ID: 1178708508

View in Genome Browser
Species Human (GRCh38)
Location 21:34893596-34893618
Sequence CATTATATGTAGATATTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 294}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178708508 Original CRISPR CATTATATGTAGATATTCAA AGG (reversed) Intronic
900597369 1:3487988-3488010 CAATAATTGTAGATATTCATCGG + Intergenic
903195500 1:21683991-21684013 ATTTATATGTAGACATACAATGG - Intronic
904868224 1:33599345-33599367 TATTATATCTAGATATTGACAGG - Intronic
907059134 1:51403221-51403243 TTTTATATGTATAAATTCAAGGG + Intronic
908139211 1:61166211-61166233 CATTATAGGTAGATATTGAATGG - Intronic
908279990 1:62523197-62523219 AAATTTATGTAGATATACAAAGG + Intronic
908614203 1:65899663-65899685 CATTATATATATATATAAAATGG - Intronic
909350008 1:74640834-74640856 CCTTATCTCTACATATTCAATGG - Intronic
909767900 1:79380848-79380870 CATTATATGTAGAAAAACACTGG + Intergenic
910086570 1:83410434-83410456 GATTATTTGTAGCTATCCAAAGG + Intergenic
910451163 1:87346978-87347000 CCTGATATGTACAAATTCAAAGG + Exonic
911995354 1:104758694-104758716 AATTATATGCAGATAGTAAAAGG + Intergenic
912489575 1:110054542-110054564 AATTATATATAGATATTTACAGG - Exonic
916472578 1:165138415-165138437 CATTGTATGGAAATATTCAGGGG - Intergenic
916496354 1:165351917-165351939 CATTACATGAAGATAATCAAAGG - Intronic
918349517 1:183639526-183639548 CAGTTGATGTAGATATTCATAGG - Intronic
919112983 1:193242751-193242773 CAGTATATCTAAATATTAAAAGG + Intronic
919146022 1:193636044-193636066 CATTATATTTACAAATTAAACGG + Intergenic
919217940 1:194584336-194584358 CATTATATTTAGATTTTCTCTGG + Intergenic
921035069 1:211369276-211369298 AATTATAGGAAGATATTCACAGG - Intronic
922313429 1:224418637-224418659 CTTTATATGTGGATTTTCTAGGG + Intronic
923407044 1:233672047-233672069 CTTTATATGTACATAGTTAATGG - Exonic
1064361554 10:14670037-14670059 CATAATATTTACATATTCATGGG - Intronic
1065234401 10:23633875-23633897 CTCTATATGTATATATCCAAAGG - Intergenic
1065514928 10:26515609-26515631 CATTATTTTTATAGATTCAAGGG - Intronic
1068340863 10:55700310-55700332 CAAAAAATGTAGTTATTCAATGG - Intergenic
1068829487 10:61477161-61477183 CATTATATTCAGATAATAAAAGG - Intergenic
1069134298 10:64744966-64744988 CATTAGATGTATATATTTACTGG + Intergenic
1069258579 10:66365004-66365026 CAGTAAATGTATATATTAAATGG - Intronic
1070218166 10:74408578-74408600 CATTGTATGTGGATTTTCGAAGG - Intronic
1072491550 10:95910710-95910732 GATTAAATATAGATATTCTATGG - Intronic
1072975874 10:100057325-100057347 AATAATATGTACATATTCATGGG + Intronic
1073563666 10:104517760-104517782 CAGTATATGAAAATATTCGAAGG + Intergenic
1073842740 10:107516664-107516686 CATTATATGTTGTTATCCATGGG - Intergenic
1078965825 11:16340936-16340958 CATTATAAATAGATATTTTAGGG - Intronic
1079751853 11:24209761-24209783 CTTTATTTGTAGAATTTCAAGGG - Intergenic
1079764680 11:24377056-24377078 CATAATGTTTAGGTATTCAATGG - Intergenic
1082986284 11:59173111-59173133 CTTTCTATGTAGAAATTCTAGGG + Intronic
1085212506 11:74793984-74794006 CATGATATATATATATTCATTGG + Intronic
1086048877 11:82565691-82565713 CATTATGAGTAGATTATCAAAGG + Intergenic
1088393341 11:109340437-109340459 GATTATCTGTAGATATATAATGG + Intergenic
1090114789 11:123957103-123957125 CATTATGGGTGTATATTCAAAGG - Intergenic
1091599083 12:1907259-1907281 CATGATATGCACATATTAAAGGG - Intronic
1092456439 12:8647787-8647809 CATTCTATGTACAATTTCAAGGG - Exonic
1092681682 12:10989440-10989462 CTTTCTATGTATATATCCAAAGG - Intronic
1092980718 12:13791702-13791724 TATTATATGTACATATTTTAAGG + Intronic
1093360784 12:18225166-18225188 TATAATATGTAAATATTCACAGG - Intronic
1093683446 12:22029903-22029925 CATTATAAATTGAAATTCAATGG + Intergenic
1094244813 12:28276858-28276880 AATTATATGTATATTTTTAAAGG + Intronic
1095623010 12:44281204-44281226 AATTATACGTAAATATTTAAAGG - Intronic
1098060156 12:66553372-66553394 AATTATCAATAGATATTCAATGG - Intronic
1098861797 12:75718903-75718925 CATTGTATGTACATCTTCAATGG + Intergenic
1099153208 12:79141346-79141368 CATTATTTGTACATTTCCAAAGG - Intronic
1099362010 12:81714977-81714999 AATTATCTGTAAATAGTCAATGG + Intronic
1099876286 12:88410016-88410038 CATTTTATGTAAATAGCCAAAGG - Intergenic
1103887272 12:124212085-124212107 CATTATATGGAAATATGGAAAGG - Intronic
1104243328 12:127012939-127012961 TAGTATATTTAGATATTTAAAGG - Intergenic
1106610425 13:31274090-31274112 CAATACATGTAAATATTTAAGGG + Intronic
1108197301 13:48007819-48007841 CATTATAGGTAGATAATTATAGG - Intergenic
1109410976 13:61969303-61969325 CATTAAATGTAAATATTATAGGG + Intergenic
1109470963 13:62802864-62802886 TATTTTATTTATATATTCAATGG - Intergenic
1109508701 13:63339234-63339256 TATTATTTGTATATATTTAAAGG - Intergenic
1109731991 13:66424292-66424314 CATTATGTGAAGAAAGTCAATGG - Intronic
1109903752 13:68809992-68810014 AATTATACTTAGATTTTCAAAGG - Intergenic
1109938851 13:69332247-69332269 AATTAAATGGAGATTTTCAATGG + Intergenic
1110430763 13:75420403-75420425 CATAATTTTTAGATTTTCAAAGG + Intronic
1111114773 13:83760778-83760800 GATTATATGAAGGTATTTAATGG + Intergenic
1111233628 13:85378517-85378539 CATTATAAATAGATATAAAATGG - Intergenic
1111551950 13:89824832-89824854 TATTATATGTAAATATTCATTGG + Intergenic
1111674581 13:91370718-91370740 CATTATAATTACATACTCAAGGG - Intergenic
1112048426 13:95621033-95621055 CATTATATGTGGATTCTCCATGG - Intronic
1112447187 13:99474871-99474893 CAGTAGATGCAGAGATTCAAGGG - Intergenic
1112626291 13:101108216-101108238 GATTAAATGTACATATTTAATGG + Intronic
1112667563 13:101594017-101594039 TATTATATGTACATATTTATGGG - Intronic
1113295124 13:108951332-108951354 CATGATATGAAGTTAATCAATGG + Intronic
1113349596 13:109515603-109515625 AGTTATATGAATATATTCAAGGG + Intergenic
1114372857 14:22109730-22109752 TATTATATGTTTATATTCAATGG + Intergenic
1115156560 14:30346476-30346498 CATTATATATATATATATAATGG + Intergenic
1115403034 14:32985082-32985104 GATTATTTGTTGATATTCATGGG + Intronic
1115955688 14:38776701-38776723 TATTATACATACATATTCAAAGG - Intergenic
1116126199 14:40788856-40788878 CATTAAATGTATATATACTATGG - Intergenic
1116694755 14:48158922-48158944 ATTTATATTTAGATATTTAAAGG - Intergenic
1116743533 14:48788081-48788103 AATTATATGTATATATTTAATGG - Intergenic
1116766352 14:49075271-49075293 AATTCTGTGAAGATATTCAATGG + Intergenic
1117553868 14:56864403-56864425 AATTATATGTATATATAAAAAGG + Intergenic
1120903617 14:89599254-89599276 CATTGTAAGTACACATTCAATGG + Intronic
1124224154 15:27875494-27875516 CAATTTATGTAGACATTCAAAGG - Intronic
1124476144 15:30036629-30036651 CATTTAATGTAGATATTTAATGG + Intergenic
1124952237 15:34334417-34334439 ATTTAGATGTAGATCTTCAAAGG - Intronic
1125368544 15:38945477-38945499 CATGATGTGTAGAAATGCAAGGG + Intergenic
1127552675 15:60056562-60056584 AATTATAAGTAAATATGCAAAGG - Intronic
1128560120 15:68659264-68659286 AGTTATATGTGGATTTTCAATGG - Intronic
1130500173 15:84491416-84491438 CATTATATTTAGAAATTAAATGG - Intergenic
1130700800 15:86178411-86178433 CAATTTCTGTAGATATGCAAAGG + Intronic
1131865868 15:96708893-96708915 CAATATTTATAGATATTCACAGG - Intergenic
1133387573 16:5382449-5382471 CATTATATGTAGATACCAGAAGG - Intergenic
1134482637 16:14632561-14632583 CATTTTATGTAGAAAATCACAGG - Intronic
1137552439 16:49448456-49448478 CATAATATATAGATATTAAAAGG - Intergenic
1141371603 16:83491765-83491787 TATTATATGTACATTTTCACGGG - Intronic
1144029902 17:11310337-11310359 CATTATGTGAAGTTATACAATGG - Intronic
1146664628 17:34690270-34690292 CTTTATTTGTAGAAATTCATAGG + Intergenic
1147118972 17:38324172-38324194 CACTATTTTTACATATTCAAAGG - Intergenic
1147199134 17:38788063-38788085 ATTTGTATGAAGATATTCAAAGG - Intronic
1149008858 17:51834252-51834274 CATCATATGTTGCTTTTCAAAGG - Intronic
1149096309 17:52845010-52845032 CATAATGTGTATATATTCATGGG + Intergenic
1149199759 17:54169989-54170011 CATTATATACAGACAGTCAAAGG - Intergenic
1150867079 17:68863409-68863431 CATTTAATGTAGTTATTCATAGG - Intergenic
1151287464 17:73123298-73123320 TATTATATGTAGTTTTTTAAAGG - Intergenic
1154180363 18:12133058-12133080 GATTATAGGAAGATATTTAATGG - Intergenic
1155292838 18:24358520-24358542 AATTATATGTATATATTTCAAGG + Intronic
1155734348 18:29202313-29202335 TACTATATGTAGAGATTCAGGGG - Intergenic
1156224175 18:35086623-35086645 AATTATATGTAAAAATTGAAAGG - Intronic
1157495082 18:48151218-48151240 CATTTTATGCAGCTATTAAAAGG - Intronic
1158826952 18:61232478-61232500 CATAATATGTAGATTCTGAAGGG + Intergenic
1159326174 18:66922115-66922137 CTTTTTATGTACATATTCAGAGG + Intergenic
1159406379 18:68007651-68007673 CATTAGTTGTAAATTTTCAAAGG - Intergenic
1159650604 18:70973199-70973221 AATTCTATGAAAATATTCAAAGG - Intergenic
1159993995 18:74943910-74943932 CATAATTTGTAGAAATTCGAAGG - Intronic
1162178985 19:8853891-8853913 TATTATTTGTATATATTTAAGGG - Intronic
1164922418 19:32098792-32098814 AATTATATGTAGAGTTTCAAAGG + Intergenic
1167170750 19:47830002-47830024 TATAATATTTATATATTCAAAGG - Intronic
1168560600 19:57379600-57379622 CAATCTATGTAGATATTTAGTGG + Intronic
925459938 2:4052962-4052984 CATAATATGTACATATTTATGGG + Intergenic
926532668 2:14069940-14069962 CGTTATATGTAGTTTTTCCACGG - Intergenic
926890020 2:17631161-17631183 AATTAAATGTGAATATTCAAAGG + Intronic
927258422 2:21061315-21061337 CATGATATATAAATATTCTAAGG - Intergenic
928500165 2:31883386-31883408 CATTTTATCTAGATGTTCAATGG + Exonic
928631381 2:33196270-33196292 CAATATACTGAGATATTCAAAGG - Intronic
928833170 2:35513210-35513232 AATTATATGAAGAAAGTCAATGG + Intergenic
930497084 2:52159628-52159650 CAATAAATGTATATATTTAAGGG + Intergenic
931120156 2:59207735-59207757 CATAATATGTAGAGAAACAATGG + Intergenic
931921192 2:67017406-67017428 CCTTATGAGTAAATATTCAAAGG + Intergenic
932480306 2:72035213-72035235 CATTATATGCATGTATTCTATGG - Intergenic
932739896 2:74283392-74283414 CATCATAGGAAGAGATTCAATGG + Intronic
932967724 2:76497177-76497199 CATTATATGCAGATATTTCAGGG - Intergenic
933092151 2:78134935-78134957 ACTTCTAGGTAGATATTCAAGGG - Intergenic
934088172 2:88527491-88527513 CCTTATATGTATATATTCTTTGG + Intronic
936786804 2:116103206-116103228 AATTATATGAAGAAAGTCAATGG + Intergenic
936900814 2:117480381-117480403 CATTAAAGGTAGATCTTTAAGGG - Intergenic
937691370 2:124759414-124759436 CATTATATATATATATATAATGG + Intronic
937963003 2:127476955-127476977 CAATAAATGAAGATATTCCATGG + Intronic
938173899 2:129106687-129106709 CATGATCTGAAAATATTCAATGG + Intergenic
939039570 2:137171994-137172016 AATTATATGTTAATATTCACAGG - Intronic
939065201 2:137475193-137475215 CATTATATATCAATTTTCAAAGG - Intronic
939542945 2:143515766-143515788 ACTTATATGTAGAAAATCAATGG + Intronic
939650180 2:144750952-144750974 CATTCTCTGTAGATATAAAAAGG + Intergenic
939746870 2:145983545-145983567 CATTATATTCATATACTCAAAGG - Intergenic
940634867 2:156286705-156286727 TATTTTATGTAGATATGCAAAGG + Intergenic
941394086 2:164952846-164952868 TATTATATGCAGAAATTGAAGGG - Intronic
941421637 2:165290099-165290121 CAGTATTTGTACATATTCATGGG + Intronic
941786176 2:169500990-169501012 AACTATATGAAAATATTCAAGGG - Intronic
942584778 2:177463843-177463865 CATTTTTTGGAGATATTTAAGGG + Intronic
942588717 2:177516899-177516921 CTTAAAATGTAAATATTCAAGGG + Intronic
943744219 2:191444599-191444621 CATTTTTTCTAGATACTCAAAGG - Intergenic
945279149 2:208018884-208018906 CTTTATATGTAGATATAGAGTGG - Intronic
1172834924 20:37867213-37867235 GGTTATATGTACATCTTCAAGGG + Intronic
1173373879 20:42465091-42465113 CATTATATGTAATTATTATATGG + Intronic
1174957183 20:55111377-55111399 CAATCTATGGAGATATCCAAAGG - Intergenic
1176894607 21:14361725-14361747 CATTATATGCAGTAATTCCATGG - Intergenic
1177130668 21:17250428-17250450 GGTTATATGTAGATATTATAGGG - Intergenic
1177591016 21:23167901-23167923 AATTATATGAAGAAAGTCAATGG + Intergenic
1177822373 21:26045629-26045651 CACTGTATCTAGATAGTCAATGG + Intronic
1178708508 21:34893596-34893618 CATTATATGTAGATATTCAAAGG - Intronic
1178840084 21:36131117-36131139 CATTTTATCTAGATGTTCAATGG - Intergenic
1178979778 21:37253861-37253883 GAGTATTTGTAGATATTTAATGG - Intronic
1179932172 21:44578214-44578236 CAGAATCTGTAGATATTTAAAGG + Intronic
1180659212 22:17451243-17451265 CATTACAGGTAGATTTTTAAAGG + Intronic
1182136656 22:27910655-27910677 CATTTTCTGTATATATTCAAAGG - Intronic
1182941159 22:34278851-34278873 AAATGTATGTATATATTCAATGG + Intergenic
950976018 3:17246202-17246224 GATTATATGTAGAAAAACAAAGG + Intronic
951349197 3:21584672-21584694 CATTATTTGTAGAAAATAAAGGG - Intronic
952615568 3:35268339-35268361 TATTCTATGTACATATCCAAAGG + Intergenic
952652443 3:35742534-35742556 CATAACATATGGATATTCAAGGG - Intronic
953123123 3:40065249-40065271 CATTATAAGAAGATGGTCAAAGG - Intronic
953292433 3:41678892-41678914 TATTATATTTATATACTCAATGG + Intronic
955389567 3:58511097-58511119 CATTGTATGTATAAATGCAAGGG - Intronic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
956624961 3:71258049-71258071 CATACTATGTAGATATTCGTAGG - Intronic
959027841 3:101261530-101261552 TATTATATTTAGATGTCCAATGG - Intronic
960719284 3:120609935-120609957 CATTATACATATATATCCAAAGG - Intergenic
962594742 3:136929496-136929518 CATTATTTTTAGTTTTTCAATGG + Intronic
962963211 3:140330441-140330463 CATTTTATGTGTTTATTCAAAGG + Intronic
963218661 3:142780688-142780710 CATTTTCTGTGGATAATCAAAGG - Intronic
963994411 3:151690994-151691016 CATTAAAAGTAGATTTTTAAAGG - Intergenic
964289445 3:155160751-155160773 CTTTATATAGATATATTCAAGGG - Intronic
964435900 3:156653101-156653123 AATTACATGTACATGTTCAAAGG + Intergenic
965137675 3:164793663-164793685 CATAATATTTATATATTCATAGG - Intergenic
965373010 3:167888463-167888485 CATTTTATCTAGATGTTCAGTGG - Intergenic
966127058 3:176591192-176591214 CTATAAATGTAAATATTCAAAGG - Intergenic
970938026 4:21597445-21597467 CATTGTGTGAAGATATTCATGGG - Intronic
971199395 4:24498329-24498351 CATCATAAGTAAATATTTAAGGG - Intergenic
975331390 4:73118522-73118544 CATTAAATGTAGATATATACAGG - Intronic
977446167 4:97135901-97135923 CATTATATATACATATAGAATGG + Intergenic
977639185 4:99335871-99335893 CTTTATATGTAGATATTGGGTGG - Intergenic
980138813 4:128890855-128890877 CATCATATGTAAATAATAAAAGG - Intronic
980160168 4:129151491-129151513 CATTATCTGTAGAAATTCTGTGG + Intergenic
980336074 4:131475071-131475093 TATTCTGTGAAGATATTCAATGG + Intergenic
981602423 4:146505470-146505492 AGTTATATGTGGATTTTCAACGG + Intronic
982212364 4:153048697-153048719 CATTATTGGTATATACTCAAAGG - Intergenic
982344336 4:154340251-154340273 CATTAAATGAAGATATTAAAGGG + Intronic
982593789 4:157352109-157352131 AATTATATGTAGATATTTACTGG + Intronic
982604244 4:157493925-157493947 AAGTATAAGCAGATATTCAATGG + Intergenic
983844310 4:172497741-172497763 CATTATTTTTAGATATTCTCTGG + Intronic
984251340 4:177339129-177339151 AATTGTATATAGATTTTCAATGG - Intronic
984395334 4:179190690-179190712 AATTTTATGGATATATTCAAAGG + Intergenic
984550366 4:181152255-181152277 CAGTATATGCAAATATTCAAAGG - Intergenic
985275202 4:188231378-188231400 CAATGTGTGCAGATATTCAAAGG - Intergenic
985469587 5:31127-31149 TATTATATCTAGAATTTCAATGG + Intergenic
985504089 5:268714-268736 GATTATATTTAAATATTAAAAGG + Intergenic
986639361 5:9857380-9857402 CATTGTATGCAGGTATCCAAAGG + Intergenic
987151946 5:15050879-15050901 CAATAGATATACATATTCAATGG - Intergenic
987631993 5:20485595-20485617 CATTATATGAAAAAATTAAAAGG - Intronic
987647355 5:20691023-20691045 CACCAGATGTAGATATTCCATGG + Intergenic
987721962 5:21647551-21647573 CATTATTTGCAAATATTCATGGG + Intergenic
987801737 5:22706198-22706220 CAAAATATGTAGATATTGAATGG - Intronic
988147844 5:27332904-27332926 CATTATATGTGTTTATTAAAAGG + Intergenic
989182048 5:38587905-38587927 CATTAGGTGTAGGGATTCAAAGG + Intronic
990246493 5:53868242-53868264 GATTAAATGTAGGTATACAAAGG - Intergenic
991070005 5:62466728-62466750 CAATATATGAAGATATACAAAGG - Intronic
992427611 5:76674029-76674051 TATTAAAGGTAGATTTTCAAGGG + Exonic
997103028 5:130989443-130989465 TATTTTATGGAGATATTAAAAGG + Intergenic
998173968 5:139889314-139889336 GTTTATATATATATATTCAATGG - Intronic
998752876 5:145342521-145342543 CATTTTATATATATATTCAGTGG - Intergenic
999319305 5:150603512-150603534 GCTTATATGTGGATATTCATTGG + Intronic
1002403556 5:179009945-179009967 AAATATATGTAGAAAATCAAAGG + Intergenic
1002838403 6:884971-884993 TATTATTTGTAGATATACAGTGG + Intergenic
1004603487 6:17173157-17173179 GATTCTATCTCGATATTCAAAGG - Intergenic
1005878304 6:30032658-30032680 CATTATATTCAGATTTTCATAGG - Intergenic
1006218158 6:32463853-32463875 CATTTTATATATATATTTAAAGG - Intergenic
1006999217 6:38293284-38293306 AATTCTATGAAGAAATTCAATGG - Intronic
1008379663 6:50826764-50826786 CCTTATATGTTTATATTCATGGG - Intronic
1009498819 6:64385128-64385150 CATGATACTTAGATATTCAGAGG + Intronic
1009860157 6:69318808-69318830 CATTTTATGTAGCTTGTCAAGGG + Intronic
1009959929 6:70506910-70506932 CTTTATAGCTTGATATTCAATGG + Intronic
1010148311 6:72698552-72698574 CATTATATGAACATGTTGAAAGG + Intronic
1010465126 6:76158626-76158648 AATTATATGAAGAAAGTCAATGG + Intergenic
1011567303 6:88689975-88689997 CATTATATGTTGGTAGTGAAGGG - Intronic
1012060574 6:94474200-94474222 CATTATATATATATATTTATTGG + Intergenic
1014272807 6:119351822-119351844 GATTATAGGTACATATTAAAGGG + Intergenic
1014904788 6:127012689-127012711 CAATATATGTTGAATTTCAAAGG - Intergenic
1015599499 6:134898504-134898526 CATTTTATCTAGATGTTCAATGG - Intergenic
1017690339 6:156957617-156957639 CATCATTTGTATACATTCAAGGG - Intronic
1019850983 7:3556949-3556971 CAGTATGTGTAAATATTTAAGGG - Intronic
1020493499 7:8818745-8818767 CATTATATATTGACATACAATGG - Intergenic
1020584707 7:10051939-10051961 AATTCTGTGAAGATATTCAATGG - Intergenic
1022513001 7:30953321-30953343 CAATATATGTATATATGAAAGGG + Intronic
1024152530 7:46587387-46587409 CATAATAGGTAGAAATTAAATGG + Intergenic
1024503523 7:50140567-50140589 CATTAAATGTAGAAATTAAGAGG - Intronic
1024750563 7:52460473-52460495 AATTGTGTGAAGATATTCAAAGG + Intergenic
1024752845 7:52488831-52488853 CATTCTCTGTAGAAATTTAAGGG + Intergenic
1024869627 7:53947919-53947941 CATGAATTGTAAATATTCAAGGG + Intergenic
1027303448 7:76866916-76866938 GATTATTTGTAGCTATCCAAAGG + Intergenic
1027403022 7:77828284-77828306 CATTATAATTAGCTATTTAAAGG + Intronic
1027769536 7:82389177-82389199 CATTATGTGTATATATGTAAAGG + Intronic
1027835555 7:83236787-83236809 CATAATATGAAGATATACACAGG - Intergenic
1027886029 7:83906180-83906202 AATTAAATGTAGATTTTGAAAGG + Intergenic
1028545150 7:91990840-91990862 CATTATCTGAAAATATTAAATGG + Intronic
1030079470 7:105764752-105764774 CTTTATATGTAACTTTTCAATGG + Intronic
1030395329 7:108979274-108979296 AATTATGTGAAGAAATTCAATGG + Intergenic
1030442824 7:109609920-109609942 CAATATATGCAGAAACTCAAAGG + Intergenic
1030471649 7:109971359-109971381 CATATTAGGTATATATTCAAAGG + Intergenic
1030474730 7:110016286-110016308 CATTATATATACATAAACAATGG - Intergenic
1031716876 7:125119169-125119191 CACTATCTGTTGATATTCAGAGG + Intergenic
1033496808 7:141907167-141907189 CATTATTTGTAGTTCTTCTAGGG - Intergenic
1033668753 7:143469211-143469233 CACTATATTCAGATTTTCAAAGG + Intergenic
1034742167 7:153485940-153485962 TATTATATATATATATGCAATGG + Intergenic
1034813251 7:154150752-154150774 GAATAAATGTAGATATTAAAGGG - Intronic
1036542052 8:9725014-9725036 TATTACCTGTAGATATTGAAAGG + Intronic
1037035928 8:14166840-14166862 CATTAAATGTAAATAAGCAAAGG + Intronic
1038384135 8:27125191-27125213 CATAATATGTACATATTTATGGG + Intergenic
1038641829 8:29335063-29335085 CATTAGATGTAGACTCTCAAAGG + Exonic
1040970610 8:53133047-53133069 CCTTATGGGTAAATATTCAAAGG + Intergenic
1043187176 8:77168139-77168161 CATTATATTTTCATATTTAATGG + Intergenic
1043272267 8:78350173-78350195 CATTTTAAGTAGATAGTCACAGG + Intergenic
1043299774 8:78713391-78713413 CATTATGTGTATATATTCATGGG + Intronic
1044182488 8:89212942-89212964 CATTCTATTTGGATCTTCAATGG - Intergenic
1044342635 8:91064953-91064975 AATTATTTGTTGATATTAAAGGG + Intergenic
1044653981 8:94528624-94528646 CATTATTTTTAAAAATTCAAGGG - Intronic
1045088941 8:98718673-98718695 CATAATATGTAAATATTTAGTGG - Intronic
1046519922 8:115310827-115310849 TATTATTTGTATATTTTCAATGG - Intergenic
1046532466 8:115465586-115465608 CAGTATATGTATCTTTTCAATGG - Intronic
1048662919 8:136627192-136627214 CATTATGTGTACATGTTTAAAGG + Intergenic
1048712222 8:137225011-137225033 CAGAATAAGTAGATATTCACTGG + Intergenic
1054345463 9:63910285-63910307 TCTTATCTGTATATATTCAAAGG - Intergenic
1054885542 9:70194047-70194069 CATCATATGTAGCAATTCCAAGG + Intronic
1055250771 9:74302430-74302452 TATTATATGTATATTTTAAATGG - Intergenic
1056552124 9:87660487-87660509 TATTATTTGTATATATTCATAGG + Intronic
1058242000 9:102575479-102575501 AATTATATTTACATATTAAATGG + Intergenic
1059118894 9:111623808-111623830 CCTTATATGAAGAAATTCAATGG + Intergenic
1059806596 9:117807771-117807793 CATTCTATGTATATAATTAATGG + Intergenic
1062311354 9:135939242-135939264 CCTTATATGTACATATTTTATGG - Intronic
1185843638 X:3416788-3416810 TATTATATTTAGACCTTCAATGG + Intergenic
1185989964 X:4882714-4882736 TATTATTTGGAGATATTAAAAGG + Intergenic
1186048226 X:5560388-5560410 CAAGATAAGTATATATTCAAAGG - Intergenic
1186139873 X:6560593-6560615 CATATTATATAGATATTCATGGG + Intergenic
1187799943 X:23050361-23050383 CATTATATATAGGAATTCAGAGG + Intergenic
1188684232 X:33049569-33049591 CAGTCTATGCAGAGATTCAATGG - Intronic
1188949065 X:36346082-36346104 CTTTAAATGTAGACATTCATAGG + Intronic
1189139369 X:38585587-38585609 CAAAATATGTAATTATTCAATGG + Intronic
1189708960 X:43789464-43789486 AATTAGATGTAAATATTCAAGGG + Intronic
1189723466 X:43944697-43944719 CATTATATGCTATTATTCAAGGG + Intergenic
1190034469 X:47008556-47008578 CACTATATGTTTATAGTCAATGG + Intronic
1191626262 X:63274543-63274565 CATTTTATGAAGAAATTCAAGGG + Intergenic
1192045319 X:67665833-67665855 CATTTTATGCATATATTCCATGG - Intronic
1192155440 X:68742968-68742990 CATTATATATATATACACAATGG + Intergenic
1192622173 X:72689198-72689220 CATAAGAAGTATATATTCAACGG + Intronic
1192901588 X:75504185-75504207 CATTATAAGTAGATAAGAAATGG + Intronic
1192997583 X:76528528-76528550 CATTATAAGTATATACTCAAAGG - Intergenic
1193114275 X:77761229-77761251 CTTTTTATGTATATATTTAAAGG + Intronic
1193862915 X:86693347-86693369 CAGTATATGTAAAGATTGAAGGG - Intronic
1194241846 X:91458906-91458928 CATAATATATAGATATTACATGG - Intergenic
1194793944 X:98186701-98186723 AATTATAAATATATATTCAAAGG - Intergenic
1194863334 X:99032590-99032612 CATTAAATGTAGAAATGCATTGG - Intergenic
1196780631 X:119380742-119380764 CCTTATTTGTTTATATTCAAAGG - Intergenic
1197902269 X:131386942-131386964 CATTATTTGTAGTAATTAAAAGG - Intronic
1201776452 Y:17671170-17671192 GATTATTTGTAGATATTACAGGG + Intergenic
1201825104 Y:18234822-18234844 GATTATTTGTAGATATTACAGGG - Intergenic
1202099943 Y:21296792-21296814 CATTGTATGTAGACCTTCATGGG - Intergenic
1202151819 Y:21850571-21850593 GATTATTTGTAGATATTATAGGG + Intergenic
1202267036 Y:23030554-23030576 CTTTATCTCTATATATTCAATGG - Intergenic
1202420028 Y:24664299-24664321 CTTTATCTCTATATATTCAATGG - Intergenic
1202450758 Y:25005785-25005807 CTTTATCTCTATATATTCAATGG + Intergenic