ID: 1178721713

View in Genome Browser
Species Human (GRCh38)
Location 21:35016591-35016613
Sequence CAGAAGAAGGAGCAGGATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1271
Summary {0: 1, 1: 0, 2: 8, 3: 166, 4: 1096}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178721713_1178721723 24 Left 1178721713 21:35016591-35016613 CCCTCATCCTGCTCCTTCTTCTG 0: 1
1: 0
2: 8
3: 166
4: 1096
Right 1178721723 21:35016638-35016660 TCTGTCCTGACCCATGGTCCAGG 0: 1
1: 0
2: 2
3: 17
4: 187
1178721713_1178721725 26 Left 1178721713 21:35016591-35016613 CCCTCATCCTGCTCCTTCTTCTG 0: 1
1: 0
2: 8
3: 166
4: 1096
Right 1178721725 21:35016640-35016662 TGTCCTGACCCATGGTCCAGGGG 0: 1
1: 0
2: 1
3: 15
4: 164
1178721713_1178721722 18 Left 1178721713 21:35016591-35016613 CCCTCATCCTGCTCCTTCTTCTG 0: 1
1: 0
2: 8
3: 166
4: 1096
Right 1178721722 21:35016632-35016654 CCTTAATCTGTCCTGACCCATGG 0: 1
1: 0
2: 1
3: 8
4: 110
1178721713_1178721724 25 Left 1178721713 21:35016591-35016613 CCCTCATCCTGCTCCTTCTTCTG 0: 1
1: 0
2: 8
3: 166
4: 1096
Right 1178721724 21:35016639-35016661 CTGTCCTGACCCATGGTCCAGGG 0: 1
1: 0
2: 1
3: 16
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178721713 Original CRISPR CAGAAGAAGGAGCAGGATGA GGG (reversed) Intronic
900001203 1:15795-15817 CAGCAGAAGGAGCAGGAGCAAGG - Intergenic
900020918 1:186316-186338 AAGCAGAAGGAGCAGGAGCAAGG - Intergenic
900293952 1:1939348-1939370 CAGAAGAAAGAGCGGGGAGAGGG + Intronic
900361383 1:2290664-2290686 CAGGAGGAGGAGGAGGAAGAGGG + Intronic
900474557 1:2869996-2870018 CAGAGGGAAGAGGAGGATGAAGG + Intergenic
900809095 1:4787604-4787626 CAGGGGCAGGGGCAGGATGAGGG + Exonic
901016070 1:6231578-6231600 CAGAGGCAGAAACAGGATGAAGG + Intronic
901145828 1:7064110-7064132 GAGAAGAAGAAGGAGGAGGAGGG - Intronic
901877581 1:12175633-12175655 GACAGGAAGGAGCAGGATTAGGG - Intronic
901900672 1:12359051-12359073 CAGAAGTAGGATCAGGATTGGGG + Intronic
902489575 1:16771412-16771434 AAGAAGAAGAAGGAGGAAGAGGG + Intronic
902546194 1:17191979-17192001 AAGAAAAAGGAGAAGGAAGAGGG - Intergenic
902704527 1:18195451-18195473 GAGAAGAAGGAAGAGGAAGAAGG - Intronic
902726702 1:18340959-18340981 AAGAAGAAGGAGAAGAAGGAGGG - Intronic
902727866 1:18349342-18349364 CAGAAGAAAAATAAGGATGATGG + Intronic
902816185 1:18918011-18918033 CAGAGGAAGGGGCAGGAAGCGGG + Intronic
902840267 1:19069916-19069938 CAGAAGGAGGAAGAGGGTGAAGG - Intergenic
903004772 1:20291418-20291440 GAGAAGAGGGAGCAGGAGAAGGG - Intronic
903134332 1:21299478-21299500 CAGCAGAAGGAACAGGAATAGGG + Intronic
903361747 1:22781332-22781354 AAAAAGAAGAAGAAGGATGAGGG + Intronic
903549919 1:24150688-24150710 CAGCAGTAGGAGGAGGAGGAGGG + Intergenic
903581268 1:24372788-24372810 CAGAAGCAGGAGGAGGAGCAGGG - Intronic
903705129 1:25280029-25280051 CAGGAGAAGTGGGAGGATGAGGG + Intronic
903790576 1:25890210-25890232 CAGAAGAAGGAGCTTGGGGAAGG + Intronic
904031103 1:27533847-27533869 CAGAAGCAGGAGCCCCATGATGG + Intergenic
904087181 1:27917090-27917112 AAGAAGCAGGAGGAGGAGGAGGG - Intergenic
904295393 1:29516937-29516959 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295740 1:29518748-29518770 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295752 1:29518808-29518830 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295769 1:29518898-29518920 AAGAAGAAGGAGAAGGAAGAAGG - Intergenic
904440255 1:30525332-30525354 AAGAAGAAAGAGGAGGAGGAGGG + Intergenic
904626089 1:31803816-31803838 GAGAAGAAGGAGGAGGAGGAGGG + Intronic
905035130 1:34913120-34913142 CAGAAAATGGAGAAGGAAGAAGG + Intronic
905409563 1:37759072-37759094 CAGAAGATGAAGAAGGAAGATGG - Intronic
905417493 1:37814179-37814201 CAGAAGAAGGTGCAGATTTAAGG - Exonic
905873855 1:41419709-41419731 CAGCAGAAGGAGCAGGAGCTGGG - Intergenic
905929752 1:41778809-41778831 AAGGAGATGGAGCATGATGAGGG + Intronic
906180817 1:43817339-43817361 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
906180828 1:43817431-43817453 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
906180868 1:43817697-43817719 GAGGAGAAGGAGAAGGAAGAAGG - Intronic
906191973 1:43904758-43904780 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906191991 1:43904827-43904849 CAGGAATAGGAGCAGGAGGAGGG - Intronic
906192249 1:43905754-43905776 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906192337 1:43906081-43906103 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906192381 1:43906225-43906247 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906528651 1:46511001-46511023 CAGAAGCAGAAGGAGGCTGAGGG + Exonic
906617174 1:47241387-47241409 CAGGAGAAGGAGCTGGAGGAAGG - Intergenic
906687563 1:47772324-47772346 CAGAGAGAGGAGCAGGACGAAGG + Intronic
906708060 1:47909447-47909469 AAGAAGAAGGAGAAGGAGAAGGG + Intronic
906958597 1:50398881-50398903 CAGGAGGAGGAGGAAGATGAAGG - Intergenic
907488078 1:54790841-54790863 AAGAAGGAGGAGGAGGAGGACGG - Intronic
907555055 1:55336159-55336181 CAGAAGAAGGGGCAGGAGGGAGG + Intergenic
907758853 1:57337968-57337990 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
907901337 1:58744160-58744182 CAAAAGAAGGGTCAGGATGGTGG - Intergenic
909172120 1:72310452-72310474 AAGGAGAAGGAGCAGAATGAGGG - Intergenic
909660005 1:78071531-78071553 AAGAAGAAGGAGAAGGAAGGAGG - Intronic
910049072 1:82955774-82955796 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
910146386 1:84085521-84085543 CACAGGAAGCAGCAAGATGAGGG + Intronic
910203670 1:84725823-84725845 CCAAAGAAGGAGTAGGGTGAAGG - Intergenic
910229177 1:84968715-84968737 GACAAGAAGGAGCAGGTTAAAGG - Intronic
910286120 1:85556141-85556163 GAGAAGGAGGAGAAGGAGGAAGG - Intronic
910333029 1:86097591-86097613 GAGGAGAAGGAGAAGGACGAGGG - Intronic
910461542 1:87453139-87453161 CATAAGCAGAAGCAGGGTGAGGG - Intergenic
910699161 1:90053572-90053594 CATAAGAAAGACCAGGATGGGGG + Intergenic
910791447 1:91055204-91055226 CAGAGGGAGGAGCAGGTTTAGGG + Intergenic
911553427 1:99312734-99312756 CAGAAGTAGGAGTAGGAGGGAGG + Intergenic
912095491 1:106137129-106137151 CAGAAGAAGAAGGAGAAAGAGGG + Intergenic
912102390 1:106226592-106226614 CAAAAGAAGAAGCAAGATGCTGG + Intergenic
912228633 1:107766232-107766254 AAGAAGAAGGAGGAGGGGGAAGG - Intronic
912228636 1:107766238-107766260 AAGAAGAAGAAGAAGGAGGAGGG - Intronic
912804009 1:112741785-112741807 GAGGGGAAGGAGGAGGATGAGGG + Intergenic
913200963 1:116495156-116495178 CGGAGGAAGGAGCAGGAGGAGGG - Intergenic
913245905 1:116869735-116869757 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
913264812 1:117033923-117033945 CAGAAGGAGGAGCAGGACGAAGG - Exonic
913437976 1:118866740-118866762 GAGAAGAAGGGGAAGGAAGAAGG + Intergenic
913963694 1:143357590-143357612 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
914058053 1:144183179-144183201 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
914121092 1:144783186-144783208 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
914215907 1:145627999-145628021 CAGAGGAAGGAACAAGTTGAGGG + Intronic
914467850 1:147948384-147948406 CAGAGGAAGGAACAAGTTGAGGG + Intronic
914857275 1:151361980-151362002 GAAAAGAAGGAGGAGGAGGAAGG + Intergenic
915035307 1:152918726-152918748 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
915271324 1:154755817-154755839 AAGAAGAAGAAGGAGGAGGAGGG + Intronic
915271374 1:154756065-154756087 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
915360412 1:155283016-155283038 GAGAAGCAGGAACAGAATGAGGG + Intronic
915622500 1:157094382-157094404 GATTAGAAGGAGCAGGAAGAAGG - Intronic
915980041 1:160414828-160414850 CTGAAGAATGAGCAGGATTTGGG + Intronic
917313592 1:173702588-173702610 AGGAAGAAGGAGAAGGAGGAAGG + Intergenic
918036680 1:180880197-180880219 CAGATGATGGACCAGGATGATGG + Exonic
918069511 1:181124592-181124614 CAGAAGGAGGAGGAGGAGGGAGG - Intergenic
918069512 1:181124595-181124617 AAGCAGAAGGAGGAGGAGGAGGG - Intergenic
918179499 1:182074127-182074149 AAGAAGAAGGAGGAGGAGGGTGG + Intergenic
918618957 1:186580559-186580581 CAAAAGCTGGAGCAGCATGATGG - Intergenic
918714690 1:187770692-187770714 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
919227493 1:194725670-194725692 CAGAAGGAGGGGGAGGATAAAGG - Intergenic
919240833 1:194914237-194914259 AAGAAGAAGCAGCTGGATGTTGG + Intergenic
919449334 1:197751867-197751889 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
919449350 1:197751936-197751958 AAGAAGGAGGAGGAGGAGGAAGG + Intronic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919595850 1:199561547-199561569 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
919751871 1:201042803-201042825 CATAAAAAACAGCAGGATGAGGG - Intronic
919841110 1:201610045-201610067 CAGAAGAAGGAGCAGAGAGAAGG + Intergenic
919879373 1:201891899-201891921 CAGATGCAGGTACAGGATGAGGG - Exonic
920199469 1:204250638-204250660 CTGCAGCAGGGGCAGGATGAGGG + Intronic
920262781 1:204700878-204700900 AAGAAGAAGAAGAAGGATCAGGG - Intergenic
920303791 1:205005987-205006009 CAGAACAAGCACCAGGAAGATGG + Intronic
920533902 1:206724738-206724760 GAGAAGAAGCAACAGAATGAGGG + Intronic
921072156 1:211669878-211669900 CAGAAGAAGGGGAGGGGTGATGG - Intronic
921353370 1:214261003-214261025 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
921396866 1:214677825-214677847 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
921543100 1:216442693-216442715 AAAAAGAAGGAGGAGGAGGAGGG + Intergenic
923010304 1:230083163-230083185 CAGAGTGGGGAGCAGGATGATGG + Intronic
923052068 1:230396082-230396104 CAGTAGGAGGAGCAGAAAGAGGG - Intronic
923072356 1:230577598-230577620 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
923517732 1:234711607-234711629 GGGAAGAAGGAGGAGGAGGATGG - Intergenic
923530862 1:234811113-234811135 AAGAAGAAGAAGGAGGAAGAGGG - Intergenic
923600134 1:235395525-235395547 AAGAAGAAGAAGTAGAATGATGG - Intronic
923925750 1:238625459-238625481 CAGAGGAAGTAATAGGATGATGG + Intergenic
923994040 1:239471549-239471571 CAGAGGCAGGATCAGGAAGAGGG + Intronic
924003029 1:239574742-239574764 GAGGAGGAGGAGCAGCATGAGGG - Intronic
924313973 1:242776570-242776592 CAGAAGCAGGAGCAAGAGAAAGG + Intergenic
924608669 1:245556299-245556321 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
924608680 1:245556345-245556367 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
924719039 1:246605865-246605887 GAGAAGCAGAAGCAGGAAGAGGG - Intronic
924722234 1:246634992-246635014 GAGAAGCAGAAGCAGGAAGAGGG - Intronic
924795644 1:247290488-247290510 GAGAAGCAGAAGCAGGAAGAGGG + Intergenic
1062936556 10:1394896-1394918 AAGAAGAAGGAGGAGGAGGGAGG - Intronic
1063343127 10:5286990-5287012 GAGGAGAAGGAGGAAGATGAAGG - Intergenic
1063475571 10:6325895-6325917 CGGCAGAAGGAGCATGAGGAAGG - Intergenic
1063621037 10:7649314-7649336 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1064294958 10:14070540-14070562 CAGAAGAAGGGACATGATGATGG + Intronic
1064510228 10:16082113-16082135 CATAAGTAGGAGCTGAATGATGG + Intergenic
1064895787 10:20234682-20234704 CAGAATAAGAAGCAGGAAAAAGG - Intronic
1065000106 10:21330720-21330742 CAGGAAAGGGATCAGGATGAGGG + Intergenic
1065493662 10:26307692-26307714 AAGAACAGGGAGCTGGATGAAGG - Intergenic
1065667871 10:28082456-28082478 AAGAAGGAGGAGGAGGAGGAAGG - Intronic
1065973684 10:30824502-30824524 CAGAAGAAGGAGGAGATGGAGGG - Intronic
1066187775 10:33027112-33027134 CAAAATAAGGAGCAAGATGGGGG + Intergenic
1066215830 10:33286403-33286425 CAGATGTAGGAGGAGGATGTAGG - Intronic
1067182135 10:43996322-43996344 CAGAAGAGGGTGCAGGAAGAGGG + Intergenic
1067241023 10:44493694-44493716 AAAAAGAAAGAGAAGGATGAAGG - Intergenic
1067337511 10:45377328-45377350 CAGAAGAGGGGGCAGAATGTAGG - Intronic
1067382443 10:45787409-45787431 GAAAAGCAGGTGCAGGATGAGGG - Intronic
1067572131 10:47379435-47379457 AATAAGAAGGAGCAGGAGGATGG + Intronic
1067878819 10:50026281-50026303 CGGAAGCATGACCAGGATGAAGG + Intergenic
1067890141 10:50127957-50127979 GAAAAGCAGGTGCAGGATGAGGG - Intronic
1067945141 10:50684456-50684478 CAGGAGCTGGAGCAGGAGGAAGG + Intergenic
1068052517 10:51968356-51968378 CAGAAGAAAGAGCAGGACTGTGG + Intronic
1068300904 10:55137768-55137790 CAGAAGAGTGAACAGGGTGAGGG + Intronic
1069107114 10:64396787-64396809 CAAAACAAGTAGCAGGATAAGGG - Intergenic
1069539871 10:69285903-69285925 CAGGAGACGGAGTAGGAGGAGGG - Intronic
1069589485 10:69632962-69632984 CAGGAAGAGGAGCAGGATGGAGG - Exonic
1069668738 10:70183598-70183620 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1070161307 10:73868258-73868280 CAGAGGAAGCAGCAGGAAGAAGG + Intronic
1070312579 10:75284353-75284375 CAGAAGAGGGAGCAGCAGGCGGG + Intergenic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070627832 10:78063686-78063708 TAGAGGAAGGATCAGGGTGAGGG - Intergenic
1071358023 10:84817959-84817981 CAGCAGCAGCAGCAGCATGAGGG + Intergenic
1071445964 10:85747522-85747544 AAGAGGAAGGGGCAGGAGGAAGG - Intronic
1071633558 10:87233551-87233573 CAGGAGCTGGAGCAGGAGGAAGG + Exonic
1071647005 10:87365767-87365789 CAGGAGCTGGAGCAGGAGGAAGG + Exonic
1071855027 10:89615430-89615452 CAGGAGATGAAGCAGGAGGAAGG - Intronic
1072306866 10:94116090-94116112 GAGAGGAAGGAGCAGGAGGAAGG - Intronic
1072547091 10:96448162-96448184 CAGCGGAACGAGCAGGATGCAGG - Intronic
1073330841 10:102669066-102669088 AAGAAGAAAAAGCAGGAGGAAGG - Intergenic
1073336514 10:102714289-102714311 CAGGAGGAGGAGGAGGAGGAGGG - Exonic
1073340775 10:102742906-102742928 CAGAAGAAGCAGCAAGGAGATGG + Exonic
1073371659 10:102995189-102995211 AAGAGGAAGGAGGAGGAAGAGGG - Intronic
1073513887 10:104060360-104060382 GAGAAGAAAGAGAAGGAGGAGGG + Intronic
1073566548 10:104540222-104540244 TAGAAAAAAGAGCAAGATGAAGG + Intergenic
1074388087 10:113033201-113033223 CAGCAGAAGGAGGAGGAGGAAGG - Intronic
1074732160 10:116390739-116390761 GAGGAGAAGGAGGAGGAAGAAGG + Intergenic
1074737012 10:116445957-116445979 GGGAAGAAGGAGAAGAATGAAGG + Intronic
1074773772 10:116751071-116751093 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1074960117 10:118437049-118437071 CAGAAGAAGCAGCAGTTTGGGGG - Intergenic
1075148045 10:119899998-119900020 CAGGAGGAGAAGCAGGAGGAAGG - Intronic
1075292390 10:121241592-121241614 CTGAAGAAGGAGCAGCAGGCAGG + Intergenic
1075301719 10:121330659-121330681 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1076246565 10:128951363-128951385 GAGAAGCAGGTGCAGGGTGACGG + Intergenic
1076564094 10:131386487-131386509 CAGAGGGAGGAGCAGGGAGAGGG + Intergenic
1076623913 10:131810164-131810186 CAGGAGGAAAAGCAGGATGATGG + Intergenic
1076825580 10:132965697-132965719 GAGAAGTAGGAACAGCATGAAGG - Intergenic
1077613800 11:3660935-3660957 CAGAAGAAGAACCATGAGGATGG + Intronic
1077651353 11:3975624-3975646 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1077924437 11:6666746-6666768 GAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1077978311 11:7273149-7273171 CAGAAGTAAGAGCAGGTAGAGGG + Intronic
1078612938 11:12837707-12837729 AAGAAGAAGGAGAAGGAGAAGGG - Intronic
1078848573 11:15143397-15143419 CAGAGGAAGGAGTACTATGAAGG + Intronic
1079086797 11:17451894-17451916 CAGAAGAAGGGACAAGAGGAGGG - Intronic
1079445555 11:20553592-20553614 AAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1079623940 11:22592851-22592873 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1079703936 11:23589047-23589069 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1079724568 11:23865126-23865148 CAGAAGAAGGAAAAGGAGTAGGG - Intergenic
1079810950 11:24999372-24999394 AAGGAGGAGGAGCAGGAAGATGG + Intronic
1079927887 11:26519075-26519097 CATAGGATGGGGCAGGATGAAGG - Intronic
1080394211 11:31875069-31875091 CAGTAGCAGGAGCAGCAGGAGGG - Intronic
1080484066 11:32686118-32686140 CAGATGAAAGAGGATGATGAAGG + Intronic
1080557365 11:33429900-33429922 TAGGAGAAGAAGCAGGAAGAGGG - Intergenic
1080680761 11:34473648-34473670 AAAAAAAAGGAGGAGGATGAGGG - Intergenic
1080872366 11:36248096-36248118 AAGAAGGAGGAGGAGGAAGAGGG - Intergenic
1080878909 11:36301198-36301220 CAGAAGAGGGAGGAGGAAGAAGG + Intronic
1081180724 11:39983519-39983541 CAGAAGGTGAAGCAGGAGGAGGG - Intergenic
1081606451 11:44530095-44530117 TAGAGGAAGGATGAGGATGATGG - Intergenic
1082721820 11:56687139-56687161 AAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1083169291 11:60913371-60913393 GAGGAGAAGCAGCTGGATGAGGG - Intergenic
1083224116 11:61273901-61273923 CAGGAGAGGAAGCAGGGTGAAGG - Intronic
1083254048 11:61485607-61485629 CAGGAGAGGGAGCAGCAGGAAGG - Intronic
1083374453 11:62208323-62208345 TAGAAGGAGGAGGAGGAAGAAGG + Intergenic
1083573431 11:63772133-63772155 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1083573437 11:63772154-63772176 GGGAAGAAGGAGAAGGAGGAGGG + Intergenic
1084104869 11:66974969-66974991 GAGAAGGAGGAGAAGGAGGAGGG + Intergenic
1084185086 11:67467319-67467341 CAGCAGCAGGAGCAGGAAGGAGG + Exonic
1084571659 11:69963411-69963433 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1085335416 11:75690053-75690075 AAGAAGAAGTAGAAGGAAGAAGG - Intergenic
1086056117 11:82649068-82649090 GAGAAGAAGGAGCAGAAGAAAGG - Intergenic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086123839 11:83329040-83329062 CAGAAGACAGATCAGGATGCTGG + Intergenic
1086194309 11:84118692-84118714 CAGCAGCAGAAGCAGGAAGATGG + Intronic
1086302509 11:85442919-85442941 AAGAAGAAGAAGGAGGAAGAAGG + Intronic
1086737935 11:90329940-90329962 AAGAAGAAGGAGGAGAAGGAGGG - Intergenic
1086851507 11:91814920-91814942 TAGAAGAAGCAGGAGGACGAAGG + Intergenic
1086998927 11:93393024-93393046 AAGTAGAAGGAGGAGGAGGAGGG - Intronic
1087070938 11:94079831-94079853 CAGAGCATGCAGCAGGATGAAGG + Intronic
1088765241 11:112969127-112969149 CATTAGATGGAGCAGGAAGAAGG + Intronic
1089001306 11:115054539-115054561 CAGAAGAAGCAGCAGGAGAAAGG + Intergenic
1089183977 11:116602515-116602537 CTGAAAAAGGGGCAGGATGGAGG - Intergenic
1089596043 11:119580963-119580985 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1089627312 11:119759619-119759641 GAGAAAATGGAGCAGGAAGAAGG + Intergenic
1089876800 11:121730227-121730249 GAGAAGAAGGGACAGGAGGAGGG - Intergenic
1090013155 11:123062515-123062537 CGGAAAAAGGAGGAGGAAGAGGG + Intronic
1090464628 11:126923293-126923315 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090464635 11:126923344-126923366 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090664991 11:128909016-128909038 CACATGAAGGAGCAGGAAGCAGG + Intronic
1090961548 11:131561781-131561803 AAGAAGAAGGATGATGATGAAGG - Intronic
1091074181 11:132599357-132599379 GAGAAGGAGGAGGAGGAAGAAGG + Intronic
1091337143 11:134780705-134780727 GAGAAGAAGGAGAAAGAGGAGGG - Intergenic
1091374293 12:15912-15934 AAGCAGAAGGAGCAGGAGCAAGG - Intergenic
1091882044 12:3987513-3987535 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1091884179 12:4003906-4003928 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1091904189 12:4169851-4169873 CAGAAGATGGTGCAAGATGAAGG + Intergenic
1092041241 12:5386542-5386564 GAGGAAAAGGAGGAGGATGAAGG - Intergenic
1092231515 12:6778189-6778211 CGGAAGGAGGAGAAGGATGAAGG - Intronic
1092750689 12:11716458-11716480 CAGAAACAGAAGCAGGATGATGG - Intronic
1092884781 12:12915605-12915627 GAGAAGGAGGAGAAGGAAGAAGG - Exonic
1092945662 12:13451525-13451547 CAGGAGAAGGAACAGGATGAGGG - Intergenic
1092964621 12:13629633-13629655 GAGAAGGAGGAGCAAGAGGAGGG - Intronic
1093017637 12:14170943-14170965 GAGAGGAAGGAGAAGGGTGAGGG + Intergenic
1093084579 12:14852466-14852488 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1093215110 12:16352858-16352880 AAGAAGGAGAAGCAGGATAATGG - Intronic
1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1093457072 12:19374985-19375007 GAGAAGGAGGAGGAGGAGGAAGG + Intronic
1093971782 12:25382564-25382586 GAGAAGAAGGGGCATGAGGACGG + Intergenic
1094056286 12:26272661-26272683 CACCAGAAGCAGCAGGATAATGG - Intronic
1094129893 12:27063500-27063522 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1094129901 12:27063562-27063584 CAGAAGAAAAAGAAGGAAGAAGG - Intronic
1094129903 12:27063588-27063610 CAGGAGGAGGAGGAGGAAGAAGG - Intronic
1094242354 12:28242892-28242914 CAGAAGTAGGAGCAAGAGGGGGG - Intronic
1094491093 12:30961176-30961198 CAGCAGAAGAGGCAGGAAGAGGG - Intronic
1094619249 12:32064558-32064580 AAGAAGAAGGAGAGGGAAGAAGG + Intergenic
1094628261 12:32146923-32146945 AAGAAGAAGGAGGAGGAAGGAGG - Intronic
1095399845 12:41801408-41801430 CAGATGAAAGAGAAGAATGATGG + Intergenic
1095800404 12:46266454-46266476 CAGCGGAAGGAACAGGAAGAAGG - Intronic
1096017952 12:48295672-48295694 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1096204003 12:49706763-49706785 CAGCAGAAGGGGGAGGAAGAAGG + Intronic
1096510106 12:52123025-52123047 CAGAAGCAGCGGCAGGAAGATGG - Intergenic
1096528419 12:52228133-52228155 AAGAAGAAGGAGGAGGGGGAGGG - Intergenic
1096638281 12:52975036-52975058 GAGGAGAAGGAGCAGGGAGAGGG + Intergenic
1096758748 12:53822222-53822244 AAGAAGAGGGAGGAGGAGGAGGG - Intergenic
1097139418 12:56887360-56887382 GAGAAGGAGGAAGAGGATGAAGG - Intergenic
1097172797 12:57127180-57127202 CAGAAACAGGAGCAGCACGAAGG - Intronic
1097426633 12:59453787-59453809 CAGGAGAAAGAGCAGGAATAAGG + Intergenic
1097726289 12:63079196-63079218 CAGAAAAAGGGGCAGGGTGGGGG - Intergenic
1097729169 12:63108031-63108053 CGGAAGAAGGAGAAAGAGGAAGG - Intergenic
1097894408 12:64810076-64810098 CAGGAGATGGAGCAGGGTGGAGG - Intronic
1097938381 12:65278487-65278509 GAGAAGGAGGAGGAGGAGGACGG + Intergenic
1098035642 12:66299608-66299630 GAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1098106035 12:67069517-67069539 AGGAAGAAGGAGGAGGAGGAGGG - Intergenic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1098281313 12:68865491-68865513 AAGAAGATGGAGAAGGATGAGGG - Intronic
1098358611 12:69633909-69633931 CTGGAGAAGCAGCAGGATGAGGG - Intergenic
1098414970 12:70223072-70223094 AAGAAGCAGAAGCAGGAGGAAGG - Intergenic
1098495878 12:71135279-71135301 AAGAAGAAGAAGAAGGAGGAGGG + Intronic
1098495882 12:71135285-71135307 AAGAAGAAGGAGGAGGGGGAGGG + Intronic
1098495894 12:71135328-71135350 GAGAAGGAGGAGGAGGAAGAAGG + Intronic
1098574564 12:72026621-72026643 GAGAAGAAAGAGCAGGAGGAAGG - Intronic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1098821398 12:75234924-75234946 CCAAAGAAGGAGCAGCTTGAGGG + Intergenic
1099064911 12:77963917-77963939 CAGAAGGAGGAGAAGAAGGAAGG - Intronic
1099163838 12:79276934-79276956 GAGAAGAAGAAGAAGGAAGAAGG + Intronic
1099950044 12:89291825-89291847 CTGAAGAAGGAGAAAGAAGAGGG + Intergenic
1100260166 12:92925761-92925783 AAAAAGGAGGAGCAGGAGGAGGG + Intronic
1100535491 12:95505009-95505031 CAGATGAGGGAGGAGGATGGTGG - Intronic
1100647229 12:96544460-96544482 GAGAAAAAGGAGCAGGAGAAAGG - Intronic
1100779395 12:98008003-98008025 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1101746714 12:107547204-107547226 GAGAAGAAGGAGAAGGGGGAGGG + Intronic
1101852709 12:108417063-108417085 CAAAAGCAGGAGCAGGAGGCAGG + Intergenic
1102166750 12:110813006-110813028 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1102167892 12:110820835-110820857 ACGAAGAAGGAGGAGGAGGAGGG - Intergenic
1102320187 12:111926575-111926597 CAGAAGAAGGATCAAGAGGGAGG - Intergenic
1102624042 12:114220324-114220346 AACAAGAGGGAGCAGGAAGATGG - Intergenic
1102627996 12:114251630-114251652 CAGAAAAGTGAGCAGGATTAAGG + Intergenic
1102679816 12:114683867-114683889 CAGAGGAAGGAGGAGGAGGGCGG - Intronic
1102749148 12:115277179-115277201 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1102823068 12:115924443-115924465 GAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1102899318 12:116624064-116624086 AAGAAGAAGGTGAAGGAAGAAGG + Intergenic
1102899329 12:116624143-116624165 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1102928343 12:116843616-116843638 CAGAGGAAGGGGGAGGAAGAAGG - Intronic
1102974966 12:117200150-117200172 GAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1103235367 12:119368150-119368172 GAAAAGAAGGAGGAGGAGGAAGG + Intronic
1103317621 12:120069293-120069315 CAGGTGAACGTGCAGGATGAAGG + Intronic
1103317866 12:120071540-120071562 CAGAAGCATGATCAGGTTGAGGG + Intronic
1103371578 12:120423335-120423357 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1104069915 12:125335641-125335663 TAGAAGACAGAGCAGGGTGATGG + Intronic
1104310044 12:127646409-127646431 GAGAAGAAGAAGCAGGTGGAGGG + Intergenic
1104416665 12:128601461-128601483 CAGAGAAAGGAGGAGGAAGATGG + Intronic
1104581986 12:130017445-130017467 CAGATGAAGGAACCGGATGGTGG + Intergenic
1104613339 12:130248108-130248130 AAAAAGAAGGAGGAGGAGGAGGG + Intergenic
1104887689 12:132120334-132120356 CAGATGAAGGACCTGAATGAGGG - Intronic
1105325051 13:19363259-19363281 GAGAAGAAGGAGGGAGATGAGGG + Intergenic
1105609266 13:21954028-21954050 GAAAAGAAGGAGCAGGAAGGAGG - Intergenic
1105943266 13:25170073-25170095 CCGGAGAAGGAGCAGCAGGAAGG - Exonic
1106040384 13:26084607-26084629 CAGAAGAAGTTGCTGTATGAGGG + Intergenic
1106389962 13:29325504-29325526 GAGGAGAAGGAGGAGGAGGAGGG + Intronic
1106666863 13:31860433-31860455 CAGAAGAAAGAAAAGGAGGATGG - Intergenic
1106771517 13:32965290-32965312 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1107106620 13:36650040-36650062 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1107242107 13:38248690-38248712 CAGAAGAAGGAGGAGGAGAAAGG - Intergenic
1107454150 13:40538520-40538542 CAGTAGGAGAAGCTGGATGAAGG - Intergenic
1107618018 13:42192558-42192580 AAGAAGGAGGAGGAGGAGGAAGG - Intronic
1107879706 13:44822305-44822327 GAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1108068942 13:46607624-46607646 AAGAAGAAGGAAGAGGAGGAAGG - Intronic
1108105871 13:47008459-47008481 CAGAGGGAGGAGGAGGAGGAGGG + Intergenic
1108291034 13:48961370-48961392 GAGAAGAAGAAGGAGGAAGAGGG + Intergenic
1108639708 13:52371709-52371731 CAGCAGCAGCAGCAGGATGGGGG + Intergenic
1109175199 13:59146468-59146490 CAGAGAAAAGAGCAAGATGATGG + Intergenic
1109351473 13:61188006-61188028 CAGAAGAAGGAGGCAGAGGAAGG + Intergenic
1110398527 13:75062625-75062647 GAGAAGAAGGAGGAGAAGGAAGG + Intergenic
1110541116 13:76708039-76708061 CACAAGGAGGAGCTGGCTGAAGG + Intergenic
1110669040 13:78154622-78154644 CAGAAGCAGGAGCAAGAAGGCGG + Intergenic
1110724107 13:78799763-78799785 CAGAAGAAGGAGTGAGATGGCGG + Intergenic
1110862608 13:80359520-80359542 CAGACAAAGGGGCGGGATGATGG + Intergenic
1111362787 13:87197081-87197103 AAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1111391467 13:87601017-87601039 GAGAAGGAGGAGAAAGATGATGG + Intergenic
1111423100 13:88043360-88043382 GAGGAGAAGGAGCCGGATCATGG + Intergenic
1111633249 13:90870481-90870503 CAGAAGAAGGGGAAGGACAAGGG - Intergenic
1111897080 13:94155226-94155248 AAGAAGGAGGAGCAGGTTGTGGG - Intronic
1112191901 13:97186282-97186304 CAGGAGAAGGGGCAGGATTTGGG - Intergenic
1113059250 13:106303501-106303523 CAGAAGACTGAGCAGGTGGAGGG + Intergenic
1113672434 13:112184150-112184172 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1113812044 13:113148921-113148943 CGGAACACGGAGCAGGAGGAGGG + Exonic
1114316465 14:21514355-21514377 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1114429019 14:22644674-22644696 CAGAGGAAGAAGCAGGTTGATGG - Intergenic
1115095383 14:29629943-29629965 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115529365 14:34312808-34312830 AAGAAGAAGGAGAAGGAGAAGGG - Intronic
1115653131 14:35417698-35417720 CAGGAGGAAGAGCAGGTTGAGGG + Intergenic
1115659133 14:35474601-35474623 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1115931166 14:38496799-38496821 GAAGAGAAGGAGGAGGATGATGG - Intergenic
1116475081 14:45330866-45330888 AAGGAGAAGGAGGAGGAAGAAGG - Intergenic
1116701399 14:48247870-48247892 CAGGATAAGGATGAGGATGAAGG - Intergenic
1117372761 14:55093967-55093989 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1117386732 14:55221925-55221947 CAAAAGGAGGAGGAGGAAGATGG - Intergenic
1118110423 14:62712054-62712076 GAGAAGCAGGTGCAGGAGGAAGG + Intronic
1118626080 14:67660578-67660600 CAGAAAGAGGAGCAGGAGAAGGG - Intronic
1118641112 14:67793478-67793500 CAGAAGAAGCAGAAGCAAGAGGG - Intronic
1119150746 14:72357317-72357339 CAGAGGAAGGAACAGTTTGAAGG + Intronic
1119196098 14:72717762-72717784 CAGCAGAAGGAGCAGGACCTAGG + Intronic
1119278250 14:73380365-73380387 CAGAAGGAGGAGCAGGTTGAAGG + Intronic
1119316864 14:73703820-73703842 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1119319508 14:73721361-73721383 GAGAAGGAGGAGCAGGAAGAGGG - Exonic
1119770198 14:77215823-77215845 CAGTAGAAGAAGTAGGAGGAGGG - Intronic
1119922209 14:78456966-78456988 GAGAAGGAGGAGAAGGAAGAAGG - Intronic
1119950091 14:78736211-78736233 CGAAAGGTGGAGCAGGATGATGG - Intronic
1120281459 14:82443675-82443697 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1120625936 14:86826556-86826578 CAGAAGAAAGAGAAAGAGGAGGG + Intergenic
1121085011 14:91139251-91139273 GAGAACAAGGAGGAGGAGGAAGG - Intronic
1121120248 14:91371859-91371881 CACAAGTCGGAGCAGGATGGTGG + Intronic
1121173577 14:91873934-91873956 CAGAAGAAGGAGCAAGGTCATGG - Intronic
1121735707 14:96216675-96216697 AAGAAGGAGGAGGAGGAGGAAGG + Intronic
1121735718 14:96216714-96216736 AAGAGGAAGGAGGAGGAGGAAGG + Intronic
1121832763 14:97066124-97066146 AAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1121905201 14:97734800-97734822 TGGAAGAAGGAGGAGGAAGAAGG - Intergenic
1122033098 14:98927875-98927897 AAGGAGGAGGAGCAGGCTGAGGG - Intergenic
1122979496 14:105185260-105185282 CAGAAGAGGGAGCAGGAGGGTGG - Intergenic
1123022665 14:105408958-105408980 GAGGAGGAGGAGCAGGAGGAGGG - Intronic
1123448482 15:20345847-20345869 CAGGAGCAGGAGCAGGATCAGGG + Intergenic
1123800313 15:23811953-23811975 ATGAAGAAGGAGGAGGATGGTGG + Intergenic
1124179225 15:27457049-27457071 AAGTAGAAGGAGCTGGAGGAGGG + Intronic
1124241142 15:28028534-28028556 CAGAAGCATGAGCAGGAAGAGGG + Intronic
1124459631 15:29877610-29877632 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1125024817 15:35019525-35019547 GAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1125214855 15:37259935-37259957 CAGAAGAAAGAGCAGGCAGGAGG - Intergenic
1125766742 15:42141419-42141441 CAGAAGGAGGGTTAGGATGATGG + Exonic
1126039853 15:44579221-44579243 CATAAGAAAAAGCAGGAAGAGGG + Intronic
1126052308 15:44697158-44697180 GAGGAGAAGGAGGAGGAGGAAGG - Intronic
1126213885 15:46132260-46132282 CAGAAGTAGTAGCAGCATGGTGG + Intergenic
1126550808 15:49927315-49927337 CAGAAGAGGGAGGAGGAGAAAGG + Intronic
1126764161 15:51996690-51996712 AAGAAGAAGGAGGAGGAGGACGG - Intronic
1127054814 15:55120862-55120884 GAGAAGCAGGAGCAGGTTGTTGG - Intergenic
1127137745 15:55942515-55942537 GAGAAGGAGGAGGAGAATGAAGG - Intronic
1127692284 15:61409125-61409147 AAAAAGAAGTAGGAGGATGAGGG + Intergenic
1127833298 15:62769659-62769681 CAGGAGAGGGTGGAGGATGATGG - Intronic
1128095609 15:64952253-64952275 AAAAAGAAGGAGAAGGAAGAAGG - Intronic
1128095618 15:64952324-64952346 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128095631 15:64952461-64952483 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128095670 15:64952813-64952835 AGGAAGAAGGAGGAGGAAGAAGG - Intronic
1128095821 15:64954599-64954621 AAGAGGAAGGAGGAGGAAGAAGG - Intronic
1128160521 15:65420746-65420768 CTGTAGAAGGAGAATGATGATGG - Intronic
1129323917 15:74789638-74789660 CTGAAGAAGGTTCAGGATGGGGG - Intronic
1129391963 15:75225174-75225196 CAGAGGGAGCAGCAGCATGAGGG + Intergenic
1129472413 15:75762988-75763010 CAGAGGGAGCAGCAGCATGAGGG - Intergenic
1130266057 15:82404660-82404682 GAGAAGAAGTTGGAGGATGAAGG + Intergenic
1130505958 15:84542214-84542236 GAGAAGAAGTTGGAGGATGAAGG - Intergenic
1130660026 15:85824056-85824078 CAGATGAAGAAACAGGCTGATGG + Intergenic
1130881778 15:88061641-88061663 CAGATGAAGAAGCAGGAAGTGGG - Intronic
1131139823 15:89968109-89968131 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1131171476 15:90181903-90181925 GAGGAGAAGGAGCAGGAAAAGGG + Intronic
1131224403 15:90611985-90612007 GATAAGAAGGAGAAGGAAGATGG - Intronic
1131372549 15:91894798-91894820 CAGAAGCATGTGCAGGGTGAGGG - Intronic
1131430147 15:92380754-92380776 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1131871962 15:96772789-96772811 CTCAGAAAGGAGCAGGATGAGGG - Intergenic
1131901123 15:97088728-97088750 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1132053776 15:98633961-98633983 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1132452306 15:101975144-101975166 CAGCAGAAGGAGCAGGAGCAAGG + Intergenic
1132454592 16:15480-15502 CAGCAGAAGGAGCAGGAGCAAGG - Exonic
1132892371 16:2210594-2210616 CAGCAGCAGGAGCAGGCTCACGG + Exonic
1133580716 16:7141991-7142013 AAGAAGAAGGAGGAAGAAGAAGG - Intronic
1133673856 16:8050913-8050935 GAGGAGAAGGAGGAGGAGGAAGG - Intergenic
1134231601 16:12434432-12434454 CAGAAGGGGGAGCAGGGCGAGGG + Intronic
1134748052 16:16602967-16602989 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1135232064 16:20717865-20717887 GAGAAGAAGGAGAAGGAGAAGGG + Intronic
1135394654 16:22122102-22122124 AAGAAGAAGGAAAAGAATGATGG + Intronic
1135682654 16:24471641-24471663 CAGAAGAAGGAGTGGGAAGTAGG - Intergenic
1135934963 16:26771757-26771779 CAGAGCAAGGAGCAGGATGGAGG - Intergenic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1137556975 16:49477040-49477062 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1137556991 16:49477122-49477144 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
1137557141 16:49477641-49477663 AAGAAGAAGGAGAAGAAGGAGGG + Intergenic
1137581766 16:49637950-49637972 CAGAAGAAGATGCGGGATGACGG - Exonic
1137589023 16:49682208-49682230 GAGAAAAAGGGGCAGGAGGAAGG - Intronic
1137611525 16:49821482-49821504 CAGAAGAACGCACAGGATGAGGG + Intronic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137617496 16:49856224-49856246 GAGAAGGAGGAGGAGGGTGAGGG - Intronic
1137805557 16:51301882-51301904 CTGAAGAAGCAGCAGAAAGAAGG - Intergenic
1137942990 16:52707263-52707285 CTGAAGGAGGAGCAGGAGGTAGG - Intergenic
1138181624 16:54944503-54944525 AAGAAGAAAGAACAGGGTGAGGG - Intergenic
1138184514 16:54966163-54966185 TGAAAGAAGGAGCAGAATGAAGG + Intergenic
1138364498 16:56463085-56463107 GAGAAGAGGGAGCAGGGAGAAGG - Intronic
1138499490 16:57430507-57430529 CAGAAGTGGGAGGAGGATGAGGG + Intronic
1138541615 16:57691106-57691128 GAGAAGGAGGAGGAGGAAGAAGG + Intergenic
1138554892 16:57765310-57765332 CAGAGGAAGGAGCAGGACCCTGG + Intronic
1138938410 16:61759432-61759454 CAGTAGTAGGAGGAGGAAGAGGG + Intronic
1139351071 16:66336153-66336175 GAGAAGAAGGAGTAGGAAGCAGG - Intergenic
1139447461 16:67006666-67006688 CAGCAGAAGCAGCAGGAGTAGGG + Intronic
1139825310 16:69752631-69752653 CAGAGGAAGGAGCAGAAAGTTGG + Intronic
1139913303 16:70412064-70412086 CTGAAGAAAGAGCAGGTTGTTGG - Intronic
1140530395 16:75660760-75660782 CAGAAGATGGGGGAGGATGAAGG + Intronic
1140536500 16:75714667-75714689 CAGAAGATGGGGGAGGATGAAGG + Intronic
1140764735 16:78146398-78146420 CAGAAGCAGCAGCGGGGTGAGGG + Intronic
1140965727 16:79964259-79964281 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1141007121 16:80363056-80363078 GAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1141711412 16:85701386-85701408 AAGAAGAAGGAAAAAGATGAAGG - Intronic
1141775723 16:86121615-86121637 AAGAAGAAGGAGGAGGAGGGAGG - Intergenic
1142221406 16:88856764-88856786 CATGAGCAGGAGCAGGATGTTGG + Exonic
1142431349 16:90029631-90029653 AACAAGAAGGAGCAGCAGGAGGG - Intronic
1142604416 17:1073695-1073717 GAGAAGGAGGAAGAGGATGATGG + Intronic
1143119131 17:4596470-4596492 CAGAAGGAGGAGTGGGAGGAAGG + Intronic
1143125559 17:4639339-4639361 GAGAAGAGGGCGCAGGATGGGGG - Intronic
1143193781 17:5059804-5059826 GAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1143361128 17:6372189-6372211 GAGAAGAAGCAGCAGGAGGGAGG + Intergenic
1143402917 17:6657473-6657495 GAGAAGAGGGCGCAGGATGGGGG + Intergenic
1144542172 17:16155004-16155026 CAGAAGAAAGAAAAGGGTGATGG - Intronic
1144746787 17:17621370-17621392 AAGAAGAAGGAGGAAGAAGAAGG + Intergenic
1145103878 17:20098737-20098759 CAGCAGGAGGAGGAGGATGGAGG - Intronic
1145900698 17:28488860-28488882 CAGAAGAAGGAGCAGGACCTGGG - Intronic
1145984364 17:29035199-29035221 GAGAAGAAGGAGAAGAAAGAAGG - Intronic
1146178124 17:30679636-30679658 CAGAGGAGGGAGGAGGATGGAGG + Intergenic
1146208739 17:30925541-30925563 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1146629953 17:34462731-34462753 CAGAAGAGCAAACAGGATGATGG + Intergenic
1146635384 17:34500340-34500362 GAGAAAACAGAGCAGGATGAGGG - Intergenic
1146852731 17:36237363-36237385 GAGAAGGAGGAGGATGATGATGG - Intronic
1146868641 17:36361255-36361277 GAGAAGGAGGAGGATGATGATGG - Intronic
1147071515 17:37961881-37961903 GAGAAGGAGGAGGATGATGATGG - Intergenic
1147083042 17:38041405-38041427 GAGAAGGAGGAGGATGATGATGG - Intronic
1147098985 17:38165378-38165400 GAGAAGGAGGAGGATGATGATGG - Intergenic
1147326419 17:39671869-39671891 GAGAGGTTGGAGCAGGATGAGGG - Exonic
1147371157 17:39994054-39994076 CAGAAAAAGGAGGAGGGTCAAGG - Intronic
1147416619 17:40295904-40295926 CAGCAGGAGGGGCAGGAGGATGG - Intronic
1147498792 17:40942407-40942429 AAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1147773906 17:42887007-42887029 CAGCAGAGGCAGCAGGAAGAGGG + Intergenic
1147970525 17:44217300-44217322 CAGAAGCAGAAGCAGGATACAGG + Intronic
1148191427 17:45681331-45681353 GAGAGGGTGGAGCAGGATGAGGG - Intergenic
1148459880 17:47833370-47833392 AGGAAGAAGGAGGAGGAAGAAGG - Intronic
1148647011 17:49225024-49225046 CAGCAGGAGGAGGAGGAGGAGGG + Exonic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149107109 17:52982657-52982679 AAGAAGAAGGAAGAGGAGGAGGG - Intergenic
1149797906 17:59538419-59538441 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1149838647 17:59937941-59937963 GAGAAGGAGGAGGATGATGATGG + Intronic
1150089440 17:62310017-62310039 GAGGAGGAGGAGCAGGAGGAAGG - Intergenic
1150423612 17:65058952-65058974 AAGAAGAAGAAGAAGGAGGAAGG + Intergenic
1150739150 17:67765656-67765678 CAGATGATGGGGCAGGAAGACGG - Intergenic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1150952610 17:69820791-69820813 CAGATGAATGAGTAGTATGAAGG - Intergenic
1151158791 17:72147189-72147211 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1151990721 17:77572371-77572393 CAGATGGAGGGGCAGGAGGAGGG - Intergenic
1152000435 17:77641917-77641939 CAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1152003492 17:77662205-77662227 AGAAGGAAGGAGCAGGATGAAGG - Intergenic
1152336643 17:79702876-79702898 GAGAAGGAGGAGGAGGAAGAGGG - Intergenic
1152637298 17:81435365-81435387 CAGTAGCAGGGGCAGGATGTGGG + Intronic
1153185232 18:2478823-2478845 GAGAAGGAGGAGGAGGAAGATGG + Intergenic
1153185255 18:2478918-2478940 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1153810059 18:8744536-8744558 CACAAGAAGCAGCAGGAAGCAGG - Intronic
1154050395 18:10950715-10950737 CAGAAGAGGGAAGAGGAGGAAGG - Intronic
1154099975 18:11463890-11463912 CAGAAGAATGAGTATGAGGAAGG - Intergenic
1154285723 18:13054608-13054630 CAGATGAAGAAACAGGTTGAGGG - Intronic
1155026624 18:21946469-21946491 CAGAAAAAGAGGCATGATGATGG - Intergenic
1155237641 18:23836914-23836936 CAGAAGGATGTGCAGAATGAGGG + Intronic
1155356821 18:24961183-24961205 CAGAAGAAGGAGCAAGACACAGG + Intergenic
1155996542 18:32336538-32336560 CAGAAGAAAGTACAGCATGAGGG - Intronic
1156268310 18:35508264-35508286 CAGAAGGAGGTACAGGAGGAAGG - Intergenic
1156520647 18:37719934-37719956 CAACAAAAGGAGGAGGATGAAGG + Intergenic
1156535811 18:37863467-37863489 CAGAAGCATGGGCAGGATGTAGG + Intergenic
1156729239 18:40170372-40170394 CAGAAGAAGGAGAAGAAAAAAGG + Intergenic
1156924849 18:42563856-42563878 CAGGAGACAGAGCAGGAAGAAGG + Intergenic
1157237605 18:45979188-45979210 AAGAAGAAGGAGAAGGGAGAGGG - Intergenic
1157556306 18:48615316-48615338 GAGAAGAAGGAGCAGAGAGAGGG - Intronic
1158045890 18:53154785-53154807 CAGGAGGAGAAGCAGGCTGAGGG + Intronic
1158119375 18:54031255-54031277 CAGAAGAATGAACAAGATGTGGG + Intergenic
1158209537 18:55031879-55031901 CAGAAGGAGGAGGAGAAGGAAGG - Intergenic
1158423136 18:57313545-57313567 CAGAAGGAAGAGGAGGAGGAAGG + Intergenic
1158722195 18:59935434-59935456 CAGCATTAGGAGCAGGATGAAGG - Intergenic
1158737391 18:60098789-60098811 AAGAGGAAGGAGGAGGAAGAAGG - Intergenic
1158855526 18:61540095-61540117 CAAAAGCAGGAGCAGAATGGAGG - Intronic
1159198706 18:65153785-65153807 AAGAAGGAGGAGGAGGAGGATGG - Intergenic
1159343214 18:67163864-67163886 AAGAAGAAGGAACGAGATGATGG - Intergenic
1159488873 18:69103205-69103227 CAGAAGTAGCAGCAGTGTGAGGG + Intergenic
1159546878 18:69850861-69850883 GAGAAGGAGGAGGAGGAAGAAGG - Intronic
1159833125 18:73303061-73303083 CAGGATGAGGAGGAGGATGAGGG - Intergenic
1160073130 18:75645664-75645686 CAGAAGAATGAGGAGGATTCCGG + Intergenic
1160278804 18:77466887-77466909 CAGAAGAAGGAAGAGGAGGAGGG - Intergenic
1160437391 18:78862200-78862222 CAGAAGAGGCTGCAGGGTGAGGG + Intergenic
1160480057 18:79231834-79231856 CATAAGAAGGAGCAAAATAATGG + Intronic
1160845622 19:1164803-1164825 GAGGAGGAGGAGCAGGAGGAGGG + Intronic
1161635117 19:5383652-5383674 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1161837037 19:6654802-6654824 CAGGAGGAGGAGGAGGAGGATGG - Intergenic
1162003988 19:7765436-7765458 CAGGAGAGGGAGGAGGAGGAGGG + Intronic
1162446159 19:10724121-10724143 AGGATCAAGGAGCAGGATGAGGG + Intronic
1162477424 19:10908929-10908951 CAGGAGAGGGAGCAGGAAGCCGG - Intronic
1162595946 19:11629370-11629392 CAGAAGCAGGAGGAGCAAGATGG + Intergenic
1162984119 19:14258384-14258406 CAGGAGGAGGAGCAGGGGGAAGG - Intergenic
1163090465 19:15016088-15016110 GAGAAGAAGGGACAGGCTGAGGG + Intronic
1163211697 19:15845594-15845616 AAGAAGAGGGAGAAGGAAGAAGG + Intergenic
1163387259 19:17007459-17007481 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1163760804 19:19135430-19135452 AAGAAGAGGGAGGAGGGTGATGG - Intronic
1164183168 19:22837585-22837607 CAGAACAATGAGCAGTGTGACGG - Intergenic
1164292696 19:23881842-23881864 GAGGAGAAGGAGGAGGAAGAGGG + Intergenic
1164696574 19:30249337-30249359 GAGAAGGAGGAGAAGGAGGAGGG + Intronic
1164740403 19:30571640-30571662 GAGAAGCAGGAGCAGGAAGTGGG - Intronic
1165334092 19:35156923-35156945 CAGAGGCAGGACCAGGATGGGGG + Intronic
1165690887 19:37862382-37862404 AAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1165781642 19:38438077-38438099 CAGGAGATGGAGCAGGATGGTGG - Intronic
1165825701 19:38704661-38704683 CAGGAGAAGGAGCTGGCTGCGGG + Intronic
1165925645 19:39324531-39324553 GAGGAGAAGGAGGAGGAAGAAGG + Intergenic
1166436182 19:42767751-42767773 CAGAAGAGGGAGCAGCAGGGTGG + Intronic
1166455925 19:42939240-42939262 CAGAAGAGGGAGCAGCAGGGTGG + Intronic
1166471858 19:43084719-43084741 CAGAAGAGGGAGCAGCAGGGTGG + Intronic
1166482991 19:43188535-43188557 CAGAAGAGGGAGCAGCAGGATGG + Intronic
1166485473 19:43207667-43207689 CAGAAGAGGGAGCAGCAGGGTGG + Intergenic
1166492625 19:43271573-43271595 CAGAAGAGGGAGCAGCAGGGTGG + Intergenic
1166674950 19:44734663-44734685 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1166875181 19:45892595-45892617 CTGAGGAAGGAGCAGGGTGGGGG - Intronic
1166966659 19:46533278-46533300 CAGAAGAACCATCAGGATTAAGG + Intronic
1167046877 19:47054903-47054925 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167153919 19:47726554-47726576 GAGAAGAAGGAGGAGGAGGAGGG - Intronic
1167214211 19:48153711-48153733 AAGAGGAAGGAGGAGGAGGAAGG - Intronic
1167214224 19:48153793-48153815 AAGAGGAAGGAGGAGGAGGAAGG - Intronic
1167428337 19:49441121-49441143 CAGAAAAAGGAACAGGATAATGG + Intronic
1167470253 19:49671822-49671844 CACCAGAAGGAGCAGGACGGAGG - Intronic
1167686496 19:50960009-50960031 GAGGAGAAGGAGGAGGAGGAGGG + Intronic
1167702110 19:51054962-51054984 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1167714241 19:51130924-51130946 CAGAAGAAGGCCCAGGAGGAGGG - Intronic
1167722309 19:51187024-51187046 CATCAGAAGGAGGAGGATTACGG - Intergenic
1167775639 19:51552998-51553020 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1168000566 19:53442623-53442645 CAGAGGAAGGAGCAGCAGCAGGG - Intronic
1168005061 19:53480107-53480129 CAGAGGAAGGAGCAGCAGCAGGG - Intronic
1168450584 19:56463258-56463280 CAGAAGAGGGAGCAGGAGTGAGG + Intronic
925101487 2:1250166-1250188 CAGAGGAAGGGGCAGGAGGCTGG - Intronic
925191689 2:1890008-1890030 CAAAAGAATTAGAAGGATGAAGG + Intronic
925198031 2:1943167-1943189 GATGAGAAGGAGGAGGATGAGGG - Exonic
925201379 2:1969812-1969834 CAGCAGGAGGTGCAGGAGGATGG + Intronic
925496218 2:4452473-4452495 GAGAAGGAGGAGGAGGAGGAGGG - Intergenic
925508471 2:4597081-4597103 AAGAAAAAGGAGGAGGAGGAAGG + Intergenic
925703712 2:6664221-6664243 GAGATGAAGGAGAAGGAGGAAGG + Intergenic
925862241 2:8190475-8190497 AAGAAGAAGGAAAAGAATGAAGG - Intergenic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
926558302 2:14386558-14386580 CAGAAGGAGGAGAAGCAGGAGGG + Intergenic
926756356 2:16239570-16239592 CAGCAGCAGCAGCAGAATGAAGG + Intergenic
927005575 2:18844494-18844516 CAGAATAATAAGCAGGATAAGGG - Intergenic
927097316 2:19757447-19757469 AAGAAGCAGGAGAAGGAAGATGG + Intergenic
927369932 2:22342941-22342963 CAAAACAAGGAGCAGAATGAAGG + Intergenic
927558718 2:24053860-24053882 CAGATGAAGGAGTAGGATATTGG - Intronic
927657589 2:24963796-24963818 GATAAGTAGGAGCAAGATGAAGG + Intronic
927986151 2:27412015-27412037 CAGAAAAAGGTGCAGTTTGAGGG + Intergenic
928105803 2:28469991-28470013 GAGAAGAAAGAGGAGGAGGAGGG + Intronic
928591214 2:32817264-32817286 AAGAAGAAGAAGAAGGATAAAGG + Intronic
929015015 2:37485260-37485282 AAGAAGAAGGAGGAAGAAGAAGG - Intergenic
929015018 2:37485283-37485305 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
929766434 2:44847819-44847841 AAGAAGAAAGAGGAGGAAGAAGG - Intergenic
930196923 2:48519446-48519468 CAGAAAGAGGACCAGAATGAAGG - Intergenic
930250868 2:49032723-49032745 TAGAAGGAGGAGCAGGATCTGGG + Intronic
930356475 2:50327577-50327599 AAGAAAAAGAAGCATGATGAAGG - Intronic
930364680 2:50424289-50424311 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
930581855 2:53221074-53221096 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
930768413 2:55108397-55108419 CAGGAGAGGGAGAAGGGTGAAGG + Intronic
931464558 2:62475124-62475146 CAGGAGAAGCAGCAGGAAGGGGG + Intergenic
931683254 2:64770048-64770070 CAGAAGAGGTGGCAGGATGGAGG - Intergenic
931799657 2:65746492-65746514 GAGCAGAAGGAGCAGGAGGAAGG + Intergenic
931992776 2:67807774-67807796 GAGAAGAAGGAGAAGGAAGAAGG - Intergenic
933154107 2:78952170-78952192 GAGGAGAGGGAGCAGAATGAAGG - Intergenic
933197385 2:79407605-79407627 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
934037450 2:88100022-88100044 TAGGAGAAGGAGCAGGAGGTGGG - Intronic
934067179 2:88350890-88350912 CAGAACAAGTGGCAGGAAGAAGG - Intergenic
934694720 2:96391315-96391337 AATAAGCAGGAGCAGGATGTGGG + Intergenic
935079486 2:99778199-99778221 CAGAGGAAGGAGGAGGAGAAGGG - Intronic
935335709 2:102014028-102014050 CAAAAGAAAGAGAAGGGTGAGGG - Intronic
936272489 2:111059927-111059949 GAGAAGAAGGAGGAGGAAGAGGG + Intronic
936379439 2:111970828-111970850 GAGAAGGAGGAGAAGGAGGAGGG - Intronic
936523962 2:113230280-113230302 AACGAGAAGGAACAGGATGAAGG - Intronic
936568520 2:113597617-113597639 AAGCAGAAGGAGCAGGAGCAAGG + Intergenic
936923313 2:117711223-117711245 CAGAAGAAAGAGGAAGATGAGGG + Intergenic
937004678 2:118500810-118500832 AATAGGAAGGAGCAGGAGGAGGG + Intergenic
937013284 2:118580997-118581019 CAGAACAGGGGGCAGGATGGAGG - Intergenic
937268638 2:120633139-120633161 CAGAAAAAGGAGGGGGAGGAGGG + Intergenic
937552318 2:123108922-123108944 GAGAGGGAGGAGCAGGATGGTGG - Intergenic
937624848 2:124032869-124032891 TAGAAGATGCATCAGGATGATGG - Intronic
937887962 2:126913235-126913257 ATGAAAAAGGAGAAGGATGATGG - Intergenic
938671963 2:133595359-133595381 AAGAAGAAGGGGGAGGATGAGGG - Intergenic
938760099 2:134417237-134417259 CATAAGAAGAAGCTAGATGAAGG - Intronic
938803713 2:134786969-134786991 CAGAAGCAGGAGAAAGTTGAAGG + Intergenic
938804565 2:134794173-134794195 TAGATGAAGGAGTTGGATGAAGG - Intergenic
938954029 2:136282188-136282210 GGGAAGAAGGAGGAAGATGAAGG + Intergenic
939160098 2:138577271-138577293 CAGGAGGAGGAGGAGGAGGAGGG + Intergenic
940087538 2:149877577-149877599 CAGAAGAAGAAACAGGGAGAAGG + Intergenic
940164050 2:150748370-150748392 AAGAAGGAGGAGAAGGACGAGGG - Intergenic
940216128 2:151305390-151305412 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
940867304 2:158830035-158830057 CAGAAGGAGGGAGAGGATGATGG + Intronic
940940478 2:159554698-159554720 CAGTTGAAGAAGCAGGATCATGG + Intronic
942157757 2:173148892-173148914 CAGAAGAAGAGGCAGAGTGAAGG - Intronic
942207728 2:173638192-173638214 AAGAAGAAGGAGGAGGAGGCAGG + Intergenic
942321629 2:174741382-174741404 CAGGAGATGGAGCAGGCCGAGGG - Intergenic
942496027 2:176541046-176541068 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
942799093 2:179856334-179856356 CAGAAGGAGGAGCAGGTTGAGGG - Intronic
942800729 2:179872586-179872608 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
942813425 2:180023418-180023440 CAGAAAAAGGAGCATGATGCTGG + Intergenic
942985412 2:182134778-182134800 GAGGAGGAGCAGCAGGATGAGGG + Intergenic
943175764 2:184472049-184472071 AGTAAGAAGGAGGAGGATGAAGG + Intergenic
943183936 2:184580798-184580820 CAGAATAAAGAACAGGAGGAAGG - Intergenic
943570626 2:189569519-189569541 GAGAAAAAGGAGGAGGATAAAGG - Intronic
943834366 2:192500424-192500446 GAGGAGAAGCAGCTGGATGATGG + Intergenic
944100378 2:196019943-196019965 AAGAAGAAGGGGGAGGAGGAGGG - Intronic
944165678 2:196717587-196717609 CAGCAAAAGAAGCAGGATAAAGG + Intronic
944205448 2:197153283-197153305 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
944224226 2:197334055-197334077 CAGAAAAAGGAGCAGGTTTGGGG + Intergenic
944395750 2:199264071-199264093 AGGAAGAAGGAACAGGAGGAAGG + Intergenic
945257335 2:207813493-207813515 GAGGAGAAGGAGGAGGAGGACGG + Intergenic
945431462 2:209770975-209770997 AGGAAGAAGGAGAAGGAGGAGGG + Intergenic
946431980 2:219631014-219631036 CAGCAGTAGCAGCAGGATGGGGG + Intronic
946740106 2:222792868-222792890 GTGAAGAAGGAGGAGGAGGAGGG - Intergenic
947389989 2:229628966-229628988 AAGAGGAAGGAGCAGGGTGAGGG - Intronic
947412756 2:229858925-229858947 CAGAAGAAGTAGCAGGGAAAAGG - Exonic
947542305 2:230987457-230987479 CAGAATCAGGAGCAGGATCAGGG + Intergenic
947629716 2:231644269-231644291 GAGAACATGAAGCAGGATGAGGG - Intergenic
947970600 2:234319921-234319943 GAGAAGAAGGAGGAGGAGGGAGG - Intergenic
948422298 2:237867313-237867335 AAGAAGGAGGAGCAAGAGGAGGG + Intronic
948539007 2:238672382-238672404 GAGAAGAAGGAGAAGGAGAAGGG - Intergenic
948881644 2:240860798-240860820 CAGAACAAGGACAAGGATGAGGG + Intergenic
1168801118 20:643707-643729 CAGTTGAAAGAGCAGGGTGATGG + Intergenic
1168826896 20:820007-820029 AAGAGGAAGGAGAAGGCTGAGGG - Intergenic
1168843068 20:922103-922125 CAGAAGAAGGTATAGGATGGGGG + Intergenic
1169954354 20:11084682-11084704 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1170264805 20:14453610-14453632 AAGATGAAGGGGCAGAATGAAGG - Intronic
1170695809 20:18657529-18657551 CAACAAAAGGAGCAGAATGAGGG + Intronic
1171209963 20:23309430-23309452 GAGATGGAGGAGCAGGAAGAGGG - Intergenic
1171506738 20:25642450-25642472 CAGCAGAAGGTGCAGGAGAAAGG + Intergenic
1171941129 20:31330955-31330977 AAGGAGAAGGAGAAGGAAGAAGG + Intergenic
1172043035 20:32059460-32059482 AAGAAGGAGGAGGAGGAGGAAGG - Intronic
1172613159 20:36266527-36266549 GAGAAGAATGAGCGGGAGGATGG + Intronic
1172861362 20:38055592-38055614 CAGAAGAAAGAGCACGCTGCAGG - Intronic
1172937399 20:38630040-38630062 AAAAAGAAGGAGGAGGAGGAGGG - Intronic
1173056688 20:39621478-39621500 AAGAAGAAGGAGGAGGAAGAGGG - Intergenic
1173144899 20:40515991-40516013 CTGAAGAAGGAGCTGGGCGAGGG - Intergenic
1173156505 20:40616916-40616938 CAGCTGAAGGAGCAGAAGGAAGG - Intergenic
1173496948 20:43526352-43526374 GGCAAGAAGCAGCAGGATGATGG + Intronic
1173525424 20:43729039-43729061 TAGAAGAAGGAAGAGGATGTGGG + Intergenic
1173556984 20:43973288-43973310 CAGGAGAAGCAGCCGGAGGAGGG - Intronic
1173727071 20:45305538-45305560 CTGAAGAAGGAGCAGCAACACGG + Exonic
1173775124 20:45698979-45699001 AAGAAGAAGGAGGAGAAGGAGGG + Intronic
1173791620 20:45831644-45831666 AAGAAGCAGGAGGAGGAAGAAGG + Intronic
1173997927 20:47353729-47353751 CAGAAGGAGGAACAGAATGTTGG - Intronic
1174246618 20:49187193-49187215 GACAAGAAGAAGCTGGATGATGG + Intronic
1174960501 20:55151686-55151708 CAGCAGTAGGAGGAGGAAGAAGG - Intergenic
1175073396 20:56353622-56353644 GAGAAGCAGGAGCAGCAGGAGGG - Intergenic
1175100631 20:56576269-56576291 TAGAAGAAGGAGGAGGAAGAAGG - Intergenic
1175298908 20:57928882-57928904 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
1175353449 20:58343208-58343230 TTGAACAAGGAGCAGGAAGATGG - Intronic
1175452092 20:59077925-59077947 GGGAAGAAGGAGGAGGAGGATGG + Intergenic
1175512852 20:59545723-59545745 CACAAAAAGGAGCTGGATTAGGG + Intergenic
1175661420 20:60816262-60816284 AAGAAGAAGGAGGAGGAGCAAGG - Intergenic
1175754859 20:61523024-61523046 CAGAGGAAGGAGCAGGAGGGAGG + Intronic
1177093741 21:16804421-16804443 CAGAAGAAGGAGCAAAATTATGG + Intergenic
1177095134 21:16823266-16823288 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1177115953 21:17087640-17087662 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
1177507233 21:22034756-22034778 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1177555480 21:22682457-22682479 CAGAAGAAGAAGGAAAATGAGGG - Intergenic
1177838828 21:26214512-26214534 CAGAAGAAGGAGCAAGTCTAAGG - Intergenic
1178349881 21:31865018-31865040 AAGAAGAAGGAGGAGGAGAAGGG - Intergenic
1178457855 21:32772203-32772225 CAGATGAGGGAGGAGGAGGAGGG + Intergenic
1178692726 21:34763127-34763149 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1178721713 21:35016591-35016613 CAGAAGAAGGAGCAGGATGAGGG - Intronic
1178724122 21:35036074-35036096 CAGAAGAGGGAGCAGGGAGCAGG + Intronic
1178930838 21:36817537-36817559 CAGGCGGAGGAGCAGGGTGAGGG - Intronic
1179081804 21:38178535-38178557 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1179438651 21:41378804-41378826 CCCAAGAAGGAGCAGCATGCAGG + Intronic
1180228858 21:46414418-46414440 CAGGAGGAGGAGGAGGAGGAGGG - Intronic
1180301617 22:11040954-11040976 GAGGAGAAGGAGGAGGAGGAAGG + Intergenic
1180857452 22:19057432-19057454 CAGAAGAGGGTGCTGGATCACGG + Intronic
1180872540 22:19154653-19154675 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
1181508449 22:23377584-23377606 GAGAAGAAAGAGGAGGAGGAAGG + Intergenic
1181860334 22:25813133-25813155 AGGAAGAAGGAGGAGGAGGAGGG - Intronic
1181931335 22:26403936-26403958 AAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1182395884 22:30035685-30035707 CAGAAGCAGGAGGAAGAGGAAGG - Intergenic
1182460748 22:30481885-30481907 CAGCAGCAGGAGCAGGAGGGCGG + Intergenic
1182561908 22:31166606-31166628 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
1182755882 22:32678549-32678571 AGGAAGGAGGAGGAGGATGAAGG - Intronic
1182931479 22:34178311-34178333 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1182936677 22:34229399-34229421 CAGATGAGGGAGCTGGAAGAGGG - Intergenic
1183730895 22:39617811-39617833 CAAGGGAAGGAGCAGGAGGAGGG - Intronic
1184362416 22:44026327-44026349 CAGGAGGAGGAGCAGGACGCCGG + Intronic
1184946475 22:47807673-47807695 GAGAAGGAGGAGGAGGAAGAGGG + Intergenic
1184989886 22:48160220-48160242 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
949242711 3:1890933-1890955 AAGAAGATGGAGAAGGAGGAGGG - Intergenic
949250082 3:1973143-1973165 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
949250100 3:1973200-1973222 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
949828812 3:8191807-8191829 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
949940095 3:9148167-9148189 CAGGAGGAGGAGGAGGATAAAGG + Intronic
950183985 3:10933876-10933898 CAGAATAAAGAGCAGCAGGAGGG - Intronic
950192509 3:10987414-10987436 CAGGAGAAGAGGGAGGATGAGGG + Intergenic
950270763 3:11613037-11613059 TAGAAGGAGTAGCTGGATGAGGG + Intronic
950475765 3:13214025-13214047 CAGAGGAAGGAGCCGGGTGGCGG - Intergenic
951934006 3:28001702-28001724 GAGAAACAGGAGCAGGAAGAGGG + Intergenic
953230239 3:41058297-41058319 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
953365400 3:42340417-42340439 GAGAAGGAGGAGAAGGAGGAGGG + Intergenic
954111670 3:48437009-48437031 CAGTAGAAGGAAGAGGATGAGGG - Intronic
954152028 3:48662563-48662585 GAGGAGAAGGAGCAGGAGTATGG + Exonic
954553850 3:51503370-51503392 CGGGAGAAGGAGGAGAATGAAGG - Intergenic
954630390 3:52044836-52044858 AAGAGGAGAGAGCAGGATGAAGG - Intergenic
954945709 3:54422417-54422439 CAGACAAAGGACCAGTATGAAGG + Intronic
954960979 3:54564754-54564776 CACAAGAAGGAGCTGGATGAGGG - Intronic
955087826 3:55720104-55720126 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
955514294 3:59711510-59711532 GAGAAGGAGGAGAAGGAGGAGGG - Intergenic
955793668 3:62613125-62613147 GAGAAGGAGGAGCAGCTTGATGG - Intronic
955941492 3:64150539-64150561 GAGAAGAAGGAGGAGGAAGAAGG - Intronic
956198803 3:66683940-66683962 AAGAAAAAGGAGGAGGAGGAGGG - Intergenic
956212623 3:66817301-66817323 AAGAAGGAGGAGGAGGAGGAAGG + Intergenic
956482664 3:69688609-69688631 GAGAAGGAGGAGGAGGAAGAGGG - Intergenic
956629407 3:71300552-71300574 CAGATGCAGGAGTAGGATGTGGG - Intronic
956724425 3:72145492-72145514 CAGAAGGAAGAGAAGGAGGAAGG + Intergenic
956925332 3:73980875-73980897 CAGAAGAAAAAGCAGGTTAAGGG + Intergenic
958055472 3:88405305-88405327 CTGAATAAGTAGCAGGGTGAAGG - Intergenic
958440423 3:94149753-94149775 AATAAGGAGGAGGAGGATGAAGG - Intergenic
958560132 3:95737960-95737982 CAGAAGAAGAAGCAGGCAGAGGG - Intergenic
958906602 3:99948621-99948643 GAGAGGAAGGAGGAGGAGGAGGG + Intronic
959193784 3:103150660-103150682 CAGCTGAAGGACCAGGATGCAGG + Intergenic
959274227 3:104257355-104257377 CAGAAGAACCAGCAGGAGCAAGG + Intergenic
959963810 3:112332213-112332235 AAGACGAAGGAGGAGGAGGAGGG + Intergenic
959963891 3:112332608-112332630 GAGAAGAAGGAGAAGGAGAAGGG + Intronic
960705230 3:120475153-120475175 CAGGTGAAGGACCTGGATGATGG + Intergenic
960987508 3:123290430-123290452 CACAGGGAGAAGCAGGATGATGG - Intronic
961133192 3:124487813-124487835 GAGAAGAATGAGGAGGATAAAGG - Intronic
961376922 3:126473388-126473410 TAGAAGCAGGAGCAGGACCAGGG - Intronic
961432763 3:126894683-126894705 CAGCAGACGGAGCAGGAGGCTGG + Intronic
961492970 3:127268054-127268076 CTGAAATAGGAGCAGGATTATGG - Intergenic
961879406 3:130050281-130050303 AAGAAGAAGGAGAAGAAGGAAGG + Intergenic
962054411 3:131854796-131854818 GAGAAGGAGGAGGAGGAGGAGGG - Intronic
962379496 3:134886136-134886158 CAGCAGAAGCAGGAGGATGTGGG + Intronic
962380359 3:134893628-134893650 GAGCAGAAGGAGCCTGATGATGG - Intronic
962381204 3:134899426-134899448 CAGAAGAAACAGCAGGGCGAAGG - Intronic
963049695 3:141130308-141130330 AGGAAAAAGGAGCAGCATGAGGG + Intronic
963353698 3:144183759-144183781 CAGGAGAGGGAGTAGGCTGAAGG - Intergenic
963606372 3:147414594-147414616 CAGAAGAGGCAGCAGGTTGCTGG - Exonic
963796476 3:149635603-149635625 CGGAAGAGGGAGGAGGAGGAAGG + Intronic
964374401 3:156035408-156035430 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
964445442 3:156752780-156752802 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
964568135 3:158080875-158080897 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
964577415 3:158188480-158188502 CAGATGATAGAGCAGGAAGAGGG - Intronic
964843166 3:161016477-161016499 CTGAAGAAGGAACAGGTTGAAGG + Intronic
964940222 3:162151276-162151298 GGGAGGGAGGAGCAGGATGAGGG - Intergenic
965086316 3:164103495-164103517 CCAAAGAAGGAGCACGGTGAGGG - Intergenic
965690053 3:171346148-171346170 CAGATGAAACAGCAGGAAGAAGG + Intronic
965768186 3:172153525-172153547 CTGAGGAAGGAGCAGGCTGGGGG + Intronic
965820663 3:172681125-172681147 GAGAAGGAGGGGCAGGAAGAAGG + Intronic
965855268 3:173080513-173080535 GAGAGGAAGGATGAGGATGACGG + Intronic
965906494 3:173713980-173714002 AAGAAAAAGGAGAAAGATGAAGG + Intronic
966099187 3:176245396-176245418 CAGAAGGAGGAGAAGGGAGATGG + Intergenic
966104454 3:176319530-176319552 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
966185639 3:177224202-177224224 CAGAATAAGTAGCATGATGAAGG - Intergenic
966503915 3:180678138-180678160 CAAAAAAAGAAGCAGGATTAGGG + Intronic
966521900 3:180882344-180882366 AAGAAGAAGGAGACGGAAGAAGG - Intronic
966559164 3:181299961-181299983 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
966559181 3:181300033-181300055 GAGAAGAAGGAGGAGGAGAAGGG + Intergenic
966616285 3:181916714-181916736 CAGAGTTAGGAGCAGGATGGAGG - Intergenic
966653181 3:182323883-182323905 CAGAAAAATGAAGAGGATGAGGG - Intergenic
966680295 3:182634818-182634840 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
966921858 3:184617282-184617304 AAGAAGAAGGAGAAGGAGAAGGG + Intronic
967146793 3:186613149-186613171 AAGACAAAGGAGCAGGACGAGGG - Exonic
967446682 3:189575126-189575148 CAGAAGAGTGAGCAGGAAAAGGG + Intergenic
967987683 3:195107507-195107529 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
967987684 3:195107510-195107532 AAGAAGAAGGAGGAGGAAGGAGG + Intronic
968903590 4:3442054-3442076 CAGCAGGAGGAGGAGGAGGAAGG - Exonic
969039122 4:4280935-4280957 CAGAATAGGTAGCAGGAGGAAGG - Intronic
969107884 4:4821615-4821637 CAGAAGAAGAAGGAAGGTGAGGG + Intergenic
969996980 4:11323415-11323437 CAGAAGAAGTAGGAAGATGAAGG + Intergenic
970730283 4:19095137-19095159 GAGAAGAAAGAGAAGGAAGAGGG + Intergenic
970814174 4:20134338-20134360 GAGAAGAAGGAGGAAGAAGAAGG + Intergenic
970814186 4:20134408-20134430 GAGAAGAAGGAGGAAGAAGAAGG + Intergenic
970852535 4:20618170-20618192 CAGACAAAGGAGAAGGAGGAAGG - Intronic
971146002 4:23976972-23976994 AGGAAGAAGGAGGAGGAAGAGGG + Intergenic
971180275 4:24323767-24323789 CAGAGCAAAGAGCAGGAGGATGG - Intergenic
971226825 4:24761825-24761847 CTGAAGAAGGAGAAAGATAAAGG + Intergenic
971231757 4:24805870-24805892 CAGCAGGAAGAGCAGGAAGATGG + Intergenic
971261557 4:25061946-25061968 CAGAATAAGGAAATGGATGAAGG - Intergenic
971338501 4:25745949-25745971 CATAAGAAAGAGCAGTCTGAGGG - Intergenic
971511378 4:27429511-27429533 CATAGGAAGGAGCAGTCTGAGGG - Intergenic
972210623 4:36832139-36832161 GAGAAGATGGAGTAGGATGAGGG - Intergenic
972927071 4:44022812-44022834 GAGAAAAAGGAAGAGGATGAAGG - Intergenic
973028904 4:45310604-45310626 CAGAAGGAGGAGCACGGTGTTGG - Intergenic
973981893 4:56314583-56314605 CAGGAGGAGGAGGAGGCTGAGGG + Exonic
974389624 4:61249429-61249451 CAGGAGGAGGAGGAGGAGGAGGG - Intronic
974660344 4:64880450-64880472 GAGGAAGAGGAGCAGGATGAAGG + Intergenic
975388524 4:73788134-73788156 GAGAAGGAGGAGGAGGAGGAAGG + Intergenic
975483338 4:74906433-74906455 CAGAAGAAGGAGGAAGAGAAAGG + Intergenic
976405711 4:84658869-84658891 CAGAAGAAGCAGGAGAATGTGGG - Intergenic
976563556 4:86529017-86529039 CAGAAGAAGGAAGAGGTTGGTGG - Intronic
976974944 4:91154484-91154506 CAGGAGCAGGAGCAGGAGCAGGG - Intronic
977381959 4:96286879-96286901 CAGCAGGAGGAACAGAATGATGG + Intergenic
977731095 4:100352919-100352941 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
978264747 4:106810305-106810327 AAGAAGGAGGAGGAGGAAGAAGG - Intergenic
978508955 4:109494658-109494680 CAGAAGCAGGATCAGGTTCAGGG - Exonic
978535349 4:109756357-109756379 CAGGAGGAGGAGGAGGACGAGGG + Intronic
978850666 4:113332107-113332129 CAGAAGAAGGAGAAGAATGGGGG - Intronic
978935609 4:114371416-114371438 GAGAAGGAGGAGGAGGAGGAAGG - Intergenic
980137320 4:128871360-128871382 GAGGAGGAGGAGCAGGAAGAAGG - Exonic
980190694 4:129520552-129520574 AAGAAGAAGAAGGAGGAAGAGGG + Intergenic
980492951 4:133552949-133552971 GAGCAGAAGCAGCAGGATGTTGG - Intergenic
980575925 4:134683072-134683094 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
980742570 4:136972059-136972081 AAGAAGAAGGAGGAAGAAGAAGG + Intergenic
980912564 4:139006891-139006913 CAAAAAAAGGAGGAGGATGGGGG - Intergenic
981025053 4:140069476-140069498 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981025068 4:140069537-140069559 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981041637 4:140228244-140228266 ATGAAGAAGGAGGAGGAGGAGGG - Intergenic
981254402 4:142644303-142644325 GAGAAGGAGGAGGAGGAGGAGGG + Intronic
981666603 4:147234174-147234196 GAGAAGAAGGAGGAAGAAGAAGG + Intergenic
982028637 4:151277192-151277214 CAGCAGAAGGAGCAGCGTGAAGG - Exonic
982226244 4:153170127-153170149 AAGGAGAAGGAGGAGGAAGAGGG + Intronic
982253524 4:153431214-153431236 CAGAAAAAGGAGTAGGTTGTAGG + Intergenic
982347771 4:154379816-154379838 CTCAAGATGGAACAGGATGAAGG - Intronic
982393304 4:154889599-154889621 GAAAAGGAGGAGCAAGATGAGGG + Intergenic
983238646 4:165207490-165207512 CAGCAGCAGCAGCAGGAGGAAGG + Intronic
983659288 4:170116889-170116911 CAGAACAAAGAGTAGGAGGACGG - Intergenic
983906348 4:173186537-173186559 AAGAAGAAGGAACAGAAGGAAGG - Intronic
984179504 4:176464314-176464336 CAGATGTGGGAGCAGGAGGATGG + Intergenic
985155419 4:186982812-186982834 CAGAAAGAGGAGCACGATGGAGG - Intergenic
985690137 5:1304322-1304344 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
986273672 5:6255500-6255522 GAGAAGGAGGAGGAGAATGAGGG + Intergenic
986566759 5:9123416-9123438 AAGAAGAAGGAAAAGGAGGAGGG + Intronic
986566769 5:9123467-9123489 AAGGAGAAGGAGAAGAATGATGG + Intronic
986824070 5:11501711-11501733 CATAAGAAGGGGCAGGAGGCTGG + Intronic
987095454 5:14545614-14545636 GAGAAGGAGGAGGAGGAGGAAGG - Intergenic
987122933 5:14784635-14784657 CAGAGTAAGGAGCAGGGTCATGG + Intronic
987241957 5:16009041-16009063 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
987353218 5:17039917-17039939 GAGGAGAAGGAGGAGGATGGGGG - Intergenic
988222805 5:28370953-28370975 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
988246449 5:28688741-28688763 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
988632071 5:32942294-32942316 AAGAAGAAGGAGGAGGACGAGGG + Intergenic
988632077 5:32942324-32942346 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
988690439 5:33566720-33566742 CAGAAGAAGAAAAAGGATTATGG - Intronic
989188053 5:38643697-38643719 CAGAAGCAGGCCCAGGCTGATGG - Intergenic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990526482 5:56633167-56633189 AAAAAGGAGGAGCAGGAGGAGGG + Intergenic
990779012 5:59337107-59337129 CAAAAAGAGGAGAAGGATGAAGG + Intronic
991116140 5:62957709-62957731 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
991329162 5:65473822-65473844 TAGAAGAAAGTGCAGGATGTTGG - Exonic
991602579 5:68368224-68368246 CAGAAAAATGAGCTGGTTGACGG + Intergenic
992090644 5:73312955-73312977 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
992090684 5:73313135-73313157 AAGAAGAAGGAGGAGGAAGAAGG - Intergenic
992142102 5:73808830-73808852 GAGAAGAAGGAGGAAGAAGAAGG - Intronic
992430774 5:76709392-76709414 GAGAAGAAGGCTCATGATGAAGG + Intergenic
993009600 5:82465007-82465029 CAGAAGCAGGAGCTAGATGTTGG + Intergenic
993466279 5:88250609-88250631 CAGGAGAAGGAAGAGGATGTTGG + Intronic
993711129 5:91226342-91226364 CAGAAGAAGGAATAAGATGCTGG - Intergenic
993877011 5:93319174-93319196 CAGAAGATAGGGCAGAATGAAGG + Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
993900855 5:93583726-93583748 CAGAAGAAGGAGCAAGAAAGAGG + Exonic
994825392 5:104707621-104707643 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
995000063 5:107116636-107116658 CAGAAGCAGGCTCAGAATGAGGG + Intergenic
995016788 5:107318875-107318897 GAAAAGAAGGAGGAGGAGGAAGG + Intergenic
995735854 5:115298386-115298408 GAGAAGAAGGAGAAGGGAGAAGG + Intergenic
996587580 5:125107739-125107761 TAGAAGGAGGAGAAGGAGGAGGG - Intergenic
997277053 5:132602637-132602659 CATCAGGAGGAGCTGGATGAGGG - Intronic
997297226 5:132776155-132776177 GAGAAGGAGGAGGAGGAGGAGGG - Intronic
997634403 5:135394317-135394339 CAGAAGAGGGAGCACATTGATGG - Intronic
997739906 5:136244193-136244215 AAGAAGAAGAAGGAGGAGGAGGG - Intronic
997815814 5:137016057-137016079 CAGAAGAAGGAGAAGGCCTAGGG + Intronic
998165804 5:139842881-139842903 CAGAGGAAGGAGGAGGAGAAAGG - Exonic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998395023 5:141812678-141812700 GAGGAGGAGGAGCAGGAGGAGGG + Intergenic
998661230 5:144240470-144240492 CAAAAGAAGAGGCTGGATGAAGG - Intronic
998695090 5:144629904-144629926 GAGAATGAGGAGCAAGATGATGG + Intergenic
998933953 5:147214598-147214620 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
999304068 5:150508487-150508509 GAGAAGGAGGAGGAGGCTGAGGG + Intronic
999850241 5:155529700-155529722 CATCAGAAGGAGGAGGATGCTGG + Intergenic
1000055499 5:157602577-157602599 CAGAAGAAGGGGGATGAGGAAGG + Intergenic
1000060780 5:157653105-157653127 CAGTAGAAAGAGAATGATGATGG - Intronic
1000065786 5:157691934-157691956 CAGTAGAAAGAGAATGATGATGG - Intergenic
1000692425 5:164340010-164340032 GAGAAGAAAAAGCAGGAAGAGGG + Intergenic
1000963660 5:167629877-167629899 AAGGAGAAGGAGGAGGAGGAGGG + Intronic
1001132907 5:169079549-169079571 AGGAAGAAGGAGGAGGAGGAAGG + Intronic
1001737807 5:174021114-174021136 AAGAAGAAGGAGAAGGAAGAAGG + Intergenic
1001752947 5:174145416-174145438 AAGCAGAAGGAGCTGGATGGGGG + Intronic
1002430054 5:179198252-179198274 GAGGAGCAGGAGCAGAATGAAGG + Intronic
1002462099 5:179379071-179379093 CAGAACAAGAACCAGGATGCAGG - Intergenic
1002780263 6:359731-359753 CAGAAGCAGAAGCAGCATTAGGG + Intergenic
1002969125 6:1996093-1996115 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1003346833 6:5277109-5277131 CTGAAGAAGAAGCTGAATGAAGG + Intronic
1003487533 6:6592507-6592529 CAGTGGAAGAAGCAGGGTGAGGG + Intronic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003722344 6:8718006-8718028 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1004119676 6:12808834-12808856 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
1004157997 6:13187640-13187662 CAGAAAGAGGAGCAGGTTGAAGG + Intronic
1004389480 6:15198059-15198081 CAGAAGAAGGAGAAGGGGCATGG + Intergenic
1004919714 6:20365096-20365118 AAGAAGAAGGAGGAGGAAGAAGG - Intergenic
1004920239 6:20369329-20369351 CAGGAAAAGGAGAAGGATCAGGG + Intergenic
1005002975 6:21261302-21261324 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
1005016259 6:21377981-21378003 CAGGGGAAGGAGAGGGATGAGGG + Intergenic
1005020079 6:21409296-21409318 AAGAAAAGGGAGCTGGATGAGGG - Intergenic
1005206462 6:23410900-23410922 AAGAAAAGGGACCAGGATGATGG - Intergenic
1005385242 6:25279272-25279294 GAGAAGGAGGAGAAGGAGGAGGG + Intronic
1005422554 6:25667667-25667689 AAGAAGAAGGAACAGGATGAAGG - Intronic
1005989338 6:30893350-30893372 GAGCAGCAGGAGCAGGATGATGG - Exonic
1006268855 6:32948909-32948931 GAGGAGAAGGAGGAGGAGGATGG - Intronic
1006368921 6:33632684-33632706 CAGCAGAGGGAGCAGGAGGATGG - Intronic
1006474283 6:34244828-34244850 CAGGAGAAGGAGGAAGAGGAGGG + Exonic
1006743333 6:36324439-36324461 AGGGAGAAGGTGCAGGATGAGGG - Intronic
1007601314 6:43083364-43083386 CAGAAGAAGGACCAGGCAGATGG - Intronic
1008201952 6:48601618-48601640 CAGAAAAAGGAACAGAAAGATGG - Intergenic
1008592709 6:53010055-53010077 GGGAAGAAGGAGAAGGATAAAGG - Intronic
1008999454 6:57696759-57696781 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1010285916 6:74077654-74077676 CAAGAGGAGGAGCTGGATGAAGG + Intergenic
1010311404 6:74390030-74390052 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1010373705 6:75141425-75141447 CAGCAGACGGAGCAGGAAGCAGG + Intronic
1010485669 6:76410457-76410479 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1011277230 6:85643066-85643088 GAGAAGGAGGAGCTGGAGGAGGG - Exonic
1011484792 6:87830139-87830161 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1011742617 6:90377649-90377671 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1011749274 6:90438947-90438969 AAAAAAAAGAAGCAGGATGAGGG - Intergenic
1011964006 6:93129823-93129845 CAGAAAAAGGGTCAGGATAAGGG + Intergenic
1012165669 6:95948056-95948078 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1012238011 6:96839667-96839689 CAGAAGAATGAGAATGCTGATGG + Intergenic
1012437918 6:99234776-99234798 CAGCTGAAGGAGCAGGAGAAGGG - Intergenic
1012843760 6:104363595-104363617 CAAAAGGAGGAGCAGGTTTAAGG + Intergenic
1013017494 6:106173713-106173735 GAGAAGAAGGGACAGGATGGAGG + Intergenic
1013922215 6:115419799-115419821 CAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1014179303 6:118367364-118367386 CAGTATTAGGAGCTGGATGATGG - Intergenic
1014207567 6:118672782-118672804 AAGAAGAAGGAGGAGGAAGGAGG + Intronic
1014344416 6:120250199-120250221 CAGAAGATGGACCAGGATTTAGG + Intergenic
1014561912 6:122901174-122901196 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1014719755 6:124901915-124901937 CAAAAGCAGGAGCAGGGTGGAGG + Intergenic
1014747305 6:125214968-125214990 CAGAAGAAGGAGCACTCTAATGG - Intronic
1014869973 6:126581949-126581971 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1014994525 6:128125373-128125395 CAGGAGCAGGAGCAGGATGGGGG - Intronic
1014999773 6:128200827-128200849 AAGAAGAAGGATGAGGAGGAGGG + Intronic
1015471633 6:133612785-133612807 CAGAGGAAGGAGCATGCAGAGGG - Intergenic
1016589409 6:145728320-145728342 CAGAGGAAGCAGGAGGATGAAGG + Intronic
1016634820 6:146275971-146275993 GAGAAGAAAGAGGAGGAGGAAGG + Intronic
1016650662 6:146455964-146455986 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1017133437 6:151127883-151127905 CAGAAGAAGAAGGAAGATGTGGG + Intergenic
1017293335 6:152766203-152766225 CAGCAGTAGGAGAAAGATGAAGG + Intergenic
1017339640 6:153305453-153305475 AAGAAGAAGGAGGAGGAGTAGGG - Intergenic
1017450797 6:154552693-154552715 CAGAAAAGGGAACAGGATGTGGG - Intergenic
1017462963 6:154668398-154668420 AAGAAGAAAGAGGAGGAGGAAGG + Intergenic
1017587418 6:155942437-155942459 TAGAAGCAAGAACAGGATGAGGG - Intergenic
1017791670 6:157805211-157805233 CAGAGGGAGGGTCAGGATGAAGG - Intronic
1017993093 6:159506899-159506921 GACAAGAAGGGGCAGGAAGATGG - Intergenic
1018038064 6:159898613-159898635 AAGAAGAGGGAGGAGGAGGAAGG - Intergenic
1018038089 6:159898697-159898719 AGGAAGAGGGAGGAGGATGAAGG - Intergenic
1018611764 6:165654254-165654276 CAGGACAATGAGGAGGATGACGG - Intronic
1018996602 6:168715028-168715050 GGGGAGAAGGAGGAGGATGATGG + Intergenic
1019005202 6:168790765-168790787 CAAAAGAAGGAGCAAGAAAAAGG - Intergenic
1019574658 7:1731345-1731367 CAGAAAAGGGAGAATGATGAAGG + Intronic
1019676576 7:2317010-2317032 CAGAAGAGGGTGAAGGGTGAAGG + Intronic
1019853757 7:3584385-3584407 CAGAATAAGGTCCAGAATGAAGG - Intronic
1019959823 7:4449798-4449820 CAGCAGCAGGAGCAGGGGGAAGG - Intergenic
1020577346 7:9949887-9949909 AAGAAGAAGAAGAAGGAAGAGGG + Intergenic
1020577401 7:9950017-9950039 GAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1021622461 7:22562254-22562276 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1022011005 7:26308216-26308238 GAGAAAAAGGAGCAGGTTGAAGG - Intronic
1022254027 7:28637660-28637682 CAGAAGAAACAACAGGACGAAGG + Intronic
1022597039 7:31722655-31722677 CAGGTGAAGAAGCAGGATGGTGG + Intergenic
1022778649 7:33554969-33554991 CAGCAGATGGAGCAAGGTGAGGG + Intronic
1022792522 7:33703107-33703129 CAGAAGAAGGTGGTGGAAGAGGG - Intergenic
1022924268 7:35044297-35044319 GAGAAGAAGGGGCAGGAAGAGGG - Intergenic
1023047089 7:36219590-36219612 AAGAAGAAGGAGGAAGAGGAAGG + Intronic
1023047096 7:36219639-36219661 AAGAAGAAGGAGGAAGAGGAAGG + Intronic
1023131753 7:37010494-37010516 CAGAAGAGGGATCAGGGTGATGG + Intronic
1023214496 7:37847531-37847553 AAGAAGAAGGAGAAAGAAGAAGG + Intronic
1023648218 7:42341441-42341463 CAGAAAAAGGATAAGGAAGAAGG - Intergenic
1023910557 7:44552659-44552681 AAGAAGGAGGAGGAGGATGTTGG + Intergenic
1024195568 7:47055368-47055390 GAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1024299531 7:47876569-47876591 CAGCAGGAGGAGCAGGAGGGAGG + Intronic
1024657705 7:51465808-51465830 CAGAACAAGATGCAGGATGATGG + Intergenic
1024721000 7:52137360-52137382 AAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1024721003 7:52137363-52137385 AAGAAGAAGGAGGAGGAGGGGGG + Intergenic
1024770284 7:52714105-52714127 TAGATAAAGGAGGAGGATGAAGG - Intergenic
1024846259 7:53646192-53646214 AAGAAGAAGGAGGAGGAGGAAGG - Intergenic
1025819963 7:64953676-64953698 CAGAAGAAAGTGCAGAGTGAAGG + Intergenic
1025887753 7:65614429-65614451 AAGAAGGAGGAGGAGGAAGAAGG - Intergenic
1026191930 7:68136553-68136575 GAGGGGAAGGAGGAGGATGAGGG + Intergenic
1026217662 7:68364012-68364034 AAGAAGAAGGAGGAGGGCGAAGG - Intergenic
1026245417 7:68615282-68615304 GAGAAGAAGGAGGAGGAAGAGGG + Intergenic
1026529522 7:71185046-71185068 AAGCAGAAGGAGGAGGAGGAGGG - Intronic
1026638631 7:72105766-72105788 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
1026917452 7:74129504-74129526 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1027589284 7:80097190-80097212 AATAACAAGGAGCAGGATGGTGG + Intergenic
1028207145 7:88031290-88031312 CAGAGGATGGAGCAGTTTGAAGG + Intronic
1028246828 7:88489565-88489587 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1028519931 7:91718626-91718648 CTGAAGAAGAAGAAGGATAATGG - Intronic
1028888132 7:95957441-95957463 CAGCAGCAGGAGGAGGAGGAGGG - Intronic
1028921374 7:96314101-96314123 AAGGAGAAGGAGGAGGAAGAAGG + Intronic
1029089383 7:98036276-98036298 CTGAAGATGGAGGTGGATGACGG - Intergenic
1029094882 7:98077226-98077248 AAGAAGAAGAAACAGGAAGAAGG + Intergenic
1029321157 7:99761475-99761497 AAGAAGAAGGAGGAGAAGGAGGG - Intronic
1029380123 7:100208546-100208568 CAGAGGAAGGAGGAGCATCATGG + Intronic
1029584404 7:101461288-101461310 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
1029822576 7:103160063-103160085 GAGAAGAAGGGGCAGGAAGACGG - Intergenic
1029886461 7:103877810-103877832 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1029939769 7:104467829-104467851 GAGAAGGAGGAGCAGGATGAAGG - Intronic
1029983689 7:104902419-104902441 GAGAAGGAGGAGGAGGAGGAGGG + Intronic
1030034445 7:105396689-105396711 GAGGAGAAGGAGGAGGAGGAAGG + Intronic
1030276065 7:107722961-107722983 CGGAAGTAGGAACAGGAAGAAGG + Intergenic
1031209044 7:118798578-118798600 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1031270361 7:119641695-119641717 CAGAAGAAGCAGCAGGAGCAGGG - Intergenic
1031618574 7:123908916-123908938 AAGAAGAAGAAGAAGGAAGAAGG + Intergenic
1031762917 7:125737116-125737138 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1031863845 7:127015094-127015116 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031863849 7:127015122-127015144 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031882653 7:127214606-127214628 CAGGAGAAGGAGCGTGTTGAAGG + Intronic
1031943596 7:127815493-127815515 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1032012027 7:128352891-128352913 GAGAAGTAGGAGAAGGAAGAGGG - Intronic
1032312759 7:130803575-130803597 CAGCAGGAGGAGGAGGATGCTGG + Intergenic
1032431825 7:131868290-131868312 GAGAAGAAGGAGCAGGTGAAAGG + Intergenic
1032466805 7:132151292-132151314 AAGAAGAAGGAGGAGGAAGAAGG + Intronic
1032473074 7:132192394-132192416 AGGAAGAAGGAGGAGGAGGAAGG + Intronic
1032498645 7:132382210-132382232 GAGAAGAGGAAGCAGGAAGAGGG + Intronic
1032669383 7:134069354-134069376 GAGAAGAGGGAGGAGGAAGAAGG - Intergenic
1032962040 7:137046859-137046881 CAGAAGAAGGAGGAGGGGGAAGG + Intergenic
1033114984 7:138617391-138617413 AAGAAGGAGGAGCAAGAAGAAGG + Intronic
1033611785 7:142970295-142970317 CAGCAAAAGGAGCAGGAAAAGGG + Intergenic
1033759780 7:144426144-144426166 CAGATGAAGGAGCTGTAAGATGG - Intergenic
1033832619 7:145271695-145271717 AAGAAGAATAAGCAGGAAGAAGG + Intergenic
1033890469 7:146006537-146006559 TAGAAGAAGAAGAAGGAGGAGGG - Intergenic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034356722 7:150456392-150456414 CAGAGGAAGGAGCAGGAGCCAGG - Intronic
1034859063 7:154580871-154580893 CAGAAGAAAGAGCAGCAAAAAGG + Intronic
1034889005 7:154822755-154822777 AGGATGGAGGAGCAGGATGAGGG - Intronic
1034945486 7:155259156-155259178 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034997020 7:155584062-155584084 CAGAAGAGGGAGGAGGATGGGGG - Intergenic
1035050299 7:155994824-155994846 TAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1035344522 7:158189352-158189374 CCGAAGGAGGAGCATGATGATGG + Intronic
1035419704 7:158717345-158717367 CAGGAGGAGGAGAAGGAAGAAGG - Intergenic
1035579843 8:732434-732456 CAGAAGCAAGGGCAGGATAAGGG + Intronic
1035781797 8:2233576-2233598 CAGAAGCAGGAGGTGGGTGAAGG + Intergenic
1035790279 8:2297885-2297907 GAGGAGAAGGATCAGGATAATGG - Intergenic
1035802526 8:2423820-2423842 GAGGAGAAGGATCAGGATAATGG + Intergenic
1035810318 8:2485830-2485852 CAGAAGCAGGAGGTGGGTGAAGG - Intergenic
1036155390 8:6337459-6337481 CAGGAATAGGAGCAGGATGAAGG - Intergenic
1036521684 8:9497769-9497791 CTAAAGAAGGAGGAGGAGGAAGG - Intergenic
1036639160 8:10571533-10571555 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1036826323 8:11978712-11978734 CCATAGAAGGAGCAGGATGTGGG - Intergenic
1037300254 8:17444021-17444043 GAGGAGAAGGAGGAGGAAGAAGG - Intergenic
1037585540 8:20273514-20273536 CAGAAGGAGGGGCACGCTGAAGG - Intronic
1037735026 8:21558853-21558875 CAGAAGGAGGGGCAAGTTGAAGG + Intergenic
1037739855 8:21599812-21599834 CAGGAGAAGGGGTAGGAGGAAGG + Intergenic
1037778864 8:21854159-21854181 GAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1038132314 8:24746118-24746140 TAGGAGAAAGAACAGGATGAAGG - Intergenic
1038284992 8:26198582-26198604 AAAAAGAAGGAGGAGGAGGAGGG - Intergenic
1038313123 8:26461151-26461173 GAGAAGAAGGAGGGGAATGAAGG + Intronic
1038313415 8:26463163-26463185 GAGAAGGAGGAGGAGGAGGAAGG - Intronic
1038483660 8:27918869-27918891 GGGAAGAAGGAGAAGGAGGAGGG + Intronic
1038526449 8:28278130-28278152 CTGGAGAAGGATCATGATGATGG + Intergenic
1038839875 8:31174723-31174745 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1039806199 8:41001795-41001817 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1039827273 8:41185192-41185214 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1039870345 8:41540473-41540495 CAGAAGAGGGAGCAGGTTGGAGG + Intronic
1040079785 8:43274954-43274976 AGGAAGAGGGAGGAGGATGAGGG - Intergenic
1041140065 8:54808180-54808202 CAGAATCAGGAGCAGGAAAATGG + Intergenic
1041167268 8:55102353-55102375 CCGACGCAGGAGCAGGAGGAGGG + Intergenic
1041267607 8:56080332-56080354 AAGAAGAAGGAGGAGGGGGAGGG + Intergenic
1041347883 8:56920442-56920464 GAGAAGACGGAGAAGGAGGAAGG + Intergenic
1041462743 8:58129777-58129799 AGAAAGAAGGAGCAGGATGCGGG - Intronic
1041831536 8:62160688-62160710 AAGAAGTAGGAGGAGGAGGAAGG + Intergenic
1042264598 8:66895372-66895394 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1042311061 8:67379859-67379881 AAGAACAAGGAGAAGGAAGAAGG - Intergenic
1042555233 8:70028792-70028814 CAGGAGAAGTCACAGGATGATGG - Intergenic
1042559687 8:70064060-70064082 CAGAACAAGCAACAGAATGAGGG + Intronic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043115602 8:76250045-76250067 GAGAAGAAGGAGGAAGAGGAAGG - Intergenic
1043342459 8:79256616-79256638 CTGACACAGGAGCAGGATGAAGG + Intergenic
1043551378 8:81376843-81376865 GAGAAGAAGGTGGAGGATGGAGG + Intergenic
1043855012 8:85255092-85255114 GAGAAGAAGAAGGAGGAGGAAGG - Intronic
1044289493 8:90451187-90451209 CAGGAGAGGGAGCGAGATGAGGG + Intergenic
1044372327 8:91426684-91426706 CAGAAGAGGGAGGAGGAAGAGGG - Intergenic
1044831147 8:96250675-96250697 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1044917776 8:97134345-97134367 AAAAAGAAGCAGCAGCATGAAGG + Intronic
1044932020 8:97260133-97260155 CAGGAGAAGGAGGAGGGGGAGGG + Intergenic
1045130036 8:99140687-99140709 GAGAAGGAGGAGGAGGAGGAGGG - Intronic
1045358607 8:101411788-101411810 GAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1045490203 8:102662460-102662482 CTGAGGAAGAAGCAGGCTGAAGG + Intergenic
1045522420 8:102914806-102914828 CAGAAGAAGGTGCAGATTGAGGG - Intronic
1045698086 8:104833986-104834008 CAGCAGAAGGAGAAGGAACATGG - Intronic
1045769790 8:105722703-105722725 GAGGAGAAGGAGGAAGATGAGGG + Intronic
1045951461 8:107856029-107856051 CAGATGAAGAAGCTGGAGGATGG + Intergenic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046796960 8:118383990-118384012 CTGAAGAAAAAGCAGAATGAAGG + Intronic
1047073647 8:121375986-121376008 AAGAAGAAGGAGGAGTATGAGGG - Intergenic
1047221538 8:122922608-122922630 GAGGAGAAGGAACAGGAGGAAGG - Intronic
1047515641 8:125552531-125552553 CAAAAGAAGGAGCAGATTGAGGG - Intergenic
1047599023 8:126408043-126408065 CAGGAGAGGCAGTAGGATGAGGG - Intergenic
1047702565 8:127464240-127464262 TAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1047719257 8:127623883-127623905 CAGAGGAAGCCACAGGATGACGG - Intergenic
1047739519 8:127795249-127795271 AAGAAGAATGACCATGATGAGGG - Intergenic
1047798671 8:128285620-128285642 AAGAAGAAGGAGAAGGAAAAGGG + Intergenic
1048251952 8:132873868-132873890 CAGAAGAAAGAGTAGGCAGAAGG + Intronic
1048389253 8:133945880-133945902 CAGAACAAGCTGCATGATGAAGG - Intergenic
1048767402 8:137859932-137859954 AAGGAGGAGGAGCAGGAGGAGGG + Intergenic
1048975757 8:139672244-139672266 CAGAGGCAGGAGCAGGACCAGGG + Intronic
1049036448 8:140079966-140079988 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
1049062570 8:140287311-140287333 AGCAAGAAGGAGCAGGAGGAAGG + Intronic
1049278185 8:141730384-141730406 GAGAGGAAGGAGGAGGAGGAGGG - Intergenic
1049342995 8:142123708-142123730 CAGAAAAATCAGCAGGCTGAGGG - Intergenic
1049495186 8:142926900-142926922 CAGAAGGAGGAGACGGATGCAGG - Intergenic
1049524506 8:143115904-143115926 CAGAAGAAAGAGGAGCTTGAAGG - Intergenic
1049884010 9:15908-15930 CAGCAGAAGGAGCAGGAGCAAGG - Intergenic
1050475935 9:6041080-6041102 GAGAAGAAGGAGGATGAGGAAGG - Intergenic
1050734470 9:8747628-8747650 CAGAAGAAGAAATAGAATGAAGG + Intronic
1050829094 9:9989415-9989437 GAGAAGAAGCAGCTGGATGTTGG + Intronic
1051095988 9:13465631-13465653 CAGAAGAAGGAGAAGAGTAATGG + Intergenic
1051170386 9:14314705-14314727 GAGAAGGAGGAGGAGGAGGAAGG - Intronic
1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1051924682 9:22309635-22309657 CAGAAGAAGTGGCAGGATTTGGG - Intergenic
1051954748 9:22678346-22678368 CAGAAGAAAGAAGAGGATAAGGG - Intergenic
1052186984 9:25609905-25609927 TAGAAGAAGGAGGAAAATGAGGG + Intergenic
1053099529 9:35359535-35359557 CAGAAGAAGGATCAGGAGTTTGG - Intronic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1054810765 9:69432300-69432322 CAGATGAAAGAGAAGGCTGAGGG + Intronic
1055298150 9:74854572-74854594 GAGAAGAAGGAGGAGGTTGCTGG - Intronic
1055620404 9:78119571-78119593 TCAAAGAAGGAGCAGGAAGAAGG + Intergenic
1055738879 9:79363969-79363991 CAGAAGAAAGAGTAGGAAGAAGG - Intergenic
1056328037 9:85497246-85497268 AAGAGGAAGGAGAAGGAGGAAGG + Intergenic
1057021146 9:91698642-91698664 GAGAAAAAGGAGCAGGTGGAAGG - Intronic
1057037204 9:91820028-91820050 AAGAAGAAGGGGCAGTAAGAAGG + Intronic
1057140811 9:92725835-92725857 CCCAAGAAGGAGTAGGGTGAAGG - Intronic
1057147511 9:92768212-92768234 CAGGAGAAGCAGCTGGATGTCGG - Intergenic
1057171164 9:92964024-92964046 CAGCAGAAGCAGGAGGATGGTGG + Intronic
1057353800 9:94319629-94319651 CAGGAGCTGGAGCAGGAGGAAGG - Exonic
1057396045 9:94681446-94681468 GAGAAGGAGGAGGAGGATGGTGG - Intergenic
1057397270 9:94691288-94691310 CAGAGGCAGGAGCAGGGTGGAGG - Intergenic
1057605748 9:96496776-96496798 CAGAGGAAGGAGCTGGAGGAAGG - Intronic
1057653951 9:96937963-96937985 CAGGAGCTGGAGCAGGAGGAAGG + Exonic
1057755986 9:97835944-97835966 CAGTTGAAGGATCAGGAAGAGGG + Intergenic
1057869202 9:98706122-98706144 AAAAAGAAGGAGGAGGAGGAGGG + Intronic
1058181951 9:101809259-101809281 TAGAACAAAGAGCAGGAGGAAGG + Intergenic
1058293139 9:103269727-103269749 CAGCAGAAGAAGCATGATGCTGG + Intergenic
1058400540 9:104613163-104613185 CAGAAGGAAGAGAAGGATGGAGG + Intergenic
1058409458 9:104715263-104715285 AAGAAGAAGGAGAAGGAAAAGGG - Intergenic
1058561469 9:106233307-106233329 AAGAAAAAGGAGGAGGAAGAAGG - Intergenic
1058561475 9:106233343-106233365 AAGAAGGAGGAGGAGGAAGAGGG - Intergenic
1058563028 9:106249893-106249915 CAGAAGAAGAAGGAAGAAGAAGG - Intergenic
1058584056 9:106487737-106487759 CTGAACAAGGAGCATGATGGTGG + Intergenic
1058700645 9:107597431-107597453 TAAAAGAAGCAGCAGGATGAAGG - Intergenic
1058715963 9:107722206-107722228 GAGGAGAAGGAGGAGGAGGAAGG - Intergenic
1058913285 9:109541023-109541045 GAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1059160674 9:112032099-112032121 AAGGAGAAGGAGGAGGAAGAAGG + Intergenic
1059302725 9:113328055-113328077 CAGAAGAAGGAGAAGCAAGCTGG + Intronic
1059303397 9:113333957-113333979 GAGAAGGAGGAGAAGGAAGAAGG - Intronic
1059463734 9:114452178-114452200 CAGAAGATACAGCAGCATGAGGG - Intronic
1059588813 9:115635251-115635273 CAGAGGAAGGAGCAGTAGGTGGG - Intergenic
1059592777 9:115679956-115679978 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1059611380 9:115900739-115900761 GAAAAGGAGGAGAAGGATGAGGG - Intergenic
1059630112 9:116112804-116112826 CAGAAGAAGGCACAGAATGACGG - Intergenic
1059780532 9:117521730-117521752 CAGAAAAAGGACCAGGAGCATGG + Intergenic
1061155993 9:128861937-128861959 TAGAAGAAGTAGCAAGATGTTGG - Intronic
1061374482 9:130215907-130215929 GAGAAGAGGGAGCAGGATGTGGG - Intronic
1061510435 9:131057659-131057681 CAGAAGAGGAAGCAGGCTCAGGG - Intronic
1061524003 9:131142525-131142547 CAGAAGTAGTAGTAGCATGATGG + Intronic
1061866190 9:133492894-133492916 CAGAAGAAGAAACAGGTTCAGGG + Intergenic
1061899681 9:133666509-133666531 GAGAGGAAGGAGGAGGAGGAGGG - Intronic
1061992757 9:134168837-134168859 CTGAAGACAGAGCAGGAGGAAGG + Intergenic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062271820 9:135713355-135713377 CAGAACAAGGAGCAGGGTTTGGG + Intronic
1062283248 9:135761362-135761384 CAGAGAAAGGAGCAGAATGCAGG - Intronic
1062377897 9:136272178-136272200 CAGCAGAAGGAAAAGGATGCGGG + Intergenic
1062451926 9:136619375-136619397 CTGAAGGAGGAGGAGGAAGAGGG + Intergenic
1062564522 9:137158256-137158278 CAGGAGAAGGAGCAGGGAGAAGG + Intronic
1062638386 9:137503502-137503524 AAGGAGAAGGAGGAGGAGGAAGG + Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1062638457 9:137503850-137503872 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
1062638470 9:137504014-137504036 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
1185504960 X:625187-625209 GAGGAGAAGGAGGAGGAGGAGGG - Intronic
1185504972 X:625227-625249 GAGTAGAAGGAGGAGGAGGAGGG - Intronic
1185814493 X:3142397-3142419 AAGAAGAAGGAGGAGGAGGTGGG + Intergenic
1185954860 X:4478252-4478274 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1186058716 X:5680404-5680426 CAGAAAGAGAAGAAGGATGACGG - Intergenic
1186299835 X:8188194-8188216 AAGGAGAAGGAGTAGGAAGATGG + Intergenic
1187025747 X:15433932-15433954 AGGAAGAAGGAGGAGGAGGAAGG + Intronic
1187025797 X:15434169-15434191 AAGAAGAAGGAGGAGAAGGAAGG + Intronic
1187267321 X:17747188-17747210 CAGAAGAAGGGCAGGGATGAGGG - Intronic
1187603666 X:20860699-20860721 CAGAAGAAGAAGGAAGATGTGGG + Intergenic
1188461782 X:30435516-30435538 CATAAGAGGGAGCAGGAGGAGGG - Intergenic
1188589607 X:31817837-31817859 CTGAAGTAGGAACAAGATGACGG - Intronic
1189314010 X:40040907-40040929 TAAAAGAAGGAGAAGGAGGAGGG - Intergenic
1189645890 X:43131021-43131043 CAGAAGCAGGAGAAAGAAGAAGG + Intergenic
1189684395 X:43548808-43548830 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1189868933 X:45361579-45361601 CAGGAGACAGAGCAAGATGATGG - Intergenic
1190533784 X:51407047-51407069 CAGAAGCACCAGCAGGACGAGGG + Exonic
1190577980 X:51860537-51860559 CAGAATAAGGAGCAGGTTTGTGG + Intronic
1190719995 X:53139836-53139858 CAAAAGAAGGAGGAGGAGGCAGG + Intergenic
1191840368 X:65509461-65509483 CAGAACAAGGAGTAGAAGGAAGG - Intergenic
1191954782 X:66632437-66632459 CAGGAGGAGGAGGAGGAGGAGGG + Intronic
1192007468 X:67232658-67232680 GAGGAGAAGGAGGAGGATGGAGG - Intergenic
1192634087 X:72802023-72802045 CAGAAGAAGGGGCATAATAATGG + Intronic
1192647623 X:72918778-72918800 CAGAAGAAGGGGCATAATAATGG - Intronic
1193102974 X:77636788-77636810 AAGAAGAAGGAGAAGGAAGAAGG + Intronic
1193103000 X:77636897-77636919 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1193620678 X:83749941-83749963 CAGGAGGAGGAGGAGGACGAGGG - Intergenic
1194167863 X:90542798-90542820 GAGAAGAAGGAGAGAGATGAGGG + Intergenic
1195244243 X:102981184-102981206 TAGAAGAAGGAGGAGGATCAGGG - Intergenic
1195421766 X:104683455-104683477 CAGAGAAAGAAGCAGAATGACGG + Intronic
1196193682 X:112818936-112818958 CTTAGGAAGGAGCAGGATGAGGG - Intronic
1196856463 X:119989959-119989981 GAGAAGCAGGAGGAGGAGGATGG + Intergenic
1197087785 X:122499441-122499463 CTGTAGAAGAAACAGGATGAAGG - Intergenic
1197645766 X:129015124-129015146 CAGAAGAAGCAGCAAGAAGATGG - Intergenic
1198204188 X:134450876-134450898 CAGAAGGAGGATCAGGAAGGTGG + Intergenic
1199109932 X:143919749-143919771 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1199785868 X:151104344-151104366 CAGCAGGAAGAGCAGGTTGAGGG - Intergenic
1199841465 X:151653691-151653713 AAGAAGAAGAAGGAGGAGGAGGG - Intronic
1200287590 X:154838486-154838508 GAGAAAAAGGAACAGAATGAAGG + Intronic
1200379708 X:155822197-155822219 CAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1200401800 X:156024251-156024273 AAGCAGAAGGAGCAGGAGCAAGG + Intergenic
1200414210 Y:2890861-2890883 AAGAAGGAGGAGAAGGAAGAGGG + Intronic
1200514120 Y:4120588-4120610 GAGAAGAAGGAGAGAGATGAGGG + Intergenic
1200531695 Y:4347687-4347709 CAGATGCAGCAGCAGGCTGAAGG - Intergenic
1201304631 Y:12540247-12540269 GAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1201461748 Y:14233042-14233064 AAGAAGAATGAGGAGGAGGAGGG - Intergenic
1201739734 Y:17311109-17311131 CAGCAGCAGGAGGAGGAGGAGGG - Intergenic
1202594133 Y:26519504-26519526 CAGGAGAAGGAGAAAGATGGGGG - Intergenic