ID: 1178709544

View in Genome Browser
Species Human (GRCh38)
Location 21:34902839-34902861
Sequence CACTTGGAATTGTGGGAAAT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 217}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178709539_1178709544 -1 Left 1178709539 21:34902817-34902839 CCAGGAACATTTATGCAAATGCC 0: 1
1: 0
2: 3
3: 8
4: 151
Right 1178709544 21:34902839-34902861 CACTTGGAATTGTGGGAAATCGG 0: 1
1: 0
2: 3
3: 18
4: 217
1178709538_1178709544 5 Left 1178709538 21:34902811-34902833 CCAGCTCCAGGAACATTTATGCA 0: 1
1: 0
2: 2
3: 13
4: 149
Right 1178709544 21:34902839-34902861 CACTTGGAATTGTGGGAAATCGG 0: 1
1: 0
2: 3
3: 18
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178709544 Original CRISPR CACTTGGAATTGTGGGAAAT CGG Intronic
902356825 1:15908774-15908796 CACTTGATATTGGGGGAAATTGG + Intronic
904742183 1:32686683-32686705 GTCATGGAATTGTGGGAAAGTGG + Intronic
908163474 1:61434899-61434921 CACTTGGAACTGTGGGAAAAGGG + Intronic
909421800 1:75475587-75475609 CAGTTAAAATAGTGGGAAATGGG - Intronic
909804105 1:79853168-79853190 CACATGGAAATGTGGAACATAGG + Intergenic
909807330 1:79887990-79888012 CACATGGAATGGTGGGGAAGTGG - Intergenic
910107499 1:83647238-83647260 CACATGGCACTGTGGGCAATGGG + Intergenic
910442668 1:87268478-87268500 CAGTGGGAATGGTAGGAAATGGG + Intergenic
910454443 1:87381959-87381981 CACTTGAAGTTGTTGGACATGGG + Intergenic
911461204 1:98193487-98193509 CACTTGAAATAATGTGAAATAGG + Intergenic
911518709 1:98901845-98901867 TACTTATAATTGTGGAAAATTGG + Intronic
912260745 1:108109773-108109795 CCCTAGGCCTTGTGGGAAATGGG + Intergenic
916251810 1:162746110-162746132 CACTGGGACTTGTCGGAAAGTGG + Intronic
918823355 1:189288523-189288545 GACTGGGATTTGTGGGAAAGAGG - Intergenic
920565199 1:206967484-206967506 TAGTTGGAATTGTGGGACCTTGG + Intronic
920777253 1:208951908-208951930 CAGTTGGAATTAGGGGAATTTGG + Intergenic
921404919 1:214768326-214768348 CACTTAGAATTAAAGGAAATTGG + Intergenic
922630079 1:227097952-227097974 CACTTGGAATTGGGCTAAGTGGG - Intronic
923689658 1:236179704-236179726 CACTTGAAATTGTAGGAAGAAGG + Intronic
923916559 1:238512243-238512265 CACTGGGAATTCTGGGAAACAGG - Intergenic
1063758855 10:9048276-9048298 CACATGGAAGTGAGGGAAAAGGG + Intergenic
1067358026 10:45549335-45549357 CCCATGGAATTATGAGAAATAGG - Intronic
1067557234 10:47281307-47281329 GACTTGGAAGGGTGGGAAAGTGG - Intergenic
1068504039 10:57876540-57876562 CACTTGGAATTGTCTAAAAATGG + Intergenic
1069421674 10:68252079-68252101 CAATTGTAATAATGGGAAATTGG + Intergenic
1069579637 10:69556844-69556866 CACATGGTACAGTGGGAAATTGG + Intergenic
1070661100 10:78305823-78305845 GAGTTGGAATTGTGGGGAAGGGG - Intergenic
1072436175 10:95416342-95416364 CACTTAGAATTGTGGATACTAGG - Intronic
1072733633 10:97864865-97864887 CACTTGGAATAGTGTGATCTGGG + Intronic
1074769921 10:116726575-116726597 CAGAAGGAACTGTGGGAAATTGG - Intronic
1076653839 10:132008205-132008227 TCCTTGGAATTGAGGGCAATTGG + Intergenic
1079904575 11:26229788-26229810 CAATTTGAATAGTGGGTAATTGG - Intergenic
1080022763 11:27580708-27580730 CAGTTGGAATTGTTGGTAATGGG - Intergenic
1080321456 11:31014843-31014865 CATTTGGAATTTTGGGATATTGG - Intronic
1081367670 11:42256303-42256325 CATTTTGAAATGTGGAAAATAGG + Intergenic
1082079736 11:48003243-48003265 CACTTGTAATGGTGAAAAATTGG - Intronic
1082612650 11:55320404-55320426 CAATTTGAAGTGTGTGAAATTGG - Intergenic
1083460615 11:62808705-62808727 CCCTTGGTATTGTGGGGCATTGG - Intronic
1083958693 11:66002087-66002109 CAGTTGGACTGGTGGGAACTGGG - Exonic
1085145485 11:74191968-74191990 CTAGTGGAATTGTGGGAAAGGGG + Intronic
1089010716 11:115129553-115129575 CTCTGGGAATTGTGGGATACAGG - Intergenic
1090232589 11:125119363-125119385 GGCTTGGTATTGTGGGAATTAGG - Intergenic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1092672147 12:10875677-10875699 TACTTGGCTCTGTGGGAAATGGG - Intronic
1095634050 12:44410341-44410363 CAATAGGAACTGAGGGAAATAGG - Intergenic
1095822921 12:46499214-46499236 GACTGGGGGTTGTGGGAAATAGG - Intergenic
1096003533 12:48149562-48149584 CACTTTGAATTGAGGAAAAATGG - Exonic
1097473692 12:60027254-60027276 CACTTTGAATTGAAGGAAACTGG + Intergenic
1097576104 12:61394479-61394501 TTCTTGGAATTGTGGCAAAAAGG + Intergenic
1097740772 12:63240514-63240536 CACTGGGAATTGTCGGACAGTGG + Intergenic
1098208634 12:68138800-68138822 CACCAGGAATTCTGGGTAATTGG - Intergenic
1098960194 12:76731906-76731928 CACTTTGCATTGTGGAAAAGGGG - Intergenic
1100068063 12:90675023-90675045 GACTTGGAATTTTTGGAAAATGG - Intergenic
1101444171 12:104725590-104725612 TACTTGCAATCGTGGGAAGTGGG + Intronic
1102347744 12:112170328-112170350 CACTGGAAATTGTGGGAGGTGGG - Exonic
1102456205 12:113072152-113072174 CACTTGGAGGAGTGGGAAAGAGG - Intronic
1103773925 12:123351265-123351287 CACTTGCTCTTGTGGGAAACAGG + Intronic
1104789511 12:131472970-131472992 CCAGTGGAATGGTGGGAAATGGG + Intergenic
1104932906 12:132349303-132349325 GGATGGGAATTGTGGGAAATTGG - Intergenic
1106780668 13:33056331-33056353 CACTTGGAAGAATGTGAAATGGG + Intronic
1108308620 13:49163639-49163661 CACTGGGACTTGTTGGAAAGTGG - Intronic
1108460781 13:50665498-50665520 CACTGGGAATGATGGTAAATTGG - Intronic
1109612019 13:64778432-64778454 TACTTATAATTGTGGGAAAATGG - Intergenic
1109952294 13:69514260-69514282 CATATGGATTTGTGAGAAATAGG - Intergenic
1110170807 13:72498206-72498228 CACTTGGAATTTTTGGTAAAGGG - Intergenic
1110315405 13:74100797-74100819 CACTGTGAATTAAGGGAAATTGG + Intronic
1113434340 13:110278135-110278157 CACTTAGAATTGTGGCAGATGGG + Intronic
1114035013 14:18616044-18616066 CAGTAAGATTTGTGGGAAATGGG + Intergenic
1114123632 14:19698972-19698994 CAGTAAGATTTGTGGGAAATGGG - Intergenic
1114894047 14:26963553-26963575 CATTTAGCATTGTGAGAAATGGG + Intergenic
1116203896 14:41836115-41836137 TACTTGGACTTGGGGGAAAGAGG + Intronic
1116730451 14:48614760-48614782 CATTTGAAATTGTCAGAAATTGG - Intergenic
1118055088 14:62071309-62071331 CACTTGGGCTTTTGGGAAATGGG - Intronic
1118127548 14:62924801-62924823 TACTTAGAAGTGGGGGAAATGGG + Intronic
1119288151 14:73473024-73473046 AACGTGGTATTGTGGGAAAATGG - Intergenic
1119699577 14:76744392-76744414 CACTGGGGATTGTTGGAAAGTGG + Intergenic
1120542645 14:85769275-85769297 CACTTGGCATTCTGTGACATGGG - Intergenic
1124189434 15:27561279-27561301 CATTTTAAACTGTGGGAAATAGG - Intergenic
1125122828 15:36183058-36183080 CACATGGAGTTGTGGAAAAGTGG + Intergenic
1125285491 15:38088316-38088338 CACATGGAATAGTGGGGAAAAGG + Intergenic
1125457680 15:39877370-39877392 CATTTGGATTTGGGGGAATTTGG - Intronic
1126189929 15:45868683-45868705 CACTTGGAATGGTGGTAAATGGG - Intergenic
1127523166 15:59763641-59763663 CAATTGCAATTTTTGGAAATTGG - Intergenic
1128549469 15:68588941-68588963 AATTTGGAATTCTGGGAAAGGGG + Intronic
1128948428 15:71848811-71848833 CACATGGAATAGTGGAAAAATGG - Intronic
1129150246 15:73684103-73684125 CTCTTGGAAGTGTGGGAACGGGG + Intronic
1129418087 15:75400001-75400023 CATTTGAAGTTGGGGGAAATGGG - Intronic
1130800306 15:87255749-87255771 CACTGGGGATTGTTGGAAAGTGG - Intergenic
1131741216 15:95394640-95394662 TACTTTGAATTGTGAGAAATCGG + Intergenic
1134778732 16:16876075-16876097 GACTAGGAACTGTGGGAGATGGG + Intergenic
1135803592 16:25521975-25521997 CACTTAGAAATGTTGGAAATGGG - Intergenic
1137482118 16:48861076-48861098 GACTTGAAATGGTGGGAAGTTGG + Intergenic
1137620257 16:49871687-49871709 CACTTGGAATAGTGCTAACTAGG + Intergenic
1137956091 16:52831404-52831426 AACTTGGAGTTGGGGGGAATTGG - Intergenic
1140486849 16:75300236-75300258 CAATTGGACTTGTGGGATGTTGG + Intronic
1140685624 16:77431641-77431663 CATTTGGAATTGTGGGCTCTGGG - Intronic
1140853553 16:78956881-78956903 CACTCAAAATTCTGGGAAATAGG + Intronic
1144578642 17:16445464-16445486 CACTTAGAAATGCGGAAAATGGG - Intronic
1144664566 17:17093189-17093211 CACTTGACTTTGGGGGAAATAGG - Intronic
1148400084 17:47351057-47351079 GACTTGGAAGTGTGGGAAGGGGG - Intronic
1149790018 17:59468596-59468618 GACTTGGCACTGTGGGAAAGAGG + Intergenic
1151945980 17:77320131-77320153 CACATGGAAATGTGGTAATTCGG + Intronic
1153597424 18:6742023-6742045 CAGCTGGAATTGTGGGAATATGG + Intronic
1155184670 18:23376745-23376767 CTCTTGGAACTGTGGAAGATGGG + Intronic
1155812974 18:30261522-30261544 CACATGGAAGTGTGGAAAAATGG - Intergenic
1156974142 18:43196493-43196515 CACATACAAATGTGGGAAATTGG - Intergenic
1157064001 18:44325719-44325741 AACTTGGAATTGTTAGAAATTGG - Intergenic
1157064005 18:44325771-44325793 CACTTGGAATTGTTAGAAATTGG - Intergenic
1157597988 18:48875384-48875406 GACTTGGAATTGTAGAATATCGG + Intergenic
1163881200 19:19923930-19923952 CACTGGGAATTGTCGGACAAGGG - Intronic
1165715426 19:38042493-38042515 CACTTGGAATTGTGAATACTTGG + Intronic
1165881361 19:39046301-39046323 CATTTAGAACTGTGTGAAATGGG - Intergenic
1166328660 19:42066308-42066330 CCCATGGGATTGTGGGAACTGGG - Intronic
1166587570 19:43963899-43963921 CACTCGGAAGAGTGGGAAGTAGG + Intronic
926020666 2:9492249-9492271 CACTTGCATCTGTGGGGAATGGG - Intronic
928112529 2:28522211-28522233 CAATTGTAAATGAGGGAAATGGG + Intronic
930402398 2:50906907-50906929 TACTTGGAACTGAAGGAAATTGG + Intronic
932425384 2:71631031-71631053 AACCTGGAATTAAGGGAAATAGG - Intronic
935282538 2:101531562-101531584 CACTTGGACTCGTGGGGGATTGG + Intergenic
936896682 2:117435571-117435593 CATTAGGAAATGTGGCAAATTGG + Intergenic
937972463 2:127561200-127561222 CAATTGTAATTGTGAGTAATAGG - Intronic
938106070 2:128530591-128530613 CACTTGGAATGGTGGCCAACGGG - Intergenic
938327196 2:130417564-130417586 CAGTAAGATTTGTGGGAAATGGG - Intergenic
938362742 2:130703913-130703935 CAGTAAGATTTGTGGGAAATGGG + Intergenic
938862155 2:135380979-135381001 CACTGGGGATTGTGGGACAGTGG + Intronic
940220922 2:151350486-151350508 CACTTGGAAGTTTTGGAAAGGGG - Intergenic
940653018 2:156456231-156456253 CACTTAGAATTGTGGGATTGGGG + Intronic
942737686 2:179134542-179134564 TACTTAGAATTGATGGAAATTGG - Intronic
947087442 2:226471243-226471265 CACTTGGAAAGTTGGGACATTGG - Intergenic
947350949 2:229244457-229244479 GAGTTGGAATTTTGGAAAATAGG - Intronic
947387599 2:229607081-229607103 CACTTGGAACTGTGGATAAACGG + Intronic
947488610 2:230574969-230574991 CACCTGGCACTTTGGGAAATGGG - Intergenic
1169294524 20:4382194-4382216 CACTTGGAAAAATGTGAAATTGG + Intergenic
1173179507 20:40793872-40793894 CACCTGGAATTCTGGCTAATTGG - Intergenic
1174191600 20:48744508-48744530 CATTTGGAATTGTGGGTGGTAGG - Intronic
1177304083 21:19289913-19289935 CACTTGGAAGGGTGGGAAGGTGG + Intergenic
1177316708 21:19471620-19471642 CACCTAGCATTGTGGGAAACTGG - Intergenic
1177532047 21:22373216-22373238 CTAGTGGAATTGTGGGAATTGGG + Intergenic
1178534577 21:33401668-33401690 CACGTTGAATTGTGGGGTATGGG - Intergenic
1178709544 21:34902839-34902861 CACTTGGAATTGTGGGAAATCGG + Intronic
1180459133 22:15543090-15543112 CAGTAAGATTTGTGGGAAATGGG + Intergenic
1181037713 22:20177970-20177992 CACTGGGACTGGTGGGAAACTGG + Intergenic
951054001 3:18126357-18126379 CACTTGGAGTTATGGGAGAGAGG + Intronic
951299960 3:20984287-20984309 CAATTGGAGATGTGGAAAATGGG + Intergenic
952617655 3:35294235-35294257 CACTTGGAAATGTGCCAAAAAGG + Intergenic
954187412 3:48928511-48928533 CACTGGCCATTATGGGAAATTGG + Intronic
956897226 3:73675018-73675040 AACCTGAAATTGTGAGAAATAGG - Intergenic
957867046 3:86039195-86039217 CACTTGGGAGTGTCGGAAAGTGG + Intronic
958557067 3:95692880-95692902 AACTAGGAAGTGTGTGAAATGGG - Intergenic
960246919 3:115409907-115409929 CACTTGTAATTGAGGGAAACGGG + Intergenic
963083130 3:141413079-141413101 GAGGAGGAATTGTGGGAAATGGG + Intronic
964463650 3:156966256-156966278 CACTGGGGAGTGTTGGAAATTGG + Intronic
967604977 3:191434058-191434080 CAGTTGGAATTGTGTGAATGAGG + Intergenic
970182080 4:13409161-13409183 GACTTGGATTTGTTCGAAATAGG - Intronic
971438716 4:26655885-26655907 CACTGGGGATTGTCGGAAAGTGG - Intronic
972899415 4:43664787-43664809 GAATTGGAATTGTAGCAAATGGG + Intergenic
973856914 4:55020706-55020728 CACTTTTAATTGTGTGACATTGG - Intergenic
973977636 4:56279180-56279202 CACTGGGGATTGTCGGACATTGG - Intronic
975724118 4:77275635-77275657 CACTTGGAATGATGGAAAAAGGG + Intronic
978196150 4:105974389-105974411 CAGTTGGAAATGTGGGAATGTGG - Intronic
979515116 4:121598784-121598806 GACTTGGAAGGGTGGGAAGTAGG + Intergenic
981797039 4:148607144-148607166 TACTTTGATTTGTGGGAAATCGG - Intergenic
982085697 4:151834146-151834168 CACTTTGAAGTATGGGAATTTGG + Intergenic
982317279 4:154044548-154044570 CATTAGGAATTGTGTAAAATTGG - Intergenic
982619886 4:157691612-157691634 CACTGGGAATTGTCGGAAAGTGG + Intergenic
982785725 4:159534059-159534081 CACTGGGACTTGTGGGAGAGTGG - Intergenic
985135818 4:186785122-186785144 GACTGGGAAGTGGGGGAAATGGG - Intergenic
989678795 5:44005432-44005454 CATTTGGAATGATGGTAAATAGG + Intergenic
990137628 5:52665874-52665896 CACTTTGAGTTCTGGGAAAAAGG - Intergenic
990269728 5:54123559-54123581 CATTTCGAATTGTCTGAAATAGG - Intronic
990610059 5:57447963-57447985 TACTTGGATTATTGGGAAATGGG + Intergenic
992337432 5:75786841-75786863 CATTTGTAATTATTGGAAATGGG - Intergenic
992413398 5:76529716-76529738 GACTTGAAATTGGGGGAAATTGG + Intronic
994776813 5:104045172-104045194 AACTTGGAATTGAAGGAAACTGG - Intergenic
996513872 5:124348026-124348048 GAAATGGAATAGTGGGAAATAGG - Intergenic
996771449 5:127090686-127090708 CACTTGGAAATGTGGGTCTTCGG - Intergenic
998407523 5:141882540-141882562 CACTGGGAATTGGGGGAATGAGG + Intergenic
1000289629 5:159858513-159858535 AACATGGAGTTGTTGGAAATGGG - Intergenic
1000941916 5:167372013-167372035 AACTAGGAATTGTGGGGAAATGG + Intronic
1006415616 6:33902056-33902078 CTCTGGGAATTGGGGGAAAAGGG + Intergenic
1010385895 6:75279162-75279184 CTCTGGGAATAGTGGGAGATAGG - Intronic
1013554062 6:111238481-111238503 AGCTTGGAGTTGTGGGAAAGAGG - Intergenic
1013783617 6:113755369-113755391 CACTTGGAATACTAGGAACTTGG - Intergenic
1016002265 6:139053764-139053786 CACTGGGAAATGTGGGATTTAGG + Intergenic
1016214286 6:141577822-141577844 TACATAGAATTGTGGAAAATAGG - Intergenic
1017381510 6:153836810-153836832 CCCTTGGATTTGTGAAAAATAGG + Intergenic
1020499625 7:8900550-8900572 GACATAGAATTTTGGGAAATAGG - Intergenic
1022933853 7:35151930-35151952 CACTGGGGATTGTCGGAAAGTGG + Intergenic
1023621001 7:42072587-42072609 CACTTGGGAATGTAGGCAATTGG - Intronic
1024429209 7:49266442-49266464 CACTTGGCATTGTGGGCTATAGG + Intergenic
1024448062 7:49504951-49504973 CACTTGGAATAGTCAAAAATTGG - Intergenic
1024681134 7:51689609-51689631 CACTTTGAAATGTGTTAAATGGG + Intergenic
1024696232 7:51859407-51859429 CAGTCTGAATTTTGGGAAATGGG - Intergenic
1024880674 7:54082287-54082309 CACCTGGAATTGTGGGCACCTGG - Intergenic
1026147004 7:67755224-67755246 CACATGGACTTTTGGAAAATCGG - Intergenic
1027176523 7:75907350-75907372 CATTTGGAGTTCTGGGAAAGTGG + Intronic
1027225892 7:76243594-76243616 CACATGGAAGGCTGGGAAATGGG - Intronic
1027614106 7:80399951-80399973 CACTTGGACCTGGGGGACATAGG + Intronic
1028436115 7:90806595-90806617 CACTGGGAAGTGTTGGAAAGTGG + Intronic
1028461580 7:91099439-91099461 CACTTTGAATTCAGGAAAATTGG + Intronic
1029829785 7:103244710-103244732 CACTGGGGATTGTCGGAAAGTGG + Intergenic
1030363791 7:108623885-108623907 CACTTAGAACTGTGGGACAATGG - Intergenic
1031685105 7:124723748-124723770 CATTTGGAAATGTGGGAGATTGG + Intergenic
1034885071 7:154792981-154793003 AAGTTTTAATTGTGGGAAATGGG + Intronic
1036981739 8:13477090-13477112 GACATGGAATAGTGAGAAATAGG - Intronic
1037487178 8:19358608-19358630 CACTTGGCATGGTGGGGAAAGGG + Intronic
1037637228 8:20710971-20710993 CCCTTGGCCTTTTGGGAAATTGG - Intergenic
1038621997 8:29153078-29153100 CACTTGGAACTTTGAAAAATGGG - Intronic
1039687142 8:39815625-39815647 TTCTTGGTATTTTGGGAAATGGG + Intronic
1039813714 8:41073312-41073334 CACTTGGAATGCTGGGAATGCGG - Intergenic
1040807926 8:51415205-51415227 CAGTAGGAATTGTAGAAAATTGG + Intronic
1043189420 8:77199559-77199581 CACTTGGAAATGTGTAAAAGTGG + Intergenic
1043254472 8:78116591-78116613 CACTGGGGATTATGGGAAATAGG + Intergenic
1043726367 8:83616563-83616585 CATTTGAATTTGTAGGAAATGGG - Intergenic
1044529119 8:93288332-93288354 CAACTGGGTTTGTGGGAAATTGG - Intergenic
1045330139 8:101148422-101148444 CACTTCGAGTTGGGGGAAACAGG - Intergenic
1046143291 8:110122538-110122560 CACTTGGAATTATTGTAACTTGG + Intergenic
1047806249 8:128363591-128363613 CTCTGGGAGTTGTGGGAATTAGG + Intergenic
1050012185 9:1196127-1196149 CACTGGGGATTGTTGGAAAGTGG - Intergenic
1051061223 9:13047183-13047205 CACTTGGAACTGTGAATAATTGG - Intergenic
1051612747 9:18977649-18977671 CACTTGGAATTGTATGAAAATGG + Intronic
1052734343 9:32324940-32324962 CAATTGGAAATGAAGGAAATTGG - Intergenic
1053505115 9:38636585-38636607 CATTTGGAATTGTGGGTCCTGGG - Intergenic
1056875026 9:90320012-90320034 CAGTTTCAATTGTGTGAAATTGG - Intergenic
1057533678 9:95876975-95876997 CTCTTGGTATTTAGGGAAATTGG + Intronic
1060052763 9:120388815-120388837 CACTTGGGATTTTGGGACCTGGG + Intergenic
1060773230 9:126347799-126347821 CAAGTGGAAATGTGGGACATTGG + Intronic
1186061353 X:5710775-5710797 CATTTGGTATTGTGGTAAAAAGG - Intergenic
1186256940 X:7732218-7732240 CACTCCGAAGTGTGGCAAATTGG + Intergenic
1191825106 X:65356070-65356092 CACTAGGATTTTTGGGAATTAGG - Intergenic
1191937566 X:66441633-66441655 ATCTTTGAATTGTGGGAATTTGG - Intergenic
1192365137 X:70465536-70465558 CATTTAGATTTGTGGAAAATTGG + Intronic
1193030779 X:76896329-76896351 CACTGGGAATTGTTGGACAGTGG + Intergenic
1193154419 X:78157894-78157916 CACTGGGGAGTGTGGGAAAGCGG - Intergenic
1195206146 X:102601709-102601731 CACTTGGAAGTGTAGGGAGTGGG + Exonic
1197060434 X:122173193-122173215 CACTTGAAATTGTGGAAACTGGG - Intergenic
1197640860 X:128966636-128966658 CACTTGGAAGAATGGGTAATGGG - Intergenic
1199641919 X:149870629-149870651 CATTTGGAATTGTGGCCTATGGG + Intergenic
1199779059 X:151041445-151041467 CACTGGGACTTGTTGGAAAGTGG - Intergenic