ID: 1178715194

View in Genome Browser
Species Human (GRCh38)
Location 21:34957984-34958006
Sequence CTTTACAAGGATGCATTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 188}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178715194 Original CRISPR CTTTACAAGGATGCATTTGT TGG (reversed) Intronic
902619215 1:17640711-17640733 CTTTAAAAGGATGCGTTTTATGG + Intronic
906116792 1:43362515-43362537 CTTTAAAAGGATGCATTTTATGG + Intronic
907525580 1:55052255-55052277 CTTTCCAAGGCGACATTTGTGGG - Intronic
909041466 1:70657815-70657837 CTATACAAAGAGGCATTTTTGGG + Intergenic
909567939 1:77076712-77076734 TTTTACAAGGATGCAGTGGAAGG + Intergenic
910050717 1:82970996-82971018 CTATACAAGGTCACATTTGTAGG - Intergenic
912239808 1:107894091-107894113 ATTTACAAGGATGCTTTTGAGGG - Intronic
915258555 1:154656410-154656432 CTTTTGAAGGATGCATTTGCTGG + Intergenic
915307818 1:154990856-154990878 CTTTAAAAGGATGAATTTGATGG + Intronic
916061586 1:161102453-161102475 CTTTACAAAGGTGCAGTAGTGGG + Intronic
916139111 1:161678068-161678090 CTTTTCAAGGCTGTATTGGTTGG + Exonic
920553286 1:206883402-206883424 CTTTGAAAGGATGCATTTTATGG + Intergenic
920716008 1:208341023-208341045 CTCTAACAGGATCCATTTGTTGG + Intergenic
922312157 1:224404951-224404973 CTTTAAAAGGATGAATTTTATGG - Intronic
1064558129 10:16567988-16568010 CTGTAGAAGGATGCAGTTGTGGG - Intergenic
1065223694 10:23521591-23521613 TTTGAATAGGATGCATTTGTTGG + Intergenic
1067922117 10:50469902-50469924 CTTTACAAGTTTACATTTATAGG + Intronic
1068497748 10:57806803-57806825 CTTCACAAGGATGCCTTTCCTGG + Intergenic
1069908043 10:71743592-71743614 CTAAACAAGGATACATTTATAGG + Intronic
1073732754 10:106310080-106310102 CTTTTTAAGGGTGCATTTTTAGG - Intergenic
1076257710 10:129041844-129041866 GTTTATAAGTATGCATTTGATGG - Intergenic
1079418534 11:20263941-20263963 CTTTAAAAGGGTGAATTTTTTGG + Intergenic
1079819647 11:25109327-25109349 CTTTATAAGGAAAAATTTGTAGG - Intergenic
1080357487 11:31467587-31467609 TTTTAAAAAGATGCATGTGTTGG + Intronic
1080509868 11:32958272-32958294 ATTTACAAGGCTGCATGTGTGGG - Intronic
1081606019 11:44527430-44527452 CTGTACTAGGATTTATTTGTGGG - Intergenic
1082124745 11:48418869-48418891 CTTCTCAATGAAGCATTTGTGGG + Intergenic
1082558402 11:54590108-54590130 CTTCTCAATGAAGCATTTGTGGG + Intergenic
1082661031 11:55911621-55911643 CTTTGCAAGGTTTCATTTGTGGG - Intergenic
1082692733 11:56325454-56325476 CTTTACAAGGCAGCAGTGGTTGG - Intergenic
1082727444 11:56752928-56752950 CTTTACAAGTCTCCATTTCTAGG + Intergenic
1085339796 11:75723727-75723749 CTTTAAACGGATGCATTTTATGG + Intronic
1085954457 11:81374375-81374397 ATGTACAAGGATGTATTTTTGGG + Intergenic
1088337594 11:108724044-108724066 GTTTTCTAGGATGCTTTTGTAGG + Intronic
1088845711 11:113664632-113664654 CTTTAAAAGGATGGATTTTATGG - Intergenic
1089475731 11:118760132-118760154 CATTTCATGGATGCTTTTGTTGG - Intronic
1090001483 11:122963917-122963939 CTTTAAAAGGATGCTCTTGTTGG - Intergenic
1090141431 11:124267976-124267998 CTTTACAAGTATATTTTTGTAGG - Intergenic
1091195017 11:133723527-133723549 ACTTACAATGATTCATTTGTTGG - Intergenic
1091940534 12:4476465-4476487 CTTTAAAAGGATGGGTTTGATGG + Intergenic
1093154266 12:15662249-15662271 ATTGACAAGGATGCATTTCATGG - Intronic
1093364949 12:18282610-18282632 CTTGAGAAGGATGAATTTGTTGG - Exonic
1094376753 12:29798327-29798349 CTTTAAAAGGATGCATTTTATGG + Intergenic
1098561023 12:71873080-71873102 CTTTAAAAGGATGCATTTTATGG - Intronic
1098827662 12:75318120-75318142 CTCTACAAGGATGAATGTGCAGG - Intronic
1099007249 12:77248446-77248468 CTTTTCAAAGATGCTTTTCTGGG + Intergenic
1103806447 12:123577359-123577381 CTTTAAAAGGATGGATTTTATGG + Intergenic
1104164129 12:126210231-126210253 CTTTACAAAGAGGCATTGTTTGG - Intergenic
1106097199 13:26658593-26658615 CTTGAGCAGGAAGCATTTGTTGG + Intronic
1106800398 13:33250538-33250560 CTTTAAAAGGATGCAGTCTTAGG - Intronic
1108069413 13:46613088-46613110 CTTTAAAAAAATGCATTTCTAGG + Intronic
1109129357 13:58561913-58561935 ATATACAAGGATCCATTTCTAGG + Intergenic
1110332388 13:74287796-74287818 CTGTCCAAGGATGCAGATGTTGG - Intergenic
1110598106 13:77341147-77341169 CTTTAAAAGGATGAATCTTTTGG + Intergenic
1111393583 13:87632954-87632976 CTTTAGAAGGATTCATTTGAAGG + Intergenic
1114413696 14:22524579-22524601 CTTCACAATGGTACATTTGTTGG + Intergenic
1115871299 14:37806010-37806032 TTTTATAATGATGCATTTGCTGG + Intronic
1119448054 14:74683165-74683187 CTTTAAAAGGATGAATTTTATGG + Intronic
1120157353 14:81108406-81108428 ATTGACAAAGATGCATTTGGAGG + Exonic
1121802454 14:96785966-96785988 CTTATCAAGGATGCTTTTGGTGG + Intergenic
1124219006 15:27833136-27833158 CTTTACAAGGTTGTATATTTAGG - Intronic
1125364141 15:38895953-38895975 CTTTGAAAGGATGTTTTTGTAGG - Intergenic
1126829453 15:52585653-52585675 CTTTACCAGGATACATATTTTGG - Intronic
1128026653 15:64443061-64443083 CTTTACAAGAATGATTTTGATGG + Intronic
1128282165 15:66404893-66404915 ATAGACAAGGATGCATCTGTAGG + Intronic
1130795220 15:87200753-87200775 CTTTTTAAGAATGCATTTGTTGG + Intergenic
1133070074 16:3240483-3240505 CTTTAAAAGGATGCATTTTATGG + Intergenic
1134305138 16:13025179-13025201 TTATACAGGGATACATTTGTAGG + Intronic
1135891384 16:26360452-26360474 CTTCACAAGGCTGCATCTATAGG + Intergenic
1136689454 16:32018495-32018517 CTTTAAAAGGGTGCATTTTGTGG + Intergenic
1136790044 16:32962037-32962059 CTTTAAAAGGGTGCATTTTGTGG + Intergenic
1137361137 16:47816498-47816520 CATTAGAAGCATGCATTTGCAGG - Intergenic
1137441190 16:48499614-48499636 CTTTAAAAGGATGAATTTAATGG + Intergenic
1138103236 16:54271301-54271323 TTTTAAAAGGATGGTTTTGTTGG - Intergenic
1139877638 16:70158877-70158899 CTTTACAAAGATGGCTTTGGAGG - Exonic
1140062765 16:71585742-71585764 CTTGAAAAGGATGCATTTTATGG - Intergenic
1203092247 16_KI270728v1_random:1223500-1223522 CTTTAAAAGGGTGCATTTTGTGG + Intergenic
1142776557 17:2144520-2144542 CTTTACAAGGTAGCTTTTTTGGG + Intronic
1143044181 17:4063475-4063497 TTTTAAAAGGAAGCATTTTTTGG - Intronic
1146361932 17:32184097-32184119 CTTTAAAAGGATGAATTTTAAGG - Intronic
1146656845 17:34639553-34639575 CTTTATAAGGGCACATTTGTGGG - Intergenic
1147152296 17:38524640-38524662 CTTTAAAAGGGTGCATTTTGTGG + Intergenic
1150484658 17:65535434-65535456 TTTTGCTATGATGCATTTGTCGG + Intronic
1151779870 17:76238899-76238921 CTTTGCAAGGATTCATTCTTTGG + Intronic
1152059081 17:78055853-78055875 CTTTCCAAGGGTACATATGTGGG + Intronic
1155807956 18:30195983-30196005 CTTTAAAAGGATGAATTTTATGG - Intergenic
1156512885 18:37655806-37655828 CTTTCCCAGGAAGCATCTGTGGG + Intergenic
1156567284 18:38206974-38206996 CTTTACAAGGAAGCCATTGATGG - Intergenic
1157134123 18:45037479-45037501 CTTTACATGGATTGACTTGTCGG + Intronic
1160525981 18:79537615-79537637 CTTTACATGCATGTATTTGTGGG + Intergenic
1163391968 19:17036587-17036609 CTTCACAAGCATGCATTTGGAGG - Intergenic
1164138718 19:22438359-22438381 TATTACAAAGATGCAATTGTAGG + Intronic
1164780996 19:30892655-30892677 CTTTAAAATGAAACATTTGTGGG - Intergenic
1165004844 19:32796287-32796309 CTTTAGAAAGTTGCATCTGTTGG + Intronic
925371043 2:3345774-3345796 CTTTACACGGATGCACATGTAGG + Intronic
926000527 2:9328310-9328332 CTTTAAAAGGATGAATTTTATGG + Intronic
926274706 2:11395084-11395106 CTGTAAAAGGATGGGTTTGTGGG - Intergenic
926354428 2:12027706-12027728 CTTTACAAGGGCGAATTTTTTGG - Intergenic
926547225 2:14256367-14256389 CTTTAAAAGTAAGCATTTATTGG - Intergenic
928786670 2:34895314-34895336 GTTTACAAGGATTCGTTTCTAGG - Intergenic
930145086 2:47993887-47993909 CTTTATAAGTATGCATGTTTTGG + Intergenic
930694924 2:54401570-54401592 CCTTACATGCATGCATATGTAGG + Intergenic
931218091 2:60264673-60264695 CTTGACAAGGATTCATTTTGTGG - Intergenic
934871597 2:97871705-97871727 TTTTACAAGGATAGTTTTGTGGG - Intronic
935499268 2:103818473-103818495 CTATAGAAAGATACATTTGTTGG + Intergenic
936435381 2:112500661-112500683 CTTTAAAAGGATAAATTTTTTGG + Intronic
937295836 2:120809491-120809513 CTTTACAAGGGTGCATTTTATGG + Intronic
939997994 2:148938302-148938324 CTTTAAAAGGATGAATTTTGCGG - Intronic
940773404 2:157862557-157862579 CTTTTCAAAGAGGCTTTTGTTGG - Intronic
941440861 2:165533707-165533729 CTATTCAAGGATGCTTTGGTAGG + Intronic
942749026 2:179267197-179267219 GTTTACAAGGCTGCATATGGGGG - Intergenic
943790686 2:191929306-191929328 CTTTACAAGGTTGCTTTAATTGG + Intergenic
943993150 2:194723372-194723394 CTTTAGAATGATGAATCTGTGGG - Intergenic
944321068 2:198342991-198343013 CTCTAAAAGAATACATTTGTGGG - Intronic
945346567 2:208724778-208724800 CTAGACAATGATGCATTTGTAGG - Intronic
945603540 2:211897377-211897399 CTTTATAATGATGCATATGAAGG + Intronic
945697835 2:213130454-213130476 CTTGAAAAGGAAGCATTTGGGGG + Intronic
946710124 2:222496947-222496969 CTTTACATGGGTGCTTCTGTAGG - Intronic
946782719 2:223207551-223207573 GTTTTGGAGGATGCATTTGTTGG - Intergenic
1169137783 20:3208188-3208210 CCTTACATGGATGCCTTTCTTGG - Intergenic
1174949230 20:55026336-55026358 GTTTTCAAGGAGGCATATGTAGG - Intergenic
1177253477 21:18627984-18628006 CTTTTCAAGGATAGTTTTGTGGG + Intergenic
1178009049 21:28261361-28261383 CTTTACAAAGATTCCTTTGAAGG - Intergenic
1178221123 21:30661322-30661344 CTTTAAAAGGCTGAATTTGATGG + Intergenic
1178353251 21:31888306-31888328 CGTTACTGGGATGCTTTTGTTGG + Intronic
1178715194 21:34957984-34958006 CTTTACAAGGATGCATTTGTTGG - Intronic
1182238672 22:28897107-28897129 CTTTAGAAGGATGAATCTGAAGG - Intronic
1183754900 22:39752525-39752547 TTTTAAAAGGATGCATTTTATGG + Intronic
950313091 3:11976028-11976050 CTTTAAAAGGATGAATTTTATGG + Intergenic
950313572 3:11980164-11980186 CTTTAGAAAGATTCTTTTGTTGG + Intergenic
950661847 3:14471670-14471692 CTCTTCAGGGGTGCATTTGTGGG - Intronic
951006648 3:17623653-17623675 ACTTACAAGGCTGCAATTGTAGG + Intronic
951062137 3:18221942-18221964 CTTTACAAAGTCGCATTTGTGGG - Intronic
952565263 3:34649789-34649811 CTTCTCAAGGATGAAGTTGTTGG + Intergenic
953178690 3:40576336-40576358 CTTTAAAAAGCTGCATTTATTGG - Intergenic
956128890 3:66036945-66036967 CTTTTAAAAGATGCATTTGCTGG - Intronic
956323588 3:68026240-68026262 CTTCACAAGGATTCGTCTGTGGG - Intronic
956805868 3:72810353-72810375 CTTTACAAGGATTCTTTACTAGG - Intronic
956874265 3:73446626-73446648 CTGTACAAGGATTCAGTTGCTGG + Intronic
957330522 3:78757682-78757704 CTTCACAAAGATACATTGGTGGG - Intronic
958673414 3:97233729-97233751 ATTTAAAAGGAAGCATTTTTTGG + Intronic
962785041 3:138760452-138760474 CTATTAAAGGGTGCATTTGTTGG - Intronic
965393693 3:168135634-168135656 CTTTACAAAGATTCATCTGAAGG + Intergenic
967710814 3:192705913-192705935 CTTTACAATTATTCATTTTTTGG + Intronic
973973056 4:56234112-56234134 CTTTAAAAGGGTGAATTTTTTGG - Intronic
975134658 4:70862974-70862996 CTGTATAATGATGCATATGTAGG + Intergenic
976160239 4:82191163-82191185 CTTTACAAGGTAACATTTATAGG + Intergenic
978130393 4:105188999-105189021 CTTTACAAGGATGTATTTTATGG + Intronic
978532852 4:109731562-109731584 CTTTACAAGGATGCAGACTTTGG + Intergenic
979166721 4:117542320-117542342 TTTTACAAGCATGTATTTGTGGG - Intergenic
981830088 4:148989382-148989404 TTTTTCAAGCATTCATTTGTGGG + Intergenic
984686375 4:182673157-182673179 CTTCAGAAGGATGCATTGATTGG + Exonic
984894739 4:184527983-184528005 CTTTAAAAGGATGGATTTTGTGG - Intergenic
984994734 4:185418950-185418972 CTTTAAAAGAATGAATTTGATGG - Intronic
985196486 4:187435768-187435790 TTTTTCATGGATCCATTTGTGGG + Intergenic
985903012 5:2811739-2811761 TTTTACAACGATGCATTTACTGG + Intergenic
986600148 5:9464973-9464995 CATTTCAAGGAAGCATTTTTGGG - Intronic
987023665 5:13901153-13901175 CTTTAGAAAGCTGGATTTGTAGG - Intronic
987868722 5:23582465-23582487 CTTTAGAAATATACATTTGTAGG - Intergenic
990722050 5:58707870-58707892 CTTTACTAGGATTCATTGCTTGG + Intronic
991547326 5:67797060-67797082 CTTTGCTAGGATGCATATGATGG + Intergenic
992253084 5:74895139-74895161 CTGTACCAGGAGTCATTTGTAGG + Intergenic
992456926 5:76924607-76924629 CTTAACAAAGATACATTTATGGG + Intergenic
992655255 5:78902894-78902916 CTTTAAAAGGATGAATTTCATGG + Intronic
993458769 5:88157786-88157808 CTTTACAAAGCAGCATTTGGTGG + Intergenic
995435055 5:112126501-112126523 CTTTAATATAATGCATTTGTGGG - Intergenic
995911350 5:117191294-117191316 ATTTATAAGGAAGCATTTGAGGG + Intergenic
997053675 5:130413790-130413812 TTTTATAAGGATGCATGTGATGG + Intergenic
997825750 5:137105612-137105634 CTTTACAAGGTAGCAATTGTTGG + Intronic
998962448 5:147502970-147502992 CTTTACAAATATGCATGTGGAGG - Intronic
1003066123 6:2904422-2904444 CTTTAAAAGGATGCATATTATGG - Intergenic
1003952834 6:11132899-11132921 CTTTAAAAGGATGAATTTTAGGG + Intronic
1004360930 6:14970421-14970443 ATTTACAAATATGTATTTGTAGG + Intergenic
1009941549 6:70294889-70294911 CTTTGCAAGAATGTATTTTTTGG - Intronic
1011171337 6:84507395-84507417 ATTTTCAAGGATATATTTGTTGG + Intergenic
1013195010 6:107837321-107837343 CCTTACAAGGGTGCATGTCTTGG + Intergenic
1015277002 6:131393295-131393317 CTTTAAAAGAATGAATTTTTTGG + Intergenic
1019471138 7:1221695-1221717 CTTTAAAAGGATGGATGTGATGG + Intergenic
1020722958 7:11772562-11772584 CTTTACATGGATGCAGCTGGAGG + Intronic
1021779726 7:24091550-24091572 TTATACAAGTATTCATTTGTGGG + Intergenic
1023074238 7:36467312-36467334 CTTTTCAAGGATGTTTGTGTGGG + Intergenic
1027943587 7:84717138-84717160 CTTTATAAACATGCATTTTTAGG + Intergenic
1031837864 7:126700892-126700914 CTTTATCAGGATGCAATTTTAGG - Intronic
1033028306 7:137799473-137799495 CTTTAAAAGGATGAATTTTATGG + Intronic
1033434991 7:141325229-141325251 CTTCACAAAGATGCATGTCTAGG - Intronic
1034268912 7:149794024-149794046 CTTGAAATGGATGCATTTATGGG + Intergenic
1034297307 7:149985784-149985806 ATTTGAAAGGATGCATTTTTAGG + Intergenic
1040039425 8:42901414-42901436 CTTTAAAAGGATGAATTTTATGG - Intronic
1040992412 8:53366840-53366862 ATCTACATGAATGCATTTGTAGG + Intergenic
1041858584 8:62484955-62484977 ATGTACAGGAATGCATTTGTTGG - Intronic
1042198281 8:66253184-66253206 GCTTACAAACATGCATTTGTGGG - Intergenic
1042559332 8:70061204-70061226 CTCTGCAGGGATGCTTTTGTAGG - Intronic
1043378006 8:79671466-79671488 CCTTGCTAGGCTGCATTTGTTGG - Intergenic
1043712066 8:83433352-83433374 TTTCACAAGGTTGCATTTGTGGG + Intergenic
1046694535 8:117324689-117324711 CTTTAAAAGGATGAATTTCATGG + Intergenic
1047425011 8:124737180-124737202 CTTTAAAAGGGTGCATTTTATGG - Intergenic
1050640280 9:7660295-7660317 CTTAACAATGATGCATCTGAAGG + Intergenic
1055564870 9:77558204-77558226 CTTAACAAAGAAGCATTTGGAGG + Intronic
1059516589 9:114901563-114901585 CTTTTCAAGAATGCATGAGTTGG + Intronic
1060081053 9:120645747-120645769 CTTTATAAGGAGGCCTTTGAGGG - Intronic
1060558742 9:124525263-124525285 TTTTACAAGCATGAATGTGTAGG - Intronic
1062510543 9:136902928-136902950 CTTTGCAATGATGCCTTTCTAGG + Intronic
1186109548 X:6241515-6241537 ATTTAAAAGTATGCATTTCTGGG + Intergenic
1189562830 X:42208603-42208625 CTTTAAAATAAGGCATTTGTAGG + Intergenic
1190443594 X:50500584-50500606 CTGTACAAGCATGCCATTGTGGG + Intergenic
1190746356 X:53324762-53324784 CTTTACAAGGGTGAATTTTATGG + Intergenic
1192732901 X:73819025-73819047 CTTTGCAAGGCTGGATGTGTAGG - Intergenic
1193131600 X:77926229-77926251 TATTTCAAGGATGCCTTTGTAGG - Intronic
1193599404 X:83490860-83490882 CCTTAGAAGGATCCCTTTGTTGG - Intergenic
1194582080 X:95686577-95686599 CTTTAAAATGATGAATTTGGGGG - Intergenic
1198303234 X:135351559-135351581 CTTTACAAGTATGCATATTGTGG + Intronic
1198606046 X:138338974-138338996 CTTTATAAGGATGCAGATTTTGG + Intergenic
1201903429 Y:19066124-19066146 CCTCACAAGGATGCTTTTGAGGG - Intergenic