ID: 1178704891

View in Genome Browser
Species Human (GRCh38)
Location 21:34864902-34864924
Sequence CCACTGTGTTTCCACCTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 204}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178704891_1178704895 17 Left 1178704891 21:34864902-34864924 CCATGAAGGTGGAAACACAGTGG 0: 1
1: 0
2: 0
3: 35
4: 204
Right 1178704895 21:34864942-34864964 ACTCTCAAGGCAACCTACTTAGG 0: 1
1: 0
2: 2
3: 5
4: 83
1178704891_1178704893 -6 Left 1178704891 21:34864902-34864924 CCATGAAGGTGGAAACACAGTGG 0: 1
1: 0
2: 0
3: 35
4: 204
Right 1178704893 21:34864919-34864941 CAGTGGTGATTCATTCAGTGTGG 0: 1
1: 0
2: 1
3: 10
4: 138
1178704891_1178704894 4 Left 1178704891 21:34864902-34864924 CCATGAAGGTGGAAACACAGTGG 0: 1
1: 0
2: 0
3: 35
4: 204
Right 1178704894 21:34864929-34864951 TCATTCAGTGTGGACTCTCAAGG 0: 1
1: 0
2: 1
3: 7
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178704891 Original CRISPR CCACTGTGTTTCCACCTTCA TGG (reversed) Intronic
900274273 1:1813520-1813542 CCACTGTGTTTCAGCCTGCACGG - Intronic
903364230 1:22796096-22796118 CCACTGTATTTCCAGGTTCTAGG - Intronic
904213872 1:28904314-28904336 CCACTGTGTCCCCACTTCCAGGG + Intronic
905911032 1:41654810-41654832 ACACTGTGTTTCTCCCTGCAGGG - Intronic
908206347 1:61854072-61854094 CCTCTGTGTTTCAAACATCAGGG - Intronic
908823550 1:68112769-68112791 TCATTAGGTTTCCACCTTCAAGG - Intronic
909508086 1:76417810-76417832 CCAATGTGGCTCCACCTTCAGGG + Intronic
909524763 1:76610507-76610529 CCACTTTGTTCCCAGCCTCAGGG - Intronic
911387877 1:97199810-97199832 CCACAGTACTTCCACCTTCATGG - Intronic
912324933 1:108748394-108748416 CACCTGTGTTCCCACCTACATGG + Intronic
912985656 1:114427198-114427220 CCATTGTGATCCCACCTTCTGGG - Exonic
917262665 1:173187090-173187112 GCACTGTGTTTCTACCTGCAGGG + Intronic
917437447 1:175035633-175035655 CCTCTGTGTTTCTAACATCAAGG + Intergenic
919918599 1:202154323-202154345 CCCCTGTGCTTCCACCTTCCAGG - Exonic
921311690 1:213850998-213851020 CAACTGTGTTTATACCTTCTAGG + Intergenic
923783376 1:237044611-237044633 CCACTGTGTCACCTCCTTCAAGG - Intronic
1063477860 10:6344375-6344397 CCACTGTCTTTCCTCCTCCCTGG - Intergenic
1064769122 10:18705664-18705686 CCCATGTGTTTCTACCTTCTCGG + Intergenic
1064944202 10:20770240-20770262 CCACCCTGCTCCCACCTTCAAGG - Intergenic
1067539998 10:47144230-47144252 CCTCTGTGTTGCCACCATCCAGG + Intergenic
1070697358 10:78572941-78572963 CCTCTGTGTTTCCACATACCTGG - Intergenic
1071509937 10:86255066-86255088 CCACTGTGTCTCCTGCTCCATGG + Intronic
1072200173 10:93150930-93150952 CCACTTTGTTTCCATCCTCCGGG + Intergenic
1073863073 10:107769851-107769873 ACACTGTGTTGCCCCCTTTAGGG - Intergenic
1075236539 10:120736071-120736093 CCACTATGTTTCTTCCTCCAGGG + Intergenic
1076203124 10:128573544-128573566 TTACTGTGTTTCCACCTGGAGGG + Intergenic
1079013003 11:16845172-16845194 CCACAGTGTGTTCATCTTCAAGG + Intronic
1079362731 11:19782759-19782781 CCACTGCCTTTCCACCTCCCTGG - Intronic
1079729237 11:23920234-23920256 GCCCTGTGTTTCTTCCTTCAGGG + Intergenic
1081327530 11:41763992-41764014 CCACTGTCTTTTCACTTGCAAGG - Intergenic
1081685680 11:45041574-45041596 TCACTGTGGTTCTGCCTTCATGG + Intergenic
1082063396 11:47879539-47879561 CCCCTGTGCCTCCACCTTCAGGG + Intergenic
1082972926 11:59042807-59042829 CCACTGTTCCTTCACCTTCAGGG - Intronic
1082977330 11:59086377-59086399 CCACTGTTCCTTCACCTTCAGGG - Intergenic
1083167279 11:60898429-60898451 CCAGTGTCTCTCCACCTTCAGGG + Intronic
1084370279 11:68737419-68737441 CCAGTGTGTTTCCAGATTCACGG + Intronic
1084427331 11:69092101-69092123 CCACAGTTTTTCTATCTTCATGG + Intergenic
1085016025 11:73174565-73174587 CCACTCTGTCTCCAACCTCATGG - Intergenic
1087921413 11:103871084-103871106 CATCTGTGTTTCCACTTTCCAGG - Intergenic
1088624078 11:111716194-111716216 CCACTGTGTCTGCATTTTCAGGG - Intronic
1093746011 12:22741829-22741851 CCACTGAGCTGCCACCCTCAGGG - Intergenic
1094479842 12:30872908-30872930 CCCCTGTCTGTCAACCTTCATGG - Intergenic
1094650286 12:32369494-32369516 CCACTGTGTTTCCACACTTGTGG - Intronic
1096862233 12:54538121-54538143 CCGCTGTGTTTCCTCCTGGAAGG - Intronic
1097693994 12:62759823-62759845 CCACCCTGTTTCCACTTTCCTGG + Intronic
1097694005 12:62759860-62759882 CCACCCTGTTTCCACTTTCCTGG + Intronic
1099896819 12:88658671-88658693 CCACTGTGATTCCATCATAAAGG - Intergenic
1100609048 12:96175880-96175902 CCAATGTTTTCACACCTTCAAGG - Intergenic
1103214880 12:119194310-119194332 CCACTGTGCTTCCACATGCCTGG + Exonic
1108762693 13:53588810-53588832 CCAATGTGCTTCCACTTTCTTGG + Intergenic
1108923319 13:55703842-55703864 CCACAGTGTTTCAACCTTCCAGG + Intergenic
1110938371 13:81319707-81319729 CCACTGTGTTCCAACCCTCGTGG - Intergenic
1113530441 13:111020602-111020624 GCCCTGTGTCTCCACCTCCAGGG - Intergenic
1113954972 13:114095278-114095300 CCACTGTGTTTACACTTAAAGGG - Intronic
1115441884 14:33445024-33445046 CCATTGTGTTCCCACCTTCTAGG + Intronic
1115980956 14:39050844-39050866 CCATTGTGCATCCAACTTCAGGG - Intronic
1116809194 14:49523251-49523273 CCACCCTGTTTCCATCTTCTTGG + Intergenic
1118785149 14:69039442-69039464 CCACTGTGTTTCCACAGGAAGGG + Intergenic
1123800002 15:23809573-23809595 CCACTGTGTTTTCACAGTGATGG - Intergenic
1123995635 15:25716199-25716221 CCAATGTGTCTCCAGCTGCATGG + Intronic
1128107218 15:65054010-65054032 ATACTGTGTTTCTACCTGCAGGG + Exonic
1128306684 15:66603571-66603593 CCACACTGTTCCCACCTCCAGGG + Intronic
1128713194 15:69887407-69887429 CCACTGTGCTGCCACATTTAGGG + Intergenic
1129118445 15:73379777-73379799 CCACTGAATTTCCGCCTTCATGG + Intergenic
1129357637 15:75002288-75002310 CCCCTGTGTCTCCCTCTTCACGG + Intronic
1131293549 15:91128125-91128147 AAACTGTGTTTCCACCCTCTGGG + Intronic
1131457721 15:92596488-92596510 CCCCTGTGTTGCCACTTTCTGGG + Intergenic
1133821340 16:9239236-9239258 CCTCTATGTTGCCAACTTCAAGG + Intergenic
1140410398 16:74737602-74737624 CCACTCTGTCCCCACCTTCTAGG + Intronic
1141633336 16:85301002-85301024 CCAGTGTGTTCCCTCCTCCAGGG + Intergenic
1141768154 16:86072209-86072231 CCACTGTGGTCCCATCCTCAAGG + Intergenic
1141864007 16:86737334-86737356 GCACTGTGAGTCCAGCTTCACGG + Intergenic
1143883481 17:10048547-10048569 CCACTGAGTTTAAAGCTTCACGG + Intronic
1145064465 17:19752783-19752805 CCACTGTGTCCACACCTTCTGGG + Intergenic
1151744145 17:76002503-76002525 CCACAGTGTCACCACCTGCAGGG - Exonic
1152168004 17:78723467-78723489 CCAGCGAGTTTCCACCTGCAGGG - Intronic
1152569628 17:81116030-81116052 CCACTGGGTCTCGCCCTTCAGGG - Intronic
1152615523 17:81336139-81336161 CCCCTGTCTGTCCACCTTCAGGG + Intergenic
1153954406 18:10083838-10083860 CCACTTTGGATCCACCTTCAAGG + Intergenic
1155325422 18:24659882-24659904 CCACTTTCTTTCCAGCTTTATGG - Intergenic
1158689798 18:59650074-59650096 CCACTTGGTTCCCAGCTTCAAGG + Intronic
1160612230 18:80097310-80097332 GCCCTTTGTTTCCAGCTTCAAGG - Intergenic
1168454492 19:56495737-56495759 CCCCTCTGTTGCCACCTTCAGGG - Intergenic
1168571804 19:57476786-57476808 CCTCTGTGCTTCCATCTTCAAGG + Intronic
929192509 2:39152612-39152634 CCACTGAGTTTCCTCCTTGAAGG + Intergenic
931944980 2:67296297-67296319 CCACTGTGCTTCCTCCTGTATGG - Intergenic
936985909 2:118311179-118311201 CCTCTGTGTTTCCCACTTCTGGG + Intergenic
939126094 2:138179124-138179146 CCACTGTGTTTACACTTTGAAGG + Intergenic
939562201 2:143745313-143745335 ACACTGTGACTTCACCTTCAGGG + Intronic
941231310 2:162915456-162915478 CCATTGTGTTTCACCCTTCATGG - Intergenic
941736655 2:168984648-168984670 TCACTGAGTTTCCATTTTCATGG + Intronic
943969638 2:194386735-194386757 CCGCTGTGTTTCACCCTTCACGG - Intergenic
945975247 2:216265353-216265375 CCAATGTCTCTCCACCTTCCGGG + Intronic
946743655 2:222825246-222825268 CCACTGAGTTTCTACCCTGAGGG - Intergenic
948340682 2:237248897-237248919 ATACTTTGTTCCCACCTTCAGGG + Intergenic
1168816640 20:742256-742278 CCACTGTGTTGCCTCCTTGAAGG - Intergenic
1169693420 20:8358896-8358918 GCACTGTGCTTCCACCTTTCAGG + Intronic
1170776487 20:19379285-19379307 CCCATGTGTTTCTGCCTTCAGGG + Intronic
1171142958 20:22758749-22758771 TGACTGTGTTTTCACATTCAAGG - Intergenic
1171354670 20:24534596-24534618 GCCCTGTGTTTCTTCCTTCAAGG + Intronic
1172450816 20:35021331-35021353 CCATTGTGTTCCCTCCTCCAGGG - Exonic
1173305871 20:41848712-41848734 CCCATTTGTTTCCACATTCAAGG - Intergenic
1173339576 20:42141391-42141413 CCAGTGTGACTCCACCTTCTTGG + Intronic
1174285315 20:49468712-49468734 CCTCTCTCTTTCCACCTTCAAGG - Intronic
1175543897 20:59765731-59765753 CCACTGTGTTTTCAGCACCATGG + Intronic
1175832249 20:61971786-61971808 CCACTGTGTGCCCACCCTCAGGG - Intronic
1178346216 21:31830566-31830588 CCACAATGTTTCCATATTCAGGG + Intergenic
1178349723 21:31864106-31864128 GCACTGTGCTTCCTTCTTCATGG - Intergenic
1178426460 21:32482800-32482822 CCACTGTCCTGCCCCCTTCAGGG + Intronic
1178704891 21:34864902-34864924 CCACTGTGTTTCCACCTTCATGG - Intronic
1179403166 21:41102798-41102820 CCTCTGTTTTCCCACCTGCAGGG - Intergenic
1180907875 22:19428163-19428185 CCAGTCTGATTCCACATTCAAGG + Intronic
1180912971 22:19466054-19466076 CCACTGTGAGTCCAACTTGAGGG + Intronic
1182578864 22:31291754-31291776 CTCCGGTGTTTCCTCCTTCACGG + Intronic
1184517505 22:44971693-44971715 ACACTGTGCCTCCACCTCCAGGG + Intronic
1184801767 22:46765275-46765297 CCTCTGTGACTCCTCCTTCAGGG - Intronic
1185092885 22:48785883-48785905 CCATTTTGTTTACACTTTCAGGG - Intronic
949188926 3:1227810-1227832 CCATTTTGCTTCCACCTTCAAGG - Exonic
950722890 3:14897550-14897572 CCAATGTGTCTCTGCCTTCATGG - Exonic
951642306 3:24849794-24849816 CCACAGAATTTCCACCTGCAAGG - Intergenic
953036988 3:39220704-39220726 TTCCTGTGTTGCCACCTTCAGGG + Intergenic
953403028 3:42643235-42643257 TCACTGTATTTTCACCTTGATGG + Intronic
955467301 3:59250558-59250580 CCACTGCTTTTCCACATGCAAGG - Intergenic
955858118 3:63296407-63296429 GGACTGTGTTTGCATCTTCAAGG + Intronic
956079819 3:65546276-65546298 CCACTGAGATACCACCTCCATGG - Intronic
956329354 3:68088376-68088398 TCACACTGTTTCCACCTTCCTGG - Intronic
956355493 3:68387776-68387798 AAACTGTTTTTCCCCCTTCATGG + Intronic
959111053 3:102123467-102123489 CCCCTGTGTATCCACATTCTTGG - Intronic
959811316 3:110622945-110622967 CCAAAGTGTTCCCACCTGCATGG - Intergenic
960741310 3:120836533-120836555 CCACTGTTTTTCCTCCTCAAAGG + Intergenic
961941466 3:130641827-130641849 CCACTTTTTTCCCACCTTTATGG + Intronic
963451766 3:145490811-145490833 CCAGTGTGTTTCACCCCTCATGG - Intergenic
964651504 3:159016298-159016320 CCACTGGGTAACCACCTTCTCGG - Intronic
966332492 3:178829973-178829995 CCACCGTGTAACCACCTTAAGGG + Intronic
966731561 3:183155737-183155759 ACACACAGTTTCCACCTTCACGG - Intronic
966801132 3:183765117-183765139 CCACTGTGGTTCTGGCTTCAGGG + Intronic
967113461 3:186316146-186316168 CCACAGTGTTTGGACCTTCAAGG - Intronic
968049883 3:195647247-195647269 CCACTGGGTCTCCAGCTGCACGG + Intergenic
968049893 3:195647294-195647316 CCACCGGGTCTCCAGCTTCACGG + Intergenic
968097382 3:195941249-195941271 CCACCGGGTCTCCAGCTTCACGG - Intergenic
968097427 3:195941437-195941459 CCACCGGGTCTCCAGCTTCACGG - Intergenic
968097438 3:195941484-195941506 CCACCGGGTCTCCAGCTTCACGG - Intergenic
968304226 3:197638642-197638664 CCACCGGGTCTCCAGCTTCACGG - Intergenic
968304237 3:197638689-197638711 CCACCGGGTCTCCAGCTTCACGG - Intergenic
968304280 3:197638877-197638899 CCACCGGGTCTCCAGCTTCACGG - Intergenic
969655295 4:8493853-8493875 CCTCTGATTTTCCACCTTCATGG + Intergenic
970273540 4:14372452-14372474 CCAGTTTCTTTCCACCCTCACGG + Intergenic
971052453 4:22876526-22876548 CCACTGTGTTACAACCTCCCTGG + Intergenic
971189408 4:24413190-24413212 AGACTGTGTTTTCCCCTTCAAGG + Intergenic
973579730 4:52331368-52331390 CCACTCTCTTTCCACAATCAAGG - Intergenic
976523136 4:86053328-86053350 CCACTGTGTATACATGTTCAAGG - Intronic
977560693 4:98530537-98530559 TCACTTTGTTTCAACTTTCATGG - Intronic
979878882 4:125929070-125929092 CCACTGTGTTTCTGCCTTTAGGG - Intergenic
980408158 4:132380899-132380921 CCACTGGATTTCAAACTTCATGG - Intergenic
981538562 4:145825121-145825143 ACACTGTGTCCCCTCCTTCACGG - Intronic
984668529 4:182455261-182455283 CCACTCTGTTCCCACCATCAGGG + Intronic
985127180 4:186706359-186706381 CCCTTTTGTTTCCATCTTCATGG + Intronic
985741574 5:1620192-1620214 CCACTGAGTCTCCAGCTGCATGG - Intergenic
987016525 5:13825983-13826005 AAATTGAGTTTCCACCTTCAGGG + Intronic
993347128 5:86798076-86798098 CCACTTTGTTCCAACCTGCATGG + Intergenic
994191669 5:96875787-96875809 CCATTGTGATCCCTCCTTCAAGG - Intronic
995045662 5:107643570-107643592 TCACTGTGTTTCAAGCATCAGGG + Intronic
995102204 5:108326017-108326039 CCACTGAGTTTACACTTTAAGGG + Intronic
995344240 5:111092903-111092925 TAATTATGTTTCCACCTTCAAGG - Intronic
995741838 5:115363996-115364018 CCACTGTGTTCCACCCTTCGTGG + Intergenic
998560837 5:143170246-143170268 CCACTGTTTTTGCATGTTCATGG - Intronic
998977217 5:147661595-147661617 ACACTGTATTCCCAGCTTCAAGG - Intronic
1000517578 5:162258309-162258331 CCATAATTTTTCCACCTTCAAGG - Intergenic
1002946030 6:1762076-1762098 CCTCTGTGTTTCTCACTTCATGG - Intronic
1003621910 6:7708050-7708072 CCAATAGGTTTCCAGCTTCATGG - Intergenic
1005011743 6:21342361-21342383 CCACTGAGTACCCACTTTCAGGG + Intergenic
1005066064 6:21818889-21818911 CCACTGCCTTACCACCTCCAAGG + Intergenic
1006343342 6:33459528-33459550 CCACTTTGTTGCCATCTTGATGG - Intergenic
1006506822 6:34494566-34494588 CAACTGTGGTTCCACCTACTTGG - Intronic
1006613548 6:35310153-35310175 TCACTGTGTTTCCAGGTTCTTGG + Intronic
1006786026 6:36667870-36667892 CCATTGTGTTACCCCCTCCAGGG - Intergenic
1008491132 6:52088379-52088401 GCCCTGAGTCTCCACCTTCAAGG + Intergenic
1008536378 6:52509226-52509248 CCTCTGGGTTTCTACCTTCTTGG - Intronic
1008623586 6:53295978-53296000 CCACTGAGATTTCAGCTTCACGG - Intronic
1011684837 6:89815808-89815830 CCACTGTGTTTCCAGTGCCAAGG + Intronic
1013510354 6:110839116-110839138 AAACTGTGTTTCATCCTTCAAGG + Intronic
1014629854 6:123774883-123774905 CCTCTCTGTTTCCACCTTCTCGG + Intergenic
1014724547 6:124959504-124959526 CCCCTGTGTTTCCAGCCTCTGGG - Intergenic
1014748713 6:125231036-125231058 CCTCTGTCTTTCCACTTTCGTGG + Intronic
1015705528 6:136083606-136083628 CCATTGGGTTTGCAACTTCAGGG - Intronic
1016424405 6:143918387-143918409 CCACTGTGTTTCATCCTCCATGG + Intronic
1019290940 7:249908-249930 CCCCTATGTTTCCATCTTGAAGG + Intronic
1019646519 7:2132478-2132500 CGACTGCGTGTCCACCATCACGG + Intronic
1020636567 7:10702613-10702635 CCACTGACTTTCCACCTTAATGG - Intergenic
1023796633 7:43798907-43798929 TCTCTGTGTTTCCACATCCATGG - Intronic
1026764821 7:73154078-73154100 CCACAGAGGTTCCTCCTTCATGG - Intergenic
1027041294 7:74963848-74963870 CCACAGAGGTTCCTCCTTCATGG - Intergenic
1027082346 7:75238528-75238550 CCACAGAGGTTCCTCCTTCATGG + Intergenic
1027358254 7:77381304-77381326 CCACTCTATTTCCATCTTCTTGG + Exonic
1027625325 7:80537458-80537480 TCACTTTGTTCCCACATTCAAGG + Intronic
1027828627 7:83149348-83149370 CCATTTTCTTTCTACCTTCAAGG + Intronic
1030619867 7:111777163-111777185 CCACTGTGTTCTGACCTTCATGG - Intronic
1034674500 7:152882846-152882868 CCTCTGTGTGCCCATCTTCACGG + Intergenic
1035044076 7:155952665-155952687 CCACTGTGTTTCTCCCCTCCTGG - Intergenic
1035318961 7:158016045-158016067 CCGCTGTTTTTCCTCGTTCAGGG + Intronic
1036464157 8:8980662-8980684 CTACTGTGCTTCCACCTCCCAGG + Intergenic
1036605815 8:10304526-10304548 TCACTGTTTTTGGACCTTCAGGG - Intronic
1037748326 8:21663625-21663647 CCACTGTATTTCTGCCTTCTGGG - Intergenic
1038310086 8:26439770-26439792 CCACTAAGGTTCCACCTACAAGG - Intronic
1039081419 8:33737655-33737677 CCATTATTGTTCCACCTTCAAGG - Intergenic
1039327966 8:36505464-36505486 TCACGGTGGTTCCACCCTCATGG - Intergenic
1039698494 8:39938794-39938816 CCACTGTGTTTCTTCTTTGATGG - Intronic
1039762362 8:40591360-40591382 CCACTGCATCTCCACCCTCAAGG + Intronic
1041755308 8:61307150-61307172 CCACTGTTTTTTCCCCATCAAGG - Intronic
1042259050 8:66837870-66837892 CCACATTGTTTTCACCTTGAAGG + Intronic
1046438010 8:114219353-114219375 CCACTGGGTTTGCAGCTGCAGGG - Intergenic
1046757367 8:117985530-117985552 CCACTGTGTCTACATGTTCAGGG + Intronic
1046920461 8:119722797-119722819 CCACTGTTTTTCCATGTTCTAGG - Intergenic
1047045474 8:121047957-121047979 GCATTGTGTTTCCAAGTTCAGGG + Intergenic
1047266401 8:123313712-123313734 CCACTTTGTACCCACCTGCATGG + Intergenic
1047500895 8:125440479-125440501 CCTCTGTTTTTTCAACTTCAGGG - Intergenic
1048415822 8:134226642-134226664 CTAATGTATTTCCAACTTCATGG + Intergenic
1048443912 8:134479168-134479190 TCTCTGTGTTTCCACACTCAGGG + Intronic
1049751403 8:144286022-144286044 CGGCTGAGTTTCCACCTGCAGGG + Intronic
1049862232 8:144907357-144907379 CCACTGTACTTCCACCAGCATGG - Intergenic
1050850068 9:10273798-10273820 CCATTGTGTTTTAACCTTTATGG - Intronic
1051122169 9:13763224-13763246 GCACTGTGTTTCCTCCTTAGGGG + Intergenic
1057102028 9:92370604-92370626 CCACTGTGTTCCCAGCTACTTGG - Intronic
1058731662 9:107856239-107856261 CAACTTTCTTTTCACCTTCAGGG + Intergenic
1059773107 9:117446508-117446530 CCTCTGTGTTTCTTCCCTCAAGG + Intergenic
1061798792 9:133103262-133103284 CCATTGGGTGTCCACCTTCCAGG - Exonic
1062574335 9:137199536-137199558 CCACTGTGCCTCGACCTCCAGGG + Exonic
1185561293 X:1062371-1062393 CTACTGTGTTGCCACCTCCAGGG + Intergenic
1189890542 X:45597555-45597577 CTTCAGTGTTACCACCTTCAGGG - Intergenic
1190138140 X:47816002-47816024 CCGTTGTGTTGCCACCTTCCTGG + Intergenic
1192560599 X:72125573-72125595 CCACAGTGCTTCCTGCTTCAGGG + Intergenic
1192563937 X:72146992-72147014 CCTCTGTCTTTGCACGTTCAAGG - Intergenic
1192635336 X:72810558-72810580 CCACTGTGTTTCAACATACTGGG - Intronic
1192646378 X:72910245-72910267 CCACTGTGTTTCAACATACTGGG + Intronic
1193382539 X:80832156-80832178 ACATTGTGTTTCCATTTTCATGG - Intergenic
1195687996 X:107602731-107602753 CCTCCGTGTGTCCACCTTCGAGG + Exonic
1196816151 X:119666913-119666935 ACACTGTGTTCCCACCTCCAAGG - Intronic
1200056782 X:153465768-153465790 CCACTGGGTCTCCTCCTTCAGGG + Intronic
1200150995 X:153951431-153951453 CCACTGGTTTTCCTTCTTCATGG + Exonic
1202054799 Y:20818620-20818642 CCACTTTGGTTCAACCTCCATGG - Intergenic