ID: 1178709862

View in Genome Browser
Species Human (GRCh38)
Location 21:34906999-34907021
Sequence TGTACACTCACTAAAGTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 126}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178709862_1178709864 26 Left 1178709862 21:34906999-34907021 CCTCTGACTTTAGTGAGTGTACA 0: 1
1: 0
2: 0
3: 10
4: 126
Right 1178709864 21:34907048-34907070 ATTAGTATTCATTATTCATGAGG 0: 1
1: 0
2: 0
3: 21
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178709862 Original CRISPR TGTACACTCACTAAAGTCAG AGG (reversed) Intronic
902890690 1:19441243-19441265 TGTACTCTCCCTGCAGTCAGAGG + Intronic
904653965 1:32028446-32028468 TATATACTCCCTAAAATCAGTGG - Intronic
905509841 1:38510477-38510499 TGTATACTCACTAAAGTTCAAGG - Intergenic
910372176 1:86527895-86527917 TGTGACCTCACTAAAGTCAAGGG + Intergenic
910609836 1:89128633-89128655 TGTTCACTCACCAAACACAGAGG - Intronic
910613948 1:89176722-89176744 TGTACACTCAGCAAACACAGAGG - Intergenic
912071083 1:105810412-105810434 TGTAGACTCACTAAACTCCTTGG + Intergenic
916690691 1:167187264-167187286 TGTACACTTAGAAAATTCAGTGG - Intergenic
916754856 1:167759805-167759827 GGTACACTCACAATAGGCAGAGG + Intronic
919158786 1:193802023-193802045 AGTAATCTCTCTAAAGTCAGGGG + Intergenic
919756437 1:201069058-201069080 TTTACACACACTGAACTCAGGGG - Intronic
921554627 1:216583301-216583323 TGTACACCTACTGAAGTCAATGG + Intronic
922088902 1:222377009-222377031 AGTTCACTCACCAGAGTCAGGGG + Intergenic
922089000 1:222377880-222377902 AGTTCACTCACCAGAGTCAGGGG + Intergenic
1062820647 10:532191-532213 TGTAAACCCACCAAAGTCACAGG + Intronic
1063572989 10:7233790-7233812 TGAACACCCACTAAAGCCAGGGG + Intronic
1070601551 10:77869727-77869749 TGTACCATCACCAAAGCCAGAGG + Intronic
1078642129 11:13106524-13106546 TTTAGGCTCACTAAAGGCAGGGG + Intergenic
1078693398 11:13604511-13604533 TGCAAGCTCACTAAAGTCATGGG - Intergenic
1079295574 11:19230389-19230411 TGAAACCTCACTGAAGTCAGAGG + Intronic
1082901493 11:58258186-58258208 TGTAGACTCTGTAAATTCAGTGG - Intergenic
1085340101 11:75725804-75725826 TGTGCACTCCCTCAGGTCAGAGG - Intronic
1085494444 11:76954960-76954982 TGTACACTCACTTATCCCAGTGG + Intronic
1087661334 11:100992218-100992240 TATACTTTGACTAAAGTCAGAGG + Exonic
1091427705 12:405840-405862 TGCAAACTCACTAAAGGCAGCGG - Intronic
1091657810 12:2358506-2358528 ACTATACTCTCTAAAGTCAGTGG + Intronic
1091699687 12:2651465-2651487 TGTCCACTCATTAAAGTGGGCGG + Intronic
1094814976 12:34174039-34174061 GATGTACTCACTAAAGTCAGGGG + Intergenic
1096103549 12:48983694-48983716 TGCACATTCACCAGAGTCAGTGG + Intergenic
1096772198 12:53942615-53942637 CGTACACTGCCTAAAGTGAGTGG - Intronic
1101122028 12:101592209-101592231 TGTACTCTCAGGAAAGACAGGGG - Intronic
1103287467 12:119814556-119814578 TGGACACTCACTTACTTCAGGGG - Intronic
1106576477 13:30979651-30979673 TGTACACTCCCTGGAGCCAGGGG - Intergenic
1107009838 13:35658530-35658552 TGTAAACTCTAGAAAGTCAGAGG - Intronic
1108504755 13:51102682-51102704 TGGTCACTCACCACAGTCAGAGG - Intergenic
1111462521 13:88565030-88565052 TGTACATTTTCTAAAGTCAGTGG - Intergenic
1112476973 13:99740253-99740275 GGCAGAGTCACTAAAGTCAGAGG - Intronic
1113424167 13:110194137-110194159 TGTACACTGACTCAGATCAGTGG + Intronic
1114448891 14:22811463-22811485 TGTACATTCAGTAAAGCCATTGG - Intronic
1114911315 14:27201635-27201657 TTTATAGTCACTAAAATCAGAGG - Intergenic
1116978101 14:51138392-51138414 TGGAGACTGAATAAAGTCAGTGG + Intergenic
1117493153 14:56273012-56273034 TGTGAACTCACTAAATTCTGTGG - Intronic
1118213184 14:63784914-63784936 TGTACATCTACTAAATTCAGTGG + Intergenic
1118355213 14:65008182-65008204 TCTAAACTCACTAAAGCCAGGGG - Intronic
1122172519 14:99888965-99888987 TGCACACTCACGGAAGTCTGGGG - Intronic
1125983112 15:44022072-44022094 GGTACACTCAGTAAATTCATAGG + Intronic
1129797695 15:78390617-78390639 TGTAAACTCCCTGAGGTCAGAGG - Intergenic
1132164504 15:99572511-99572533 TGTAAACTCCATAAAGGCAGAGG + Intronic
1133965547 16:10528848-10528870 TGTAAACACACTAAACACAGTGG - Exonic
1135157143 16:20062149-20062171 AGGACAGTCACTAAAGTCTGGGG - Intronic
1135916029 16:26606346-26606368 TGCAGACTCACTAAAGTCTCAGG - Intergenic
1138330792 16:56213886-56213908 TGTGGTCTCACTAAAGACAGGGG + Intronic
1138914184 16:61442673-61442695 TGAAACCTCACTAAAGTGAGTGG + Intergenic
1141626057 16:85261662-85261684 TGGACACTGCCGAAAGTCAGTGG - Intergenic
1143368694 17:6424976-6424998 TCAAGACCCACTAAAGTCAGTGG + Exonic
1143826251 17:9610278-9610300 TGTACACACACTAAAAACAAAGG - Intronic
1144690696 17:17261067-17261089 TGTGCCTTCACTAAATTCAGTGG - Intronic
1146624516 17:34425189-34425211 GCAACACTCACAAAAGTCAGAGG + Intergenic
1150926741 17:69540244-69540266 ACTAAACTCCCTAAAGTCAGGGG + Intronic
1150991309 17:70262969-70262991 TGTACATTCAGTATATTCAGTGG - Intergenic
1151538994 17:74755067-74755089 TGTGCAGGCACTAGAGTCAGAGG - Intronic
1158749616 18:60243779-60243801 TGTAAACTCAGTGAAGGCAGGGG + Intergenic
1158865295 18:61632526-61632548 TGTACTCTCACTACAGAGAGAGG - Intergenic
1159013093 18:63077266-63077288 TCTACACTATCTAAACTCAGTGG + Intergenic
928517570 2:32058577-32058599 TGTAAACTTACTGAAGGCAGTGG - Intergenic
929412346 2:41711111-41711133 TGTACACTCAGGAGAGACAGTGG - Intergenic
940498901 2:154469797-154469819 TGTCCAGTCGTTAAAGTCAGTGG + Intergenic
1169349021 20:4853235-4853257 TGTACACTCGCTATAGGCATAGG - Exonic
1171280507 20:23892268-23892290 TGTATACTCAACAAAGACAGTGG + Intergenic
1173591874 20:44231190-44231212 TGTAAGCTCAGTAAGGTCAGTGG - Intergenic
1173706173 20:45111831-45111853 TGGACACTCACAGAGGTCAGAGG - Intronic
1177065824 21:16434364-16434386 AGTACACTCTCTAGAGGCAGTGG - Intergenic
1177895511 21:26852446-26852468 TGGAGACTCAGGAAAGTCAGTGG + Intergenic
1178709862 21:34906999-34907021 TGTACACTCACTAAAGTCAGAGG - Intronic
950405153 3:12799695-12799717 TGTACACTCACTGAGGGCAGAGG - Intronic
952755926 3:36866773-36866795 TGCACACACACCAATGTCAGGGG + Intronic
952819565 3:37474619-37474641 TGTTCACTCACCAAGGGCAGAGG - Intronic
956739706 3:72266243-72266265 TCAAAACTCACTAGAGTCAGGGG + Intergenic
958127802 3:89380659-89380681 TGTAAGCTGACTAAAATCAGAGG + Intronic
964921448 3:161901039-161901061 TTTATAATCACTAAATTCAGTGG + Intergenic
965135018 3:164753655-164753677 TAAACACACTCTAAAGTCAGAGG + Intergenic
966144614 3:176795770-176795792 TGTAAATTCTGTAAAGTCAGGGG + Intergenic
966585104 3:181615046-181615068 TGTAAACTCTGTAAGGTCAGGGG - Intergenic
970386300 4:15560326-15560348 TGTAAGCTCCCTAAAGTCAGGGG - Intronic
972947966 4:44281499-44281521 TGTACACTCATTAAATACTGGGG + Intronic
975241659 4:72066815-72066837 GGTACACTCAGTAAAGCCATGGG - Intronic
975695835 4:77011867-77011889 TGGACATTCACTAAAGTCCCTGG + Exonic
978823094 4:112988520-112988542 TGTACATTCTCTAAAGGGAGAGG + Intronic
982176847 4:152714018-152714040 TGGACAATCACTCAAGTCATTGG - Intronic
982644896 4:158011055-158011077 TGTACAGTCACTACAGTCTATGG + Intergenic
982794718 4:159630777-159630799 TGTAAACTCTTTAAAGGCAGAGG + Intergenic
983074524 4:163309385-163309407 TGGACAGACACTAAATTCAGTGG - Intergenic
990250441 5:53908735-53908757 CGTACACTCACTAAATGCACAGG + Intronic
991367769 5:65886928-65886950 TGTACTCTCACTCCAGTCATTGG + Intergenic
992441428 5:76800859-76800881 TGTAAACTCCATGAAGTCAGGGG - Intergenic
996624240 5:125550928-125550950 TTTATGCACACTAAAGTCAGAGG - Intergenic
1000682824 5:164207711-164207733 AGAACACTCAATAGAGTCAGTGG + Intergenic
1003622476 6:7713150-7713172 TGTAAACTCATTGAGGTCAGGGG + Intergenic
1006206037 6:32343964-32343986 TGAACCCTCACTATATTCAGTGG + Intronic
1006429295 6:33985248-33985270 TGGAGACTCACTAAAGCCACTGG + Intergenic
1008082341 6:47207839-47207861 TGTTCTCTCATTTAAGTCAGGGG + Intergenic
1014080504 6:117281307-117281329 TGTACAGTCACTGGAGTAAGTGG + Intergenic
1014163122 6:118193391-118193413 TGGACACTGACTAAAGTTAAAGG - Intronic
1014655239 6:124095657-124095679 TGTATACTTACTAAGGTAAGTGG - Intronic
1014712689 6:124826172-124826194 TGTACAATCGCTAATGCCAGTGG - Intergenic
1017926062 6:158912657-158912679 TGTCCACCCACTACAGCCAGAGG + Intergenic
1021200432 7:17722974-17722996 TACAGACTCACCAAAGTCAGTGG - Intergenic
1023202020 7:37708565-37708587 TGTACATACAGTAAAGTCAGGGG + Intronic
1023554848 7:41410582-41410604 TGTAAATTCTCTAAAGACAGTGG - Intergenic
1025530325 7:61872592-61872614 TGAAAACTCATTGAAGTCAGTGG - Intergenic
1028213884 7:88108247-88108269 TGAACACTTACTGAAGTCCGTGG - Exonic
1030087861 7:105832478-105832500 TTTACACTCACTGAGGTCTGGGG - Intronic
1032936478 7:136738554-136738576 TGTACATTCAATAAATTCTGGGG - Intergenic
1033764013 7:144467706-144467728 TGTAGATTGACTAAAGTCACAGG + Intronic
1034834650 7:154340527-154340549 AATACACTCATTAAAATCAGAGG - Intronic
1038160924 8:25036656-25036678 TGTACAATAACCAAAGTCATGGG - Intergenic
1040962550 8:53050162-53050184 TGGAAACACAGTAAAGTCAGGGG - Intergenic
1041850169 8:62381971-62381993 TGTGCAGTCCCTAAAGACAGAGG - Intronic
1042674957 8:71309995-71310017 TGTACATGTACTAAACTCAGAGG - Intronic
1045872675 8:106944115-106944137 TGTAGCCTCAATAAAGTGAGGGG - Intergenic
1046198242 8:110890691-110890713 TGTACACATACCAAAGTCATAGG + Intergenic
1047612080 8:126530823-126530845 TGTATACTCCATAAAGACAGTGG + Intergenic
1048785826 8:138049179-138049201 TGTACACTCAATGAGGTCACAGG - Intergenic
1051398168 9:16649453-16649475 TGAACTATCACTAAACTCAGAGG + Intronic
1051467585 9:17397729-17397751 TGCACATGCACTAATGTCAGAGG - Intronic
1053461538 9:38275014-38275036 TGTACAATCACTGGAGTAAGTGG - Intergenic
1053491028 9:38502592-38502614 TGTTGACTCACAAAAGTCAGAGG - Intergenic
1056987209 9:91374375-91374397 TGTACACACACAAAAGTTATAGG - Intergenic
1057671343 9:97091795-97091817 TGTTGACTCACAAAAGTCAGAGG - Intergenic
1062151560 9:135021858-135021880 CGTACACTCACAAAACTCTGGGG - Intergenic
1187991493 X:24878474-24878496 TGCACACTGAATAAAGGCAGGGG + Intronic
1194139034 X:90185647-90185669 TGTACATTTGCCAAAGTCAGTGG + Intergenic
1195754461 X:108187428-108187450 TATCCACTAACTAAAGTCAGAGG - Intronic
1196887188 X:120259117-120259139 TGGACATTCACTAAAGCCAACGG + Exonic
1197907272 X:131439080-131439102 TGTACACACACAGTAGTCAGTGG + Intergenic
1198185316 X:134248794-134248816 TATACAATCACTAACTTCAGAGG + Intergenic
1199087834 X:143649453-143649475 TGTACACACACAAAAATCAAGGG + Intergenic