ID: 1178723272

View in Genome Browser
Species Human (GRCh38)
Location 21:35028948-35028970
Sequence CACTGCAGACAGATGAGCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 201}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178723272_1178723277 -8 Left 1178723272 21:35028948-35028970 CCCTAGCTCATCTGTCTGCAGTG 0: 1
1: 0
2: 2
3: 22
4: 201
Right 1178723277 21:35028963-35028985 CTGCAGTGTGAATTGGAGAGGGG 0: 1
1: 0
2: 4
3: 21
4: 251
1178723272_1178723275 -10 Left 1178723272 21:35028948-35028970 CCCTAGCTCATCTGTCTGCAGTG 0: 1
1: 0
2: 2
3: 22
4: 201
Right 1178723275 21:35028961-35028983 GTCTGCAGTGTGAATTGGAGAGG 0: 1
1: 0
2: 1
3: 33
4: 210
1178723272_1178723276 -9 Left 1178723272 21:35028948-35028970 CCCTAGCTCATCTGTCTGCAGTG 0: 1
1: 0
2: 2
3: 22
4: 201
Right 1178723276 21:35028962-35028984 TCTGCAGTGTGAATTGGAGAGGG 0: 1
1: 0
2: 3
3: 26
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178723272 Original CRISPR CACTGCAGACAGATGAGCTA GGG (reversed) Intronic
902641614 1:17769972-17769994 TCCTCCAGCCAGATGAGCTATGG + Intronic
902986930 1:20160591-20160613 CACTGCAGCAGGATGAGCTGTGG - Intergenic
902992438 1:20197673-20197695 CACTGCAGGCAGCTGAGCAGAGG + Intergenic
905037087 1:34925388-34925410 CCCTGCAGACAGATGTGGTGGGG + Intronic
908367584 1:63442123-63442145 CACAGCAGACAGATCACCTCAGG - Intronic
910367931 1:86486572-86486594 TGCTGCAGACAGTTGAGCTGGGG + Exonic
911669572 1:100592622-100592644 CACCTCATACAGAAGAGCTATGG + Intergenic
913165247 1:116179027-116179049 CACAGCAGACAGGTGACCCACGG + Intergenic
914916904 1:151824564-151824586 CAGTGCAGGCATATGAGCTGGGG - Intronic
915902906 1:159858896-159858918 CACAGCAGACAGCAGTGCTAGGG + Exonic
917793556 1:178515329-178515351 CAAGGCAGACAGATCAGCTGAGG - Intronic
918744257 1:188180049-188180071 TACTGCAGACATATGAGTAAGGG - Intergenic
921016245 1:211194188-211194210 CAAGGCAGACAGATGACCTGAGG - Intergenic
921936971 1:220804490-220804512 CACTGCAGCCAGGGGAGCTGTGG - Intronic
922865881 1:228861216-228861238 CAATGCAGGCACGTGAGCTAAGG - Intergenic
1063576020 10:7262664-7262686 GACTGCAGACAGCGGAGCTCAGG + Intronic
1064256497 10:13746917-13746939 TAGGGCCGACAGATGAGCTATGG + Intronic
1065759646 10:28970090-28970112 GACTGCAGAAACATCAGCTATGG - Intergenic
1066352717 10:34651596-34651618 CACTGCTGACAGATCAACAAAGG + Intronic
1067753058 10:48984620-48984642 CACAGAAGACAGATGAGGTGAGG - Intergenic
1073820105 10:107252305-107252327 CTCTGCAGCCATATGAGTTAAGG + Intergenic
1077500719 11:2908709-2908731 CACAGCAGACAGGGGAGCAAGGG + Intronic
1080667525 11:34348931-34348953 CAATGGAGACAGATTAGCAAGGG - Intronic
1083607632 11:63988266-63988288 CACTGCAGGCAGCTGGGCCAGGG - Intronic
1083894104 11:65611611-65611633 CCCTGCAGGCAGCTGGGCTAGGG + Intronic
1088454022 11:110014687-110014709 AACTTAAGACTGATGAGCTAGGG - Intergenic
1089975141 11:122725578-122725600 CACTGTCTAAAGATGAGCTATGG - Intronic
1091162172 11:133433932-133433954 TACTTCAGAAAGATAAGCTATGG - Intronic
1091492473 12:945116-945138 CAATGCAGACAGATCACCTGAGG + Intronic
1092104472 12:5911711-5911733 CTATGCAGACAAATAAGCTAAGG - Intronic
1092308312 12:7324320-7324342 CACTGGAGACAGAGGAGTGATGG + Exonic
1093499651 12:19797633-19797655 CACTGTATACATGTGAGCTATGG + Intergenic
1101128068 12:101659975-101659997 CATTGGAGAAAGAAGAGCTAAGG + Intronic
1101881498 12:108629039-108629061 CGCTGCAGGCAGATGAGCAGAGG + Intronic
1102414112 12:112745783-112745805 CATTGCTGGAAGATGAGCTATGG - Intronic
1104138827 12:125966930-125966952 CACTGCAGAGAGCTGGACTAGGG + Intergenic
1104882702 12:132083771-132083793 CACTGTAGACGGGTGAGCTTTGG - Intergenic
1104915568 12:132262682-132262704 AGGTGCAGACAGATGAGCTATGG - Intronic
1104915584 12:132262759-132262781 AGGTGCAGACAGATGAGCTATGG - Intronic
1105594646 13:21825753-21825775 CACTGCAGATAGATGGCCCAGGG - Intergenic
1106501340 13:30331854-30331876 CACTGCAGAGAAATGGGTTAAGG - Intergenic
1107354890 13:39556527-39556549 CACTTCAGAGTGATGACCTAGGG + Intronic
1108015557 13:46071808-46071830 CACAGCTGACACATGACCTAAGG - Intronic
1108303642 13:49107808-49107830 CAGTGCTGACAGCTGAGTTAAGG + Intronic
1110254294 13:73415274-73415296 TAATGCAGAAAAATGAGCTAAGG - Intergenic
1111649031 13:91066475-91066497 CAGAGCAGACAGCTGAGATAAGG + Intergenic
1111865872 13:93768146-93768168 TACTGGAGACAGATGAACTCAGG + Intronic
1112258924 13:97860364-97860386 CACAGCAGACAGATCACCTGAGG + Intergenic
1113074493 13:106454547-106454569 CACCCCAGACAGATGGGCCATGG - Intergenic
1114316335 14:21512976-21512998 CAAGGCAGGCTGATGAGCTAAGG - Intergenic
1115654031 14:35425835-35425857 CACTGAAGAAAGATGAGTGAAGG - Intergenic
1120781972 14:88493629-88493651 GACTGCATACAGATGAGATAGGG + Intronic
1121207228 14:92179600-92179622 CACTGAGGACAGAGGAGGTAAGG - Intergenic
1121328514 14:93035491-93035513 CAGTGCAGACTGATGTGCTATGG + Intronic
1121362309 14:93272866-93272888 CACTGCAGACACCTGGGCTTAGG - Intronic
1121721141 14:96109516-96109538 AAATGCAGACAGATGAGGTGTGG + Intergenic
1121945849 14:98121056-98121078 CACTGCTGACAGATGAGCCAAGG - Intergenic
1122002499 14:98671725-98671747 CACTGTAGAAAGATAAGCCAAGG - Intergenic
1122070827 14:99204393-99204415 CACTGCAGATGGAAGAGCTCGGG - Intronic
1124429375 15:29593097-29593119 GACTGCAGAGAGATTTGCTATGG - Intergenic
1125164965 15:36692105-36692127 CACTGCAGACAAATAAGAAAAGG - Exonic
1125329927 15:38573000-38573022 CACCTCATACAGAAGAGCTATGG - Intergenic
1127340680 15:58040359-58040381 ACCTGCAGACAGATAATCTAGGG + Intronic
1134673014 16:16069789-16069811 CAAGGCAGACAGATCAGCTGAGG + Intronic
1135589925 16:23697641-23697663 CAATGCAGATATATGAGCTGGGG + Intronic
1136242583 16:28953303-28953325 CAAGGCAGACAGATCACCTAAGG - Intronic
1141450335 16:84095618-84095640 CACTGCAGGCAGATGTGCTCTGG - Exonic
1141863912 16:86736628-86736650 CACTGCAGACAGCAGAAGTAAGG - Intergenic
1147966055 17:44194803-44194825 CACAGCACACAGATGAGCAGAGG - Exonic
1148452028 17:47784962-47784984 CACTGAAAACAGATGAGCTATGG + Intergenic
1148885143 17:50766997-50767019 CCTTGCAGACAGATGTGCTGAGG - Intergenic
1149376115 17:56045934-56045956 CAATGTAGACAGATGATCTACGG + Intergenic
1150211517 17:63444536-63444558 CACTGCTGACACATGAGGTTTGG + Intronic
1150456543 17:65310998-65311020 GGCTGCAGAGAAATGAGCTAAGG + Intergenic
1151674733 17:75591595-75591617 CACTGCAGTGGGAGGAGCTAAGG - Intergenic
1153552545 18:6276494-6276516 AATTGCAAACATATGAGCTAAGG + Intronic
1155364492 18:25036358-25036380 CATTGGAGATAGATGAGCCAAGG + Intergenic
1157176087 18:45453719-45453741 CACTGCATCCACATGAGGTAGGG + Intronic
1158369912 18:56788968-56788990 CACTGCAAACAGATACACTACGG - Intronic
1158949147 18:62475640-62475662 CACTGCAGACTAATGTGCTCTGG - Intergenic
1160425501 18:78776270-78776292 AGCTGGAGACAGATGAGCTCAGG - Intergenic
1162514264 19:11138727-11138749 CACTGCAGACAGCTGTGGTCTGG - Intronic
1162648966 19:12070617-12070639 CATTGCAGACATATGAATTAGGG + Intronic
1162740563 19:12771327-12771349 CAGGGCAGAAAGATGAGCTTGGG + Intronic
1163057505 19:14731570-14731592 GACAGCAGACAAAGGAGCTAGGG - Intronic
1164803113 19:31093939-31093961 GCCTGGAGAAAGATGAGCTATGG + Intergenic
1165586395 19:36919801-36919823 CACTGCAAACACATGAGTAATGG - Intronic
1168637794 19:58009867-58009889 CACTGTAGCCACATGACCTAGGG - Exonic
927801381 2:26102906-26102928 CTTTGCAGACAGATGCTCTATGG - Intronic
929003365 2:37369917-37369939 CAAGGCAGGCAGATCAGCTAGGG + Intronic
929978193 2:46655064-46655086 CTCTGCAGCCATATGAGCTAAGG - Intergenic
933773792 2:85759729-85759751 CACTACACACAGATGAGCACCGG - Intronic
934681239 2:96285457-96285479 GAGTGCAGACAGAGGAGCTAAGG + Intronic
935040246 2:99419584-99419606 CACAGGAGACAGAGGAGGTAGGG + Intronic
937358783 2:121214559-121214581 CGCTGGAGACAGAAGAGCTTGGG + Intergenic
937526826 2:122781482-122781504 CAATGCACACAGGTGAGCAACGG - Intergenic
942655904 2:178213824-178213846 CACAGCAGACACATGTGCAAAGG - Intronic
945895396 2:215475673-215475695 CACATCAGAAAGATAAGCTAAGG + Intergenic
945989355 2:216380718-216380740 CACTGTACACATATGAGCTGGGG - Intergenic
1169414879 20:5407407-5407429 CACTGCAGACAGATGATAAGTGG - Intergenic
1169620922 20:7505880-7505902 CCCTGGAGACAGATGATCCAGGG + Intergenic
1170978954 20:21192910-21192932 CACTGCAGAAAGAAGGACTAAGG - Intronic
1172525060 20:35595740-35595762 CACTGCAGACAGTTTTGCCACGG - Intergenic
1172896728 20:38305256-38305278 CACAGAAGACAGAAGAGCTAGGG + Intronic
1175136808 20:56830224-56830246 AACTGCAGACAAATGAGCCCGGG - Intergenic
1175765360 20:61588664-61588686 CACTGGAGACAGAGGAGAAAGGG - Intronic
1177087832 21:16729499-16729521 GACTGCAGACAAATGGGTTATGG + Intergenic
1178624131 21:34201643-34201665 CACTGCAGAAAGATAATTTAAGG + Intergenic
1178723272 21:35028948-35028970 CACTGCAGACAGATGAGCTAGGG - Intronic
1179163985 21:38920823-38920845 GGCTGCAAACAGATGAGCTAGGG + Intergenic
1179676246 21:42984618-42984640 CAAGGCAGACAGATCACCTAAGG - Intronic
1180679330 22:17614116-17614138 CAAGGCAGACAGATCACCTAAGG + Intronic
1181562627 22:23714700-23714722 CACTGCAGACATAGGAGATATGG + Intergenic
1183219233 22:36501691-36501713 CAAGGCAGACAGATCACCTAAGG - Intronic
1184806591 22:46798589-46798611 CACTCCACAAAGATGAGATAGGG - Intronic
1185039345 22:48496521-48496543 CCCTGCAGGCAGAGGAGCCAGGG + Intronic
950713101 3:14827893-14827915 CATTGCAGACAGAGCAGTTAAGG + Intronic
950838007 3:15939204-15939226 CACTGCAGACAGTGGAACTGTGG + Intergenic
951774268 3:26291454-26291476 CATTTCAAACACATGAGCTATGG - Intergenic
953026186 3:39146559-39146581 CACGGGAGACAGAAGAGCTTGGG + Exonic
953996272 3:47522437-47522459 GGCTCCAGAGAGATGAGCTAAGG - Intergenic
955131132 3:56170243-56170265 CACTGCAGCCAGTTGAGCCTGGG - Intronic
955711487 3:61783785-61783807 CACTGGAGACAGATGAACTTGGG + Intronic
958045276 3:88277199-88277221 GACTGCAGAGAGAGGATCTATGG - Intergenic
958600568 3:96291102-96291124 CAAGGCAGACAGATCACCTAAGG + Intergenic
959261437 3:104086921-104086943 TACTTCAGAAAGAGGAGCTATGG + Intergenic
959700450 3:109293681-109293703 CACTGCAGACAGGACAGATAAGG - Intergenic
963235745 3:142953890-142953912 CACTGCCACCAGATGAGCCATGG - Intronic
964269352 3:154939124-154939146 CACTCCAGTCAAATCAGCTATGG - Intergenic
964623672 3:158739061-158739083 CACTGGAGAGAGGTGAGCAAAGG - Intronic
964715836 3:159720529-159720551 CATTGCTGAAAGATAAGCTAGGG - Intronic
964843106 3:161015862-161015884 CACTAGAGTCAGATTAGCTAGGG - Intronic
965379162 3:167966949-167966971 CTCTGCAGACTGAAGTGCTATGG + Intergenic
965738759 3:171850515-171850537 CACTGAAGCCAGATAAGCAAGGG - Intronic
966792951 3:183690229-183690251 CAAGGCAGACAGATCACCTAAGG + Intergenic
967928693 3:194674054-194674076 CAGTGCTCACAGATGAGCAAAGG + Intergenic
967995242 3:195161421-195161443 CACTGCACAGAGATGATCTGGGG - Intronic
970353844 4:15233123-15233145 CACTGAAAACAGAGGAGCTGTGG + Intergenic
970475725 4:16420908-16420930 CACTGCAGACAGGTGACTTGGGG - Intergenic
975764759 4:77655449-77655471 CACTTCATACAGAAGAGCTCTGG + Intergenic
976720403 4:88163819-88163841 AACTGCACACAGATGCGGTATGG - Intronic
977150669 4:93507664-93507686 CAGTGCAGACAGAGAAGATAAGG - Intronic
977591757 4:98834748-98834770 CAAGGCAGGCAGATCAGCTAAGG + Intergenic
979239468 4:118435557-118435579 CCTTCCAGCCAGATGAGCTAGGG - Intergenic
980200666 4:129652240-129652262 CACTGCATACAGGAGAGCTCCGG + Intergenic
981316130 4:143341483-143341505 CAATGCTGACAGCTGGGCTATGG - Intronic
982109335 4:152039574-152039596 CACTGCAGGGAAATGACCTATGG + Intergenic
983517636 4:168674374-168674396 ACCTCCAGACAGATCAGCTAGGG + Intronic
984639885 4:182150850-182150872 CACTGCATTCAGAGGTGCTACGG - Intronic
987198157 5:15547958-15547980 CACTGCAGAAAGATGAGAGTGGG + Intronic
987218085 5:15760246-15760268 AACTGCAGAATGATCAGCTATGG - Intronic
987953456 5:24706416-24706438 CAAGGCAGGCAGATGACCTAAGG + Intergenic
988061388 5:26175128-26175150 AACTGGAGACAGATGATTTAGGG + Intergenic
989246763 5:39263898-39263920 CACTGGAGACACCTGAGCTGAGG - Intronic
989625795 5:43428453-43428475 CACTGAAGCCAGGTCAGCTATGG - Intergenic
990242978 5:53834252-53834274 CACTGCAGCCCTATGAGTTAGGG - Intergenic
990258912 5:54000102-54000124 CACTGCAGACTGATGTATTATGG + Intronic
992503753 5:77365921-77365943 CCCTGCAGATAGAGGAGCTTCGG - Intronic
992984098 5:82209838-82209860 CATAGCAGACATATGAGATATGG - Intronic
994379261 5:99051960-99051982 AACTGCAGACAGAGGACCTAAGG + Intergenic
998786263 5:145712036-145712058 CACTGGATTCAGATGATCTATGG - Intronic
999473625 5:151878266-151878288 AACTGCAGAGAGATGATTTAGGG + Intronic
1001856355 5:175013984-175014006 CAAGGCAGGCAGATGACCTAAGG - Intergenic
1003492502 6:6635938-6635960 CACTGCAGTCTGATGAGTCAGGG - Intronic
1008471578 6:51890960-51890982 CAGTGCAGACAGTAGGGCTATGG + Intronic
1009812497 6:68686559-68686581 CACTGTGGCCAGATCAGCTATGG - Intronic
1010406424 6:75511294-75511316 CACTGCTGAGAACTGAGCTAAGG - Intergenic
1012762476 6:103319269-103319291 AACTGAACACAGATGAACTAAGG + Intergenic
1013969352 6:115998117-115998139 CAGTGCAGCCAGCTGAGCTTGGG + Intronic
1014553193 6:122812596-122812618 CACTCCAGACAGATGTGACAAGG - Intergenic
1015186734 6:130425715-130425737 CCCCTTAGACAGATGAGCTAAGG - Intronic
1015198192 6:130547758-130547780 CACAGCAGAGAGATGAACTCAGG - Intergenic
1016495680 6:144659359-144659381 CACTGCTGTCAGATCAGCCAGGG + Intronic
1018555261 6:165042924-165042946 CCCTGCAGACAAAGGAACTATGG - Intergenic
1019123830 6:169825883-169825905 CACTGCAGACAGCTGTGAAAGGG + Intergenic
1025227480 7:57177887-57177909 CACTGCAGACAAAGGAGATATGG + Intergenic
1025230598 7:57201336-57201358 CACTGCAGACACAGGAGATATGG + Intergenic
1025928905 7:65979910-65979932 CACTGCAGACACAGGAGATACGG + Exonic
1026459892 7:70604678-70604700 CTCTGCTGACAGAGAAGCTATGG + Intronic
1026539779 7:71269583-71269605 CTCTGCAGACAGATGAGCAGTGG - Intronic
1026604363 7:71803324-71803346 GACTGCAGACCCCTGAGCTAGGG + Intronic
1027170975 7:75872242-75872264 CACTGCAGAGGGGAGAGCTAAGG - Intronic
1027430941 7:78112062-78112084 CAATGCAGACAAATGACCTAAGG - Intronic
1027466984 7:78527254-78527276 CACTGCTTTCAGATGACCTAGGG - Intronic
1029488979 7:100860111-100860133 CACAGCAGACACATCAGCCAGGG - Intronic
1030017936 7:105243437-105243459 CAATGCAGACAGATCACCTGAGG + Intronic
1031732554 7:125316541-125316563 CACTGCAGACTGAAGTGCTCTGG + Intergenic
1032583074 7:133121270-133121292 GACTGCAGACAGATAAGGAAGGG + Intergenic
1036068041 8:5406070-5406092 CACGGCAGGCAGATCACCTAAGG - Intergenic
1036210995 8:6841399-6841421 CACAGCAGACAGAAGAGGGATGG - Intergenic
1038888808 8:31695400-31695422 CACTGCAGGCAGATCACTTAAGG - Intronic
1040551600 8:48442092-48442114 CACAGGAGACAGAGGAGCTTGGG + Intergenic
1041254974 8:55972135-55972157 CACTTGAGCCAGATGAACTATGG - Intronic
1042024985 8:64413772-64413794 CACTGTAGACACATGAGGAAGGG - Intergenic
1045303174 8:100932672-100932694 AACTGCAGGCAGATAAGCTGTGG - Intronic
1045343859 8:101277122-101277144 AACTGCAGGCAGATGAGTTAAGG - Intergenic
1045498094 8:102725430-102725452 CAGTGGAGACCCATGAGCTAAGG + Intergenic
1046823523 8:118661726-118661748 CACTGCAGAAGGTTGAGCTGAGG + Intergenic
1047483530 8:125307493-125307515 CACTCCAGACAAATGGGCTCAGG - Intronic
1048012368 8:130468285-130468307 CACTCCAGCCAGATGACCTCAGG - Intergenic
1051436993 9:17043691-17043713 CAAGGCAGGCAGATCAGCTAAGG - Intergenic
1051998540 9:23248470-23248492 CACTTCATACAGAAGAGCTCTGG + Intergenic
1052901192 9:33796183-33796205 CACTGCACAGATCTGAGCTATGG + Intronic
1055036128 9:71820485-71820507 AGCTGCAGAAAGATGGGCTAAGG + Intergenic
1055524048 9:77112071-77112093 CACTGCACCCAGCTGAGCTAAGG - Intergenic
1056776743 9:89518588-89518610 CACTAAGGACAGATGTGCTAGGG - Intergenic
1057228481 9:93304784-93304806 CACTGCAGACAACTGGGCTGGGG - Intronic
1058283948 9:103152887-103152909 GACTGCAGCAAGATGAGCTGGGG + Intergenic
1060528796 9:124335518-124335540 CATTTCAGACAGTTGAGCTCCGG + Intronic
1061098465 9:128473730-128473752 CACTGCAAAGAGGTGAGCTTGGG + Exonic
1061186370 9:129056804-129056826 CACTGCACCCAGCTGAGCTCAGG + Intronic
1061584937 9:131559454-131559476 CATTGCAGACAGAGGAGGAAGGG + Intergenic
1061958743 9:133977336-133977358 CCCAGCAGAAAGATGAGCTGGGG + Intronic
1188007919 X:25029699-25029721 TACTGCAGCCATATGAGATATGG + Intergenic
1188473748 X:30568428-30568450 CATTGCAGACAGAGGAGAGAAGG + Intronic
1189471327 X:41316484-41316506 CACTGCAGTCAGACCAGCCAGGG - Intergenic
1189865503 X:45323090-45323112 CAATGCAGGAAGAAGAGCTAGGG + Intergenic
1190692553 X:52923621-52923643 CACTGCAGTCAGATGAGCCTTGG - Intergenic
1193908614 X:87274407-87274429 CACTGCAGATGGTTGAGCTATGG + Intergenic
1199542289 X:148970090-148970112 CAGTGGAGCCAGATGACCTAAGG + Intronic
1200281433 X:154780361-154780383 CTCAGCAGAAAAATGAGCTAAGG + Intronic
1200417966 Y:2933205-2933227 CACTTCAGAAAGAACAGCTAAGG - Intergenic
1200727396 Y:6688241-6688263 CACTGCCTACAGATAGGCTAAGG + Intergenic
1200728548 Y:6704016-6704038 CACTGCCTACAGATAGGCTAAGG + Intergenic
1202342197 Y:23881713-23881735 CACTTCATACAGAAGAGCTCTGG - Intergenic
1202528572 Y:25788372-25788394 CACTTCATACAGAAGAGCTCTGG + Intergenic