ID: 1178707761

View in Genome Browser
Species Human (GRCh38)
Location 21:34889203-34889225
Sequence GGCCTCCGCTTCCAGGGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178707745_1178707761 7 Left 1178707745 21:34889173-34889195 CCCCAGATCCTGCGCGGCCGCCC No data
Right 1178707761 21:34889203-34889225 GGCCTCCGCTTCCAGGGCGGGGG No data
1178707741_1178707761 29 Left 1178707741 21:34889151-34889173 CCGGGCTGCAGCCCGCGGACGGC No data
Right 1178707761 21:34889203-34889225 GGCCTCCGCTTCCAGGGCGGGGG No data
1178707746_1178707761 6 Left 1178707746 21:34889174-34889196 CCCAGATCCTGCGCGGCCGCCCA No data
Right 1178707761 21:34889203-34889225 GGCCTCCGCTTCCAGGGCGGGGG No data
1178707752_1178707761 -10 Left 1178707752 21:34889190-34889212 CCGCCCAGGGCCAGGCCTCCGCT No data
Right 1178707761 21:34889203-34889225 GGCCTCCGCTTCCAGGGCGGGGG No data
1178707747_1178707761 5 Left 1178707747 21:34889175-34889197 CCAGATCCTGCGCGGCCGCCCAG No data
Right 1178707761 21:34889203-34889225 GGCCTCCGCTTCCAGGGCGGGGG No data
1178707743_1178707761 17 Left 1178707743 21:34889163-34889185 CCGCGGACGGCCCCAGATCCTGC No data
Right 1178707761 21:34889203-34889225 GGCCTCCGCTTCCAGGGCGGGGG No data
1178707742_1178707761 18 Left 1178707742 21:34889162-34889184 CCCGCGGACGGCCCCAGATCCTG No data
Right 1178707761 21:34889203-34889225 GGCCTCCGCTTCCAGGGCGGGGG No data
1178707750_1178707761 -1 Left 1178707750 21:34889181-34889203 CCTGCGCGGCCGCCCAGGGCCAG No data
Right 1178707761 21:34889203-34889225 GGCCTCCGCTTCCAGGGCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178707761 Original CRISPR GGCCTCCGCTTCCAGGGCGG GGG Intronic