019624262 7:2008084-2008106 CAAATCATACAGATAAAGCTGGG + Intronic
1020015825 7:4831028-4831050 AAAAAAATACAAAATCAGCTGGG + Intronic
1021020675 7:15594711-15594733 AAAAACAAACAAATGAAACTTGG + Intergenic
1021570692 7:22062168-22062190 AAAGACATACAGGTGCAGCCAGG - Intergenic
1022006243 7:26268088-26268110 AAAAAGATACAAATTTAGCTGGG + Intergenic
1023448847 7:40260209-40260231 AAAAACATACAGAAGCACAGAGG - Intronic
1024663640 7:51523063-51523085 GAAAACTTAGAGATGCTGCTGGG + Intergenic
1026276721 7:68885362-68885384 ATAAACATACCGATGCTGTTGGG + Intergenic
1026402000 7:70023495-70023517 AAAAACTTACAGAGTCACCTGGG - Intronic
1026974039 7:74485624-74485646 AAAAAAAAATAGATGCAGCTGGG + Intronic
1026982911 7:74537112-74537134 AAAAATACAAACATGCAGCTGGG + Intronic
1027329780 7:77079670-77079692 GACAACATACAGATCCATCTGGG + Intergenic
1027446655 7:78281243-78281265 AAATACATACTGATGTGGCTTGG + Intronic
1028656010 7:93207788-93207810 AGAGACATCCAGAGGCAGCTGGG + Intronic
1029785982 7:102791669-102791691 GACAACATACAGATCCATCTGGG - Intronic
1031550132 7:123100223-123100245 AAAAACATGCAGATAAAGTTTGG - Intergenic
1031897084 7:127362977-127362999 AAAAACATTCAGAGGCAGGATGG + Intronic
1032393417 7:131571754-131571776 AAAATCATACAGGTAGAGCTGGG + Intergenic
1032960868 7:137032655-137032677 AAAAAAATACAGATGCTTGTGGG + Intergenic
1033990860 7:147284895-147284917 TGAAACATACAGAAGCTGCTAGG + Intronic
1034211814 7:149370338-149370360 AAAAAAATACAGATGAGGCCAGG - Intergenic
1036536073 8:9653936-9653958 AAAACCATGCAGATGCAGACAGG - Intronic
1037536067 8:19826061-19826083 AAAAATTTAAAAATGCAGCTAGG - Intronic
1038160916 8:25036568-25036590 AAAAACTTAAAGATTCATCTTGG - Intergenic
1038792749 8:30683119-30683141 AAAAAAATAAAGATTCAGCTGGG - Intronic
1041089079 8:54285343-54285365 AAAAAAAAAAAGATCCAGCTGGG + Intergenic
1041255153 8:55973633-55973655 AAAAATTTACAGTTGCAGTTTGG + Intronic
1041591451 8:59589994-59590016 AAAAACTTAGAGATGGATCTAGG + Intergenic
1042676094 8:71324087-71324109 AAAAACATAGACATAGAGCTAGG - Intronic
1042888607 8:73581150-73581172 AAAAACAAACACATAAAGCTAGG + Intronic
1043097275 8:75991273-75991295 AAAAGCACACTGATGCATCTGGG - Intergenic
1043270933 8:78332057-78332079 AAAAAAAGAAAGATTCAGCTTGG - Intergenic
1043418832 8:80078697-80078719 AAAAACAAACTCATGTAGCTAGG - Intronic
1044503262 8:92987909-92987931 ACACAGATACAGATGCAGATAGG + Intronic
1044674165 8:94712962-94712984 AAAAACATATAGAATCAGCCGGG - Intergenic
1044893026 8:96857292-96857314 ATAAACATGCAGATGCCCCTCGG - Intronic
1045577973 8:103446590-103446612 AAAAACATACACACCTAGCTGGG - Intergenic
1047904964 8:129463104-129463126 AAAGACATACAGATGAAGAAAGG + Intergenic
1048570104 8:135645498-135645520 TAAAACATAAAGATGAAGGTGGG - Intronic
1048856788 8:138693225-138693247 CCAAACACACAGATGCAGCCAGG - Intronic
1049636421 8:143691937-143691959 GATGACATACAGCTGCAGCTCGG + Intronic
1050717712 9:8548661-8548683 AAAAAAATCCAGCTCCAGCTGGG - Intronic
1051657400 9:19396251-19396273 AAAAAAAAAAAAATGCAGCTTGG - Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053310144 9:37012952-37012974 AAAAATATATAGATTAAGCTAGG + Intronic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1055731271 9:79281474-79281496 AAAAACATACATATACACCTGGG + Intergenic
1056225989 9:84495898-84495920 AAAAAAAGACAGACGCAGCCGGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057135664 9:92686096-92686118 AAAAAAATCCGGATTCAGCTGGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058553653 9:106142420-106142442 ACAAAGAAACAGAAGCAGCTCGG + Intergenic
1059096147 9:111416918-111416940 AAAAACTTACAAAAGCAGATGGG + Intronic
1059097591 9:111435383-111435405 AAACACATACAGAGGCATATTGG + Intronic
1059517538 9:114909701-114909723 AAAGATAGACAGGTGCAGCTGGG - Intronic
1059805709 9:117798246-117798268 AAAACCAGGCAGAGGCAGCTGGG - Intergenic
1059860743 9:118458383-118458405 AAAAATAAATAGATGCAGATAGG + Intergenic
1059965277 9:119607894-119607916 AAAATTAGACAGAAGCAGCTTGG - Intergenic
1061457288 9:130708191-130708213 AAAAATATAAAAATTCAGCTGGG - Intergenic
1062152485 9:135028883-135028905 AAAAACACAAAAATTCAGCTGGG + Intergenic
1186635846 X:11403966-11403988 AAAAAGACACAGATGCAGAAAGG + Intronic
1187671984 X:21676861-21676883 ATAAACATACAGATACAGATAGG + Intergenic
1187865724 X:23721386-23721408 AAAAAAATAGAGATGGGGCTGGG - Intronic
1188814696 X:34698092-34698114 ATATACATACATATGCATCTAGG - Intergenic
1189003223 X:36967596-36967618 AAAAACACACAGATATGGCTGGG + Intergenic
1189123155 X:38416794-38416816 AAAAACTTACAAATTCAACTTGG - Intronic
1190515674 X:51221553-51221575 AAAGACATAGAGATCCAGCCAGG + Intergenic
1191980780 X:66923316-66923338 AAAAACATAAAAATGAAGGTAGG - Intergenic
1192475775 X:71441173-71441195 GAAAATATACAGATGGGGCTTGG - Intronic
1193313513 X:80037267-80037289 AATGACATACAGAAACAGCTGGG + Intergenic
1194713512 X:97263880-97263902 AAAAACTAACAGTTGGAGCTGGG - Intronic
1195300143 X:103521674-103521696 AAAAACAAACACATGAAACTGGG + Intergenic
1195768302 X:108320024-108320046 ACATAGATACAGATGCAGGTAGG + Intronic
1195940759 X:110166044-110166066 AAAAACATGCAGGTGAGGCTGGG - Intronic
1196436182 X:115676680-115676702 ACAAAAATAAAGAAGCAGCTTGG + Intergenic
1197680197 X:129374669-129374691 AAAAAGAAACAGATTCAGCGAGG - Intergenic
1198880676 X:141277717-141277739 AAAAAAATACAGTGGCATCTAGG - Intergenic
1199549844 X:149047344-149047366 AAAAGAATACAAATGGAGCTGGG - Intergenic
1199764652 X:150932184-150932206 AAAAACAGAAAAATTCAGCTGGG + Intergenic
1199839470 X:151629921-151629943 AAAAATATTCTGATGCAGCAAGG + Intronic
1200153122 X:153961163-153961185 AAAAACAAACAGTGGCAGCCTGG - Intronic