ID: 1178708533

View in Genome Browser
Species Human (GRCh38)
Location 21:34894134-34894156
Sequence GCTCAGCTTTAATAGGTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 131}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178708530_1178708533 -8 Left 1178708530 21:34894119-34894141 CCTGAAGTTACGTCAGCTCAGCT 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1178708533 21:34894134-34894156 GCTCAGCTTTAATAGGTGTTGGG 0: 1
1: 0
2: 1
3: 8
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178708533 Original CRISPR GCTCAGCTTTAATAGGTGTT GGG Intronic
901500194 1:9647939-9647961 GCTGAGCTTTAGTAGATCTTAGG - Intergenic
905602967 1:39269771-39269793 ACTCAGCTTTAATATGTTTGAGG - Intronic
911300395 1:96165832-96165854 GCTCAGCTTTCCAAAGTGTTAGG - Intergenic
912968241 1:114256184-114256206 GCTCAGCTTTAATGAGTTTTAGG - Intergenic
915731481 1:158057210-158057232 ACTCAGCTTTATTTGGGGTTTGG + Intronic
916711270 1:167411838-167411860 GGACAGCTTTACTAGGTGGTAGG + Intronic
917661928 1:177185347-177185369 ACACATATTTAATAGGTGTTTGG - Intronic
918384113 1:183987699-183987721 GCTCAGCATTTATAGGCATTTGG - Intronic
918487126 1:185041567-185041589 GCTTAGCATTAACAGGTGATTGG + Intergenic
920336222 1:205247140-205247162 CCTCAGCTTTGTTAGGTGTATGG + Intronic
921248291 1:213270838-213270860 GCTCAACATTATTAGTTGTTAGG + Intronic
921857568 1:220003212-220003234 GCTCAGCATCATTAGTTGTTAGG - Intronic
1065993945 10:31038938-31038960 ACTCAGCTCTCAGAGGTGTTTGG + Intergenic
1067297477 10:44982952-44982974 GTTCGGCTTGCATAGGTGTTGGG - Intronic
1068451136 10:57190402-57190424 TATCAGCTTTAATAGTTTTTTGG + Intergenic
1072398684 10:95073026-95073048 GCTGAGCTTTAAGAGTTCTTTGG + Intergenic
1073787044 10:106901088-106901110 GCTCAGCTATTTTAGGTGCTGGG - Intronic
1076377051 10:129997245-129997267 TATCAGTTTTAATAGGTTTTTGG - Intergenic
1076397109 10:130147789-130147811 CCTCAGCCTCAAGAGGTGTTGGG - Intronic
1076425282 10:130363175-130363197 GCTGAGCCTTACTTGGTGTTTGG + Intergenic
1076519268 10:131070266-131070288 GCTCAACTTCCATATGTGTTTGG - Intergenic
1079869410 11:25778547-25778569 GCACAGCTCTAGTAGGTGGTGGG + Intergenic
1081434745 11:43014833-43014855 GCACAGCTTTAAGGGGAGTTGGG + Intergenic
1083780529 11:64915155-64915177 GCACAGCTACACTAGGTGTTTGG - Intronic
1083810214 11:65100329-65100351 GCTCAGCATCATTAGGTCTTAGG + Intronic
1084164491 11:67368852-67368874 TTTCAGCTTGAATAGGTGTGAGG + Intronic
1087715995 11:101609447-101609469 TATCTCCTTTAATAGGTGTTTGG - Intronic
1091634834 12:2189148-2189170 GCTCAGCTTTTCTAAGTGTTGGG + Intronic
1097347644 12:58512159-58512181 TCTCAGCTTTATTAGGAGCTTGG + Intergenic
1102366572 12:112341722-112341744 GCTAAGACTTAATATGTGTTGGG + Intronic
1104828198 12:131729978-131730000 TCTCAGCTTTAAAAGGTTTTTGG - Intronic
1105488869 13:20867176-20867198 GGTCAGCTTTTATAGTTGTGTGG - Intronic
1106330560 13:28735419-28735441 CCTCAGCTTTCAAAAGTGTTGGG + Intergenic
1110379243 13:74830985-74831007 TATCAACTTTAATAGGAGTTTGG + Intergenic
1112415105 13:99197571-99197593 GTTCTGCTTTAATAGGTCTAGGG + Intergenic
1114699016 14:24658100-24658122 GCTCTGCTTTTATAGGAGTCCGG + Intergenic
1116054533 14:39846982-39847004 GTACAGCTTTTATAGGTGATTGG + Intergenic
1118543894 14:66863090-66863112 TCTCAGTTCTAATAGTTGTTTGG - Intronic
1122593144 14:102870040-102870062 TCCCAACTTTAATATGTGTTGGG - Intronic
1123145061 14:106121411-106121433 CCACAGCTTTATTAGGTGCTGGG - Intergenic
1123196427 14:106621205-106621227 CCACAGCTTTATTAGGTGCTGGG - Intergenic
1123204311 14:106697541-106697563 CCACAGCTTTATTAGGTGCTGGG - Intergenic
1123209320 14:106744014-106744036 CCACAGCTTTATTAGGTGCTGGG - Intergenic
1123584951 15:21751135-21751157 CCACAGCTTTATTAGGTGCTAGG - Intergenic
1131314779 15:91325658-91325680 TATCAGTTCTAATAGGTGTTTGG + Intergenic
1134091532 16:11394052-11394074 ACTCTGATTTAATTGGTGTTGGG + Intronic
1136694038 16:32060352-32060374 CCACAGCTTTATTAGGTGCTGGG + Intergenic
1136794532 16:33003615-33003637 CCACAGCTTTATTAGGTGCTGGG + Intergenic
1136865083 16:33742502-33742524 GATCAGCTTAAATATATGTTTGG + Intergenic
1136865213 16:33744376-33744398 GATCAGCTTAAATATATGTTTGG + Intergenic
1136875377 16:33850776-33850798 CCACAGCTTTATTAGGTGCTGGG - Intergenic
1138745304 16:59356221-59356243 GCTCAATTTGAACAGGTGTTCGG - Intergenic
1142124954 16:88405624-88405646 GCTCTGCTCTCATGGGTGTTTGG - Intergenic
1203096795 16_KI270728v1_random:1265266-1265288 CCACAGCTTTATTAGGTGCTGGG + Intergenic
1203126579 16_KI270728v1_random:1590645-1590667 GATCAGCTTAAATATATGTTTGG + Intergenic
1144420063 17:15088285-15088307 GGTCAGCTTTAAAAGGTATTTGG + Intergenic
1145110646 17:20158445-20158467 GCTTCCCTTTCATAGGTGTTGGG - Intronic
1146111148 17:30090703-30090725 TCACAGGTTTAATAGGTTTTGGG + Intronic
1151561438 17:74872030-74872052 GCTTACCTTTAGCAGGTGTTGGG + Exonic
1153621936 18:6987679-6987701 CCTCAGCTTTCACAGGTGTCAGG + Intronic
1156333930 18:36151552-36151574 CCTCAGCTTTCCTAAGTGTTAGG - Intronic
1157107845 18:44791647-44791669 GCTCAGTTTTAATAGCAGCTGGG + Intronic
1158193306 18:54855609-54855631 GCTCAGCAAAAATATGTGTTGGG - Intronic
1162475076 19:10894993-10895015 GCTCAGCTTTCCAAAGTGTTAGG + Intronic
1164769347 19:30796103-30796125 CCTCAGCTTTCCTAAGTGTTGGG - Intergenic
1164843440 19:31412087-31412109 GCTAAGCTTTAATAGGTTGTTGG + Intergenic
1165374095 19:35429463-35429485 GCTCAGCCTAAATAAATGTTGGG + Intergenic
1166052301 19:40267575-40267597 CATTAGCGTTAATAGGTGTTGGG - Intronic
925660368 2:6195920-6195942 CCTCAGCTTCAAAAAGTGTTGGG + Intergenic
933438928 2:82285001-82285023 GCTCAAGTGTGATAGGTGTTAGG + Intergenic
933467316 2:82669956-82669978 GGTCTGATTTAATAGTTGTTTGG + Intergenic
934562048 2:95318463-95318485 GCTTAGGTTTCATAGGTTTTGGG - Intronic
934633602 2:95959311-95959333 GATCAGCTTAAATATATGTTTGG + Intronic
934633731 2:95961193-95961215 GATCAGCTTAAATATATGTTTGG + Intronic
934799895 2:97143970-97143992 GATCAGCTTAAATATATGTTTGG - Intronic
942077454 2:172369345-172369367 TATCAGCATTAATAGGAGTTTGG + Intergenic
942495034 2:176531306-176531328 AATTAGCTTTAATAGGGGTTTGG - Intergenic
944799464 2:203224808-203224830 GCTCAGCTTTAAAATGTTTTTGG - Intronic
945092977 2:206193347-206193369 GCTCAGCTTTTCAAGGTGCTGGG + Intronic
946456132 2:219827945-219827967 ATTCTGCTTTAATTGGTGTTGGG - Intergenic
948658094 2:239489340-239489362 GCTCATCTTTAAAAGATCTTAGG - Intergenic
1169882669 20:10364533-10364555 GTTCAGCTTTAGTAGATATTAGG - Intergenic
1171393080 20:24814017-24814039 GCTCAGCTTTAAGAGCTGTTTGG + Intergenic
1174333308 20:49838430-49838452 GCTCAGCTTTATTTTGTCTTGGG + Intronic
1174858801 20:54070689-54070711 GCTCAGTTTTTATTGGAGTTGGG - Intergenic
1177392378 21:20493006-20493028 TCTTAGCTTTAATAAGTTTTTGG + Intergenic
1178708533 21:34894134-34894156 GCTCAGCTTTAATAGGTGTTGGG + Intronic
1178963524 21:37091444-37091466 ACTCAGTTTTTAAAGGTGTTTGG + Intronic
951042857 3:18007172-18007194 GATCAACATTAATAGGGGTTTGG - Intronic
951892691 3:27581901-27581923 GCTCTGCTTGAAGAGGTGGTTGG + Intergenic
952810162 3:37395184-37395206 GATCAACATTAATAGGAGTTTGG + Intronic
955942021 3:64155284-64155306 GCTCAACATTATTAGCTGTTGGG + Intronic
957546953 3:81651461-81651483 GATTAGCTTTAATAGGTGGGAGG - Intronic
958660045 3:97055179-97055201 GGTCAGGTTCAATAGGTTTTTGG - Intronic
960910073 3:122641044-122641066 GCTCAGATTGAAGAGGTGGTTGG - Intergenic
963507308 3:146203041-146203063 TATCAGCATTAACAGGTGTTTGG - Intronic
964687206 3:159409398-159409420 GATCAGTTCTAATAGGTTTTTGG - Intronic
965035853 3:163436704-163436726 TATCAGCTCTAATAGGTTTTGGG - Intergenic
965481045 3:169220074-169220096 CCTCAGCTTTCTTAAGTGTTGGG - Intronic
965789931 3:172376420-172376442 GCTCAGTTTTTAAAGGAGTTTGG - Intronic
974412258 4:61556622-61556644 GTCCAGCTTTAGTAGGTATTTGG - Intronic
974516883 4:62927103-62927125 GCTCTGCTTTATTAGGTGAATGG + Intergenic
976203499 4:82602232-82602254 GCTGATCTGTACTAGGTGTTAGG + Intergenic
976677931 4:87724052-87724074 GCTCAGTTTTAATAGTTTTGTGG - Intergenic
977212796 4:94240891-94240913 GCTCTGCTTTAAAAGGTGGTGGG + Exonic
978145080 4:105363091-105363113 GCTCTGCTTTAATGGGTGGGAGG - Intergenic
978902957 4:113974572-113974594 GCTCAACTTTATTAGTTGTCAGG + Intronic
979170701 4:117598372-117598394 GCTCAGCTTTAATAGGTTCAGGG + Intergenic
983561775 4:169108838-169108860 TCTAAGCTTTAGTAGGTGTAGGG - Intronic
985503851 5:266691-266713 GCTCACCTTTGATCCGTGTTAGG - Intergenic
986501570 5:8406310-8406332 GCTAAGATTAAATAGGTTTTAGG - Intergenic
990412774 5:55557612-55557634 GCTCAGCTTCATTAGTTATTAGG - Intergenic
993263057 5:85685677-85685699 GCTCAACATCATTAGGTGTTAGG - Intergenic
999029447 5:148274995-148275017 TCTCAGTTTTAATAAGTTTTGGG + Intronic
1002911727 6:1495966-1495988 ACTCAGCTTTAAAAGGTGCAGGG - Intergenic
1003712106 6:8603654-8603676 GCTCAGCTTTCCAAAGTGTTAGG + Intergenic
1005200726 6:23341437-23341459 CCTCAGCTTTACAAAGTGTTGGG - Intergenic
1016192020 6:141281049-141281071 GCTCAGTTTGAATTGGTATTGGG + Intergenic
1022438307 7:30411152-30411174 GCTGAGCTTCGCTAGGTGTTGGG - Intronic
1033142369 7:138839034-138839056 GCTTAGCTTCATGAGGTGTTTGG - Intronic
1033286480 7:140045432-140045454 CCTCAGCTTTACTATATGTTAGG - Intronic
1037035215 8:14158411-14158433 AGTCAGCTTTTATAGCTGTTGGG - Intronic
1037303069 8:17473311-17473333 CCTCAGCTTTGAAAGATGTTGGG - Intergenic
1037844944 8:22275113-22275135 CCTCAGCGTTAAAATGTGTTAGG - Intergenic
1038123497 8:24644520-24644542 GATCTGCTTTAATAGCTGGTAGG - Intergenic
1039321057 8:36431955-36431977 GTTGAGTTTTAATAGGTTTTTGG - Intergenic
1045091857 8:98754121-98754143 ACTCAGCTTTGCTAGGTCTTGGG + Intronic
1048821795 8:138387033-138387055 ACTCAGCTTTTATAGGGCTTGGG - Intronic
1050644794 9:7707706-7707728 GCTCAGCTTTCCAAGGGGTTAGG - Intergenic
1055022229 9:71682753-71682775 ATTCAGATTTAATTGGTGTTGGG - Intergenic
1055044863 9:71913031-71913053 GCTCAAATTTACTAGGTGTGCGG + Intronic
1055578437 9:77682974-77682996 GCTCAACTTCAATAGCTATTAGG - Intergenic
1057410913 9:94815897-94815919 GCTTTGGTTTAATAGGTATTTGG + Intronic
1057420990 9:94912254-94912276 TCTTAGCTTTGTTAGGTGTTTGG + Intronic
1185767196 X:2735133-2735155 GCTAATCTTTAAGCGGTGTTAGG - Intronic
1188922957 X:36001759-36001781 GGTGATCTTTAATAGGTTTTTGG - Intergenic
1190036636 X:47031403-47031425 GCTGAGCTTGAGTAGGTGGTTGG - Intronic
1195523736 X:105861217-105861239 GTTCAGCATTATTAGTTGTTAGG - Intronic
1197623187 X:128774502-128774524 GATCAGTTTTAATAGTTTTTTGG + Intergenic
1201553512 Y:15243881-15243903 GCTCAGCTTTAAGCGGTTTAAGG - Intergenic
1202586773 Y:26438261-26438283 GATCAGCTTAAATATATGTTTGG - Intergenic