ID: 1178709447

View in Genome Browser
Species Human (GRCh38)
Location 21:34901802-34901824
Sequence CTGAAAATTGCGCTCCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178709444_1178709447 -10 Left 1178709444 21:34901789-34901811 CCAAGTGGAGCATCTGAAAATTG No data
Right 1178709447 21:34901802-34901824 CTGAAAATTGCGCTCCAGGGAGG No data
1178709442_1178709447 18 Left 1178709442 21:34901761-34901783 CCTTCAGCTAAGCATTGTGAGAA No data
Right 1178709447 21:34901802-34901824 CTGAAAATTGCGCTCCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178709447 Original CRISPR CTGAAAATTGCGCTCCAGGG AGG Intronic