ID: 1178709500

View in Genome Browser
Species Human (GRCh38)
Location 21:34902359-34902381
Sequence CCTTAAATGTGGACAATGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 104}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178709493_1178709500 18 Left 1178709493 21:34902318-34902340 CCTTGGTGAGCTGGTAGAGCAGT 0: 1
1: 0
2: 0
3: 15
4: 149
Right 1178709500 21:34902359-34902381 CCTTAAATGTGGACAATGGTGGG 0: 1
1: 0
2: 0
3: 10
4: 104
1178709492_1178709500 19 Left 1178709492 21:34902317-34902339 CCCTTGGTGAGCTGGTAGAGCAG 0: 1
1: 0
2: 2
3: 17
4: 146
Right 1178709500 21:34902359-34902381 CCTTAAATGTGGACAATGGTGGG 0: 1
1: 0
2: 0
3: 10
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178709500 Original CRISPR CCTTAAATGTGGACAATGGT GGG Intronic
905654504 1:39677359-39677381 CCTGAAATATGGTCAAGGGTTGG - Intergenic
906264111 1:44415930-44415952 CCTTAAATCTGGGTACTGGTAGG + Intronic
906782382 1:48584236-48584258 TCTTGAATGTAGACAATGGAAGG - Intronic
907832710 1:58080152-58080174 ACTGAAGTGTGGACAATGGTTGG - Intronic
908069956 1:60449245-60449267 CCTGAAATGTGCACAGTGGAGGG + Intergenic
908694142 1:66817893-66817915 CCTTAAATGTTCACAATGTCAGG + Intronic
909603786 1:77488197-77488219 CCTTAACTGTGGAAACTGGATGG + Intronic
913204805 1:116528533-116528555 CCATAAATGTGTACAACAGTTGG + Intronic
916393388 1:164357978-164358000 TCTTAGCTGTGGACAAAGGTGGG + Intergenic
917025250 1:170634894-170634916 CCTTCAATGTGGAGAAGGGAAGG - Intergenic
919253402 1:195089869-195089891 TTTTAAATGTGGACAATTATAGG - Intergenic
919591741 1:199511972-199511994 CCATAAAAGTGGAAAATGGGAGG - Intergenic
924859716 1:247908598-247908620 CCCTAAATCTGGACAAGGGAAGG + Intergenic
1065313542 10:24439777-24439799 CCTTAAAAGTGGACATGGGAGGG - Intronic
1069910311 10:71754698-71754720 AGTAAAATGGGGACAATGGTAGG + Intronic
1070155012 10:73827888-73827910 CCTAAAAAGTGGACATTGGAAGG - Intronic
1073055443 10:100697729-100697751 CCTGAGATGTGAATAATGGTGGG + Intergenic
1074233999 10:111566455-111566477 GGTTAAATGAGGACAAGGGTGGG + Intergenic
1085735370 11:79034259-79034281 CCTGAAGTGTGTACAGTGGTTGG + Intronic
1086550193 11:88045284-88045306 CCTTAAAGGTGTACAATGTTAGG + Intergenic
1091690401 12:2592579-2592601 CATTAAATGTGGCCACTGGCTGG + Intronic
1094598457 12:31887135-31887157 CTTTAAATGTCTACAAAGGTGGG - Intergenic
1099453566 12:82837309-82837331 CAATAAATGTGTACAATGGCTGG + Intronic
1100201510 12:92303659-92303681 CATAGAATGTGAACAATGGTGGG - Intergenic
1104529642 12:129557068-129557090 CTTTAAAAGTGAATAATGGTGGG - Intronic
1110725973 13:78824146-78824168 CCATAAAAGTGGACATTGGATGG - Intergenic
1115286671 14:31721761-31721783 ACTTAAAGGTGGAGAATGGGGGG - Intronic
1116447748 14:45031381-45031403 CCTTACATCTGGAAAATGCTTGG + Intronic
1128712942 15:69885612-69885634 CCATCAGTGCGGACAATGGTAGG + Intergenic
1130637832 15:85642073-85642095 CCTTAAAGGTGGACACAGGTAGG - Intronic
1139019434 16:62728999-62729021 CCTGAAACATGGGCAATGGTTGG + Intergenic
1139147020 16:64337568-64337590 CCTATAATGAAGACAATGGTGGG + Intergenic
1140667411 16:77240347-77240369 TATAAAATGTGGACAATGGCTGG + Intergenic
1144028502 17:11299734-11299756 CCTTATAAGTGGACACAGGTTGG - Intronic
1146431356 17:32798469-32798491 CCTTAACTGTGGACAGGGGAAGG - Intronic
1152801970 17:82334687-82334709 CCTCAAATGTGGGGAATGGACGG + Intergenic
1152813218 17:82392000-82392022 CCATAAATGGGGACAAACGTGGG - Exonic
1161881553 19:6957978-6958000 TCCTAAATGTGGACATAGGTAGG - Intergenic
1166627352 19:44370886-44370908 CCTTAAATGGAGACTATGGAGGG + Intronic
1167970386 19:53185666-53185688 CCCTAAATGTGGACTATGCACGG - Intronic
925446160 2:3928687-3928709 CCTGCAATGTCTACAATGGTGGG - Intergenic
929816776 2:45238736-45238758 CCTTAATTGTGGTCACTGATGGG + Intergenic
931187079 2:59963532-59963554 CTTTAAATGAGGTTAATGGTAGG - Intergenic
932535569 2:72590521-72590543 CCCTCAATGTGGACAAAGCTAGG - Intronic
932725321 2:74174954-74174976 CATTAAATGTGGACTAGGGTAGG + Intronic
936139384 2:109926279-109926301 CCTTAAATGTAGAGAATCCTGGG + Intergenic
936205312 2:110445207-110445229 CCTTAAATGTAGAGAATCCTGGG - Intronic
936659684 2:114528883-114528905 CTTTACATATGGACAATGGGAGG + Intronic
938546146 2:132333671-132333693 CCTTAAATGGAGACTATGGAGGG - Intergenic
938584166 2:132672367-132672389 CCTGAAGTGTGGACACTGATTGG - Exonic
942437907 2:176001567-176001589 CCTGAAATAAGGACAATGGTTGG + Intronic
943459180 2:188148950-188148972 ACTTAAACGTGGACAATTGCAGG + Intergenic
943975359 2:194469741-194469763 CATATAATGTTGACAATGGTTGG - Intergenic
946957343 2:224945437-224945459 CATTTAATGTGAACAAGGGTAGG + Intronic
947435659 2:230069827-230069849 CCTTAAAAGTGGACAGGGGTGGG - Intergenic
948917548 2:241043139-241043161 CATCAAATGTGGAAAATGTTTGG - Intronic
948950112 2:241244302-241244324 CATCAAATGTGGACAATTTTTGG - Intronic
1169190335 20:3654922-3654944 CATGAAATGTGGACACGGGTTGG - Intergenic
1169224578 20:3847949-3847971 CCATAAATGTGAACAAATGTGGG + Intronic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1171875010 20:30566404-30566426 CCTTAAATGGAGACTATGGAGGG - Intergenic
1176612669 21:8999359-8999381 CCTAAAATGTGGACACAGGTTGG + Intergenic
1176712450 21:10164092-10164114 CCTAAAATATGGACACAGGTTGG - Intergenic
1178709500 21:34902359-34902381 CCTTAAATGTGGACAATGGTGGG + Intronic
1183174388 22:36212217-36212239 CCTAAATTGTGGCCAATGGAAGG - Intergenic
952481189 3:33763541-33763563 CCGAAAATGTGGAGAATGGAGGG + Intergenic
953234412 3:41093699-41093721 CCTTGAAGGTGTGCAATGGTGGG - Intergenic
954556491 3:51521346-51521368 CCTAAAATCTGGACAAGGATTGG - Intergenic
955154008 3:56397889-56397911 CCTGGAATGTGGACACTGGGAGG - Intronic
958762474 3:98325837-98325859 CATGAAATGTGAAGAATGGTTGG - Intergenic
962177810 3:133173566-133173588 TCATTAATGTGGACAATGGAAGG - Intronic
965672146 3:171158036-171158058 CAATAAAAATGGACAATGGTGGG + Intronic
969573495 4:8023647-8023669 CCTGACATGTGGACAAGTGTGGG - Intronic
975211526 4:71706067-71706089 CTTTACATGTGTACAATGGGAGG - Intergenic
976183986 4:82427797-82427819 ACTTAAATGTGGTCAGTGTTTGG - Intronic
976501940 4:85801050-85801072 CCTCAAATGTGAACTATGGATGG + Intronic
977140759 4:93368959-93368981 CCTTAAATGTGCACTATTTTTGG + Intronic
979470726 4:121093153-121093175 CCTTCAGTGTGGAAAATGGATGG + Intergenic
985527147 5:411715-411737 CCTTAAATCTGGACCATGCTGGG - Intronic
985832249 5:2242422-2242444 CCTCAAATGTGGACAGTGCTGGG - Intergenic
992473834 5:77083218-77083240 CCTTAACTGTGGAGGCTGGTGGG + Intronic
995153922 5:108886850-108886872 CATTAAATGCAGACATTGGTAGG + Intronic
996866824 5:128133224-128133246 CCTTGAAGGTGGACAAGGTTGGG + Intronic
997524138 5:134541689-134541711 CTCTAAATGTGGGCAATGATGGG + Intronic
997592421 5:135083726-135083748 CCTTAAATCTGCAGAATGGGAGG - Intronic
999096484 5:148982747-148982769 TTTTAAATGTGGCCTATGGTAGG + Intronic
1001305820 5:170571753-170571775 GCTTAAATGTGGACATTTCTGGG + Intronic
1004723997 6:18293593-18293615 CATAAAATGTTTACAATGGTGGG + Intergenic
1007234721 6:40382328-40382350 CTTTAGATGTGGACAGTGGGTGG + Intergenic
1013951337 6:115785873-115785895 CCTTAAATGTGAACAAATTTTGG - Intergenic
1015104574 6:129520921-129520943 CTTAAAATGTGGACAATTTTTGG - Intergenic
1028366748 7:90040987-90041009 CATTAAGGGTGGACAATGGTGGG - Intergenic
1031095041 7:117407062-117407084 CCTTTAATGTGCACACTGATCGG - Intronic
1031507292 7:122601009-122601031 TTTTAAATGTGGATAATGATAGG + Intronic
1031563839 7:123270126-123270148 CCTAAAATGGGGTCAAAGGTAGG - Intergenic
1033139025 7:138808719-138808741 CCTTAAATGTAGACAATTAAGGG - Intronic
1034375821 7:150643017-150643039 ACTTAAAAATGGACAATGGCTGG - Intergenic
1039202253 8:35108846-35108868 TCTTGAAAGTGGACCATGGTAGG + Intergenic
1042045085 8:64641874-64641896 CCTTAAATCTGGAAACTGGAAGG + Intronic
1047176001 8:122540994-122541016 CCATTAATGTGGAAACTGGTTGG - Intergenic
1053649453 9:40149828-40149850 CCTAAAATATGGACACAGGTTGG - Intergenic
1053756296 9:41314056-41314078 CCTAAAATATGGACACAGGTTGG + Intergenic
1054535128 9:66226345-66226367 CCTAAAATATGGACACAGGTTGG + Intergenic
1062239960 9:135531724-135531746 CCCTGAATGTGTACATTGGTGGG - Intergenic
1202797197 9_KI270719v1_random:133082-133104 CCTAAAATATGGACACAGGTTGG - Intergenic
1190161551 X:48035179-48035201 GCAAATATGTGGACAATGGTGGG + Intronic
1192028237 X:67479068-67479090 ACTTAAAGGTGGACAGTGGGAGG - Intergenic
1194120112 X:89951447-89951469 CTTTTAATGTGTAGAATGGTTGG - Intergenic
1194184118 X:90751218-90751240 CCTTAAAGAAGGACATTGGTAGG - Intergenic
1194616003 X:96104045-96104067 TCTTAAATATGGCCAATGCTTGG + Intergenic
1198746146 X:139892583-139892605 CCTTTTATGGGTACAATGGTTGG - Intronic
1200472974 Y:3608968-3608990 CTTTTAATGTGTAGAATGGTTGG - Intergenic
1200961038 Y:8996404-8996426 CCTTTAACATGGTCAATGGTAGG - Intergenic
1201533636 Y:15021007-15021029 TGTTAAATGTGTACAATGTTAGG + Intergenic
1201536996 Y:15060566-15060588 TCTTCTATCTGGACAATGGTTGG - Intergenic