ID: 1178725509

View in Genome Browser
Species Human (GRCh38)
Location 21:35048018-35048040
Sequence CTGGTTTCAAAAATGGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 289}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178725504_1178725509 2 Left 1178725504 21:35047993-35048015 CCACAGCTTTGTCCATTTCAAGA 0: 1
1: 0
2: 0
3: 12
4: 217
Right 1178725509 21:35048018-35048040 CTGGTTTCAAAAATGGAGACAGG 0: 1
1: 0
2: 3
3: 26
4: 289
1178725507_1178725509 -10 Left 1178725507 21:35048005-35048027 CCATTTCAAGAGGCTGGTTTCAA 0: 1
1: 0
2: 1
3: 16
4: 245
Right 1178725509 21:35048018-35048040 CTGGTTTCAAAAATGGAGACAGG 0: 1
1: 0
2: 3
3: 26
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178725509 Original CRISPR CTGGTTTCAAAAATGGAGAC AGG Intronic
900296073 1:1950817-1950839 CTGGTTTAAAAATTGTAAACTGG - Intronic
900924621 1:5696527-5696549 CTGTTTTTAAAAATTGAGACAGG - Intergenic
901384063 1:8895477-8895499 CTTGTTTTAAAAATTCAGACCGG + Intergenic
901456365 1:9365155-9365177 CTTGTCTCAAAAATGAAAACAGG - Intronic
908132577 1:61088802-61088824 GTGGTTTCAAAGATTGAGAGAGG + Intronic
909055024 1:70810717-70810739 ATGGTATGAAAACTGGAGACAGG + Intergenic
909128145 1:71701400-71701422 CTGGTTTGGAAAATGGAGAAAGG - Intronic
909896089 1:81070808-81070830 CTGGTTTTAAAAAGAGAGAGAGG + Intergenic
910332105 1:86085837-86085859 CTGGTTTCAAAAAATGGGAATGG + Intronic
911051059 1:93671773-93671795 CTGGTTTCAAAAAGGAATTCAGG + Intronic
912088531 1:106040826-106040848 CTGGTTTTAAAAATGAAAATTGG - Intergenic
914452400 1:147804065-147804087 CTGGTTTCAACAAATGACACAGG + Intergenic
916916918 1:169417088-169417110 CTGGTTACCAAAATGGGGAAGGG + Intronic
917127383 1:171699345-171699367 CTGTTGTTAGAAATGGAGACAGG - Intergenic
919770931 1:201158111-201158133 CTGGCTTCAAAGATGCAGGCAGG + Intronic
920762941 1:208803395-208803417 CAGGTTTCAAAATTGCAGAGTGG + Intergenic
923441779 1:234027512-234027534 GTGGTTTAAAGAATGGAGAGTGG + Intronic
923488025 1:234455018-234455040 CTGGTTTTGAAGATGGAGAAAGG + Intronic
923754928 1:236783502-236783524 CTGGTATCTATAATGGAGATTGG - Intergenic
1063189108 10:3677620-3677642 CTGTTTTCAAAAATGTAGAGTGG - Intergenic
1063334430 10:5198327-5198349 CTGTTTTCAAAGTTGGAGCCTGG + Intronic
1063364252 10:5480258-5480280 CTCATTTGCAAAATGGAGACAGG - Intergenic
1063919321 10:10916236-10916258 CTGGTCTCAAAAATGGTGACTGG + Intergenic
1064142494 10:12802447-12802469 CTGTCTTCAGAAATGCAGACTGG + Intronic
1065731937 10:28717454-28717476 CTTGTTTTAAAATTGGAAACTGG - Intergenic
1066283473 10:33941121-33941143 CTTTTTTAAAAAATAGAGACAGG - Intergenic
1067059607 10:43071180-43071202 CTGTTTCCAAAAATGGTGCCTGG + Intergenic
1067543248 10:47172989-47173011 CTTTTTTTAAAAAAGGAGACAGG + Intergenic
1068286159 10:54938868-54938890 CTGGCTTTGAAAATGGAGAAAGG + Intronic
1068380832 10:56251983-56252005 CTGGCTTCAAAAAAGGAGTCAGG + Intergenic
1068566602 10:58582769-58582791 CTGGCTTTAAAAATGGAGGAAGG - Intronic
1072629708 10:97136863-97136885 CTGATATTAACAATGGAGACAGG + Intronic
1074337648 10:112594205-112594227 CAAGTTTAAAAGATGGAGACCGG - Intronic
1074918335 10:117981021-117981043 CTGGTTTCAGGAATGAAAACTGG + Intergenic
1076238616 10:128884727-128884749 TAGGTTTCAAAAATGCAGAAAGG + Intergenic
1076291034 10:129345900-129345922 CTGTTTTGAAGAGTGGAGACTGG - Intergenic
1078352922 11:10609625-10609647 CTGGGTTCAAGAATTAAGACTGG + Intronic
1079790852 11:24737595-24737617 CTCTTTTTAAAAAGGGAGACAGG + Intronic
1084380527 11:68809625-68809647 CTGCCTTCAAAAGTGGAGTCAGG - Intronic
1085261304 11:75206441-75206463 ATGGTTTCAAAAATGGAATAAGG + Exonic
1087342573 11:96926633-96926655 ATGCTTACAAAATTGGAGACTGG + Intergenic
1087686046 11:101266372-101266394 CTGGCCTCAGAAATGGAGTCTGG + Intergenic
1088081743 11:105925029-105925051 TTGGTTTGACAAATGGAAACTGG + Intronic
1088326455 11:108606032-108606054 CTTTTTTTAAAAATAGAGACAGG + Intergenic
1091318013 11:134629315-134629337 CTGGATTAAAAAATGGACAAAGG + Intergenic
1091459734 12:634913-634935 CTTTTTTAAAAAATAGAGACAGG + Intronic
1091497631 12:986233-986255 CTTGTTTTTAAAATAGAGACAGG + Intronic
1092439734 12:8489301-8489323 TTGATTTAAAAAATGGAGAAAGG + Intergenic
1093516335 12:19990874-19990896 CTGGTTTTGAAGATGGAGAAAGG + Intergenic
1094728622 12:33148616-33148638 GTGGTTTCAAACATGGACTCTGG - Intergenic
1097674051 12:62578531-62578553 TTGGTTTCAAAAATGGTCACAGG - Intronic
1098872725 12:75834983-75835005 TTTGTTTCAAAAATGGAGAAAGG + Intergenic
1100713817 12:97284915-97284937 CTGAATTCAAAAATAGACACAGG + Intergenic
1100857544 12:98771477-98771499 CTTTTTTTAAAAATTGAGACAGG + Intronic
1101169767 12:102078633-102078655 CTCATTTCTAAAATGGAGATGGG + Intronic
1102061401 12:109934679-109934701 ATGGTTTAAAAAATGGGGAAAGG - Intronic
1102331440 12:112035184-112035206 CTGGTTTCTAAAAATGAGAATGG - Intronic
1102688913 12:114745106-114745128 GGGCTTTCAGAAATGGAGACAGG + Intergenic
1103598614 12:122039869-122039891 CTGTATTCAAAAATAGAGACAGG + Intronic
1104701220 12:130905625-130905647 CTGTTTTCAAAAATACAGATGGG + Intergenic
1106024256 13:25941696-25941718 CTGGTTTAAAGAATGGACACAGG - Intronic
1106298714 13:28442335-28442357 CTGTTTTCAACAAAGGACACTGG + Intronic
1108268277 13:48733696-48733718 CTGGCTTTGAAAATGGAGAAGGG + Intergenic
1108929371 13:55796625-55796647 CTGGTTTCAAAAAATGAGTTTGG + Intergenic
1109364783 13:61340210-61340232 CTGACTTCAAAAATGAAGCCAGG - Intergenic
1111238158 13:85436293-85436315 TTGGTTCCAGAAATGGAGTCAGG + Intergenic
1112884180 13:104148021-104148043 CTGATTTTAAAAGTGGGGACAGG - Intergenic
1114370451 14:22081661-22081683 CTTTTTTCAAAATTGGAGTCAGG + Intergenic
1116043117 14:39710046-39710068 CTGGAGTTAAAAATGGAGAAAGG - Intergenic
1116596543 14:46855531-46855553 CTGGTTTCCAAGATGGAGGAAGG + Intronic
1116968314 14:51038242-51038264 CTGGTTTTGAAAATGGAGGAAGG + Intronic
1117319705 14:54609268-54609290 CTGACTTCAAAGATGGAGAAAGG + Intronic
1119919171 14:78430230-78430252 CATTTTTCAAAAATTGAGACAGG - Intronic
1122459883 14:101885660-101885682 CTCGTTTGTAAAATGGAGCCCGG + Intronic
1123690232 15:22832648-22832670 CTGGCTTCAAAGATGGAGGAAGG - Intergenic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1125221024 15:37335645-37335667 ATGGTTTCAGAAATGCAGACTGG + Intergenic
1127471110 15:59291136-59291158 CTGGTTGCAAAAATGCTGAAAGG + Intronic
1130177570 15:81590966-81590988 CTGACTTCAAGAATGGAGCCAGG - Intergenic
1130616574 15:85414895-85414917 CTGTTTTCTAAAATGGATTCTGG + Intronic
1130630996 15:85569081-85569103 GTGGTTTCATAAATGGAAATAGG + Intronic
1130990751 15:88874304-88874326 CTGGTTTCCACAAGGGAGAGAGG + Intronic
1131292402 15:91118182-91118204 ATGCTTGCAAAAAGGGAGACAGG + Intronic
1133384192 16:5355510-5355532 CTGGGTTTAAAAATGGAGACTGG + Intergenic
1133481263 16:6172979-6173001 CTGGCTTCGAAGATGGAGAAAGG - Intronic
1134034594 16:11020170-11020192 CTGGAAGCCAAAATGGAGACTGG - Intronic
1134422144 16:14103565-14103587 CTGATTTCAGCAATGGAAACAGG - Intronic
1134869229 16:17636726-17636748 TTGTTTTCAAAAATGTACACAGG - Intergenic
1134912178 16:18037632-18037654 CTGGGTTCCAAAATGGAATCAGG + Intergenic
1135948666 16:26890875-26890897 CTTTTTTAAAAAATTGAGACAGG + Intergenic
1136239578 16:28936048-28936070 CTTGGTTCAACAAAGGAGACAGG - Intronic
1137339564 16:47587207-47587229 CTGGATTAAAATATGAAGACAGG - Intronic
1137428602 16:48400296-48400318 TTGGCTTTGAAAATGGAGACAGG - Intronic
1140146445 16:72315518-72315540 CTGGTTTCAGAAATAGAGTTTGG + Intergenic
1140210608 16:72966910-72966932 GTGGCTTCAAGAATGGAGAAGGG + Intronic
1140766448 16:78163840-78163862 GTGATTTCAAAGATGAAGACTGG - Intronic
1140928871 16:79608947-79608969 CTGGCTTCAAAATTGGCGTCAGG - Intergenic
1141235656 16:82213565-82213587 CTGGCTTCAAAGATGGAGGAGGG + Intergenic
1141455558 16:84139400-84139422 CTGGTTTCGATAATAGAGAGAGG + Intronic
1142189196 16:88709827-88709849 CTGCTTTTAAAGATGGAGATTGG + Intronic
1143965032 17:10750955-10750977 GTGGTTTTAAAAAGGGAGAGGGG + Intergenic
1144342806 17:14324155-14324177 CTGTTTTTACACATGGAGACAGG + Intronic
1144806869 17:17973643-17973665 TTATTTTTAAAAATGGAGACAGG + Intronic
1147495406 17:40910921-40910943 TTGCTCTCAAAAATGGAGAGGGG - Intergenic
1148557106 17:48585258-48585280 CGGGTGTCAAAAATGAAGAAGGG - Intronic
1149313621 17:55420303-55420325 CTGATGTCAGAAATGAAGACCGG - Intronic
1149668690 17:58385808-58385830 CTCGTTTTAAAAATGGAGGCTGG + Intronic
1150584463 17:66504971-66504993 GTGGTTTCAGAAATGGACTCGGG - Intronic
1151532588 17:74716215-74716237 CTGCTTTCACATATGGGGACAGG - Intronic
1151659433 17:75510899-75510921 ATTGTTTCAAAAGTGCAGACTGG - Intronic
1152508148 17:80766353-80766375 CTTTTTTAAAAAATAGAGACAGG + Intronic
1155721005 18:29012135-29012157 CTTATTTCAAAAATGGAAATTGG - Intergenic
1157382890 18:47235988-47236010 CTTGTCTCAAAAAGGGAGACAGG - Intronic
1158203989 18:54970676-54970698 ATCATTTCAAAAATGGAGAAAGG + Intergenic
1158350594 18:56561642-56561664 CTGGTAACAAAAATAGAAACTGG + Intergenic
1158700613 18:59742536-59742558 CTGGTTTACATAATGTAGACCGG + Intergenic
1160125794 18:76170162-76170184 CTGTTTTCAGAAAATGAGACTGG + Intergenic
1161428020 19:4215188-4215210 CTAGTTTTAAAAATGGGGGCAGG + Intronic
1162636011 19:11967703-11967725 CTTTTTTTAAAAATAGAGACAGG - Intronic
1162707228 19:12564193-12564215 CTGGTACCAAAAAAGGAAACTGG + Intronic
1162877068 19:13628298-13628320 CTCCTTTTAAAAATAGAGACAGG - Intergenic
1163297253 19:16420413-16420435 TTGGTTTCTAAAAGGGACACTGG + Intronic
1163399771 19:17085242-17085264 CTGGTTTCTACAAAGGACACAGG - Intronic
1165167661 19:33868435-33868457 CGGCTTTCAAAACTGGGGACTGG - Intergenic
1166400993 19:42479897-42479919 CTGGTTTCAAAGATGGAAAAGGG - Intergenic
1166671441 19:44711807-44711829 TTATTTTCAAAAATAGAGACGGG - Intergenic
1167462508 19:49633299-49633321 CTGTCTACAAAAATAGAGACAGG - Intergenic
1167639753 19:50674335-50674357 CTGGTCTCAAAGATGGAGAAGGG - Intronic
1168082653 19:54021551-54021573 CTAGTTCCAAGAATGGACACAGG - Intergenic
1168465968 19:56601437-56601459 CTGGCCTCACAAATGTAGACAGG - Intronic
926192861 2:10741609-10741631 CTGCTTTCACGGATGGAGACTGG + Intronic
926516679 2:13854938-13854960 CACATTTCAAAAATGGTGACAGG - Intergenic
927399265 2:22692046-22692068 CTGGCTTCCAAAGTGGAGAATGG - Intergenic
928583235 2:32729819-32729841 ATAATGTCAAAAATGGAGACAGG - Intronic
929840610 2:45458654-45458676 CTGTTTTCAAAAATGTAGTAAGG - Intronic
931040815 2:58297515-58297537 CTGATTTTGAAAATGGAGACTGG - Intergenic
931138287 2:59428921-59428943 CTGATTTTTAAAATGGAAACAGG - Intergenic
931359397 2:61565298-61565320 TTAGTTTCTAAAATTGAGACAGG - Intergenic
933558926 2:83867533-83867555 CTGGTTTCACCAATGTATACAGG - Intergenic
935555360 2:104503754-104503776 CTGGTCTCAATGATGGTGACTGG - Intergenic
936972065 2:118185716-118185738 TTGGTTTAAAAAAGGGAGAGGGG + Intergenic
937956507 2:127424665-127424687 CTTTTTTTAAAAATAGAGACAGG - Intronic
938178859 2:129161943-129161965 CTGGTCTCAAAAATGAAAAGAGG + Intergenic
938708197 2:133952207-133952229 CTCGTCTCCAAAATGGACACAGG + Intergenic
938827485 2:135020323-135020345 CTTTTTTAAAAAATTGAGACAGG + Intronic
939041782 2:137198268-137198290 CTCCTTTCAAAATTGGAGAAGGG - Intronic
939413152 2:141857635-141857657 CAGTTTTCTAAAATGGAGAGGGG - Intronic
941614842 2:167707559-167707581 CTGGTTTTCAAGATGGAGAAAGG - Intergenic
941620345 2:167770918-167770940 CTGCTATCGAAAATGGAGATAGG - Intergenic
941812933 2:169771906-169771928 CTGGTTTCAAACAGGAAGATGGG + Intronic
944252116 2:197588926-197588948 ATGGTTTTAAAAATGGGGCCAGG + Intronic
944862514 2:203828512-203828534 CTGGCTTTGAAAATGGAGAAAGG - Intergenic
948373245 2:237504002-237504024 CTGGTTTTGAAGATGGAGAAAGG + Intronic
1169085301 20:2822374-2822396 TTGCTTTAAAAAATGGAGGCTGG - Intergenic
1170172396 20:13429972-13429994 CTGGGAGCAATAATGGAGACGGG + Intronic
1173646594 20:44637104-44637126 CTGCTTTTGAAAATGGAGCCTGG - Intronic
1174510654 20:51049567-51049589 CTGGTTTAAATAATGGACAAAGG + Intergenic
1174598236 20:51701987-51702009 CTTTTTTAAAAAATAGAGACAGG - Intronic
1174816038 20:53688056-53688078 CTACTTTAAAAAATAGAGACGGG + Intergenic
1174990356 20:55502335-55502357 CTGGTTGAAAAAAAGGAGAAAGG + Intergenic
1175897425 20:62345410-62345432 CTTGTTTCAAAAAAGAAAACTGG - Intronic
1176697705 21:10000699-10000721 CTCATTTCAAAAATGGAGGAAGG - Intergenic
1176930934 21:14809293-14809315 TTTTTTTTAAAAATGGAGACTGG + Intergenic
1177362303 21:20088526-20088548 TTGGTTATAGAAATGGAGACAGG + Intergenic
1177837230 21:26197898-26197920 CAGCTTTCAAAAATGAAGAGAGG + Intergenic
1177914273 21:27068879-27068901 CTGGCTTTAAAAATGGAGGAAGG + Intergenic
1178590499 21:33905439-33905461 CTGGTTTCAAATATTGGGGCTGG - Intronic
1178725509 21:35048018-35048040 CTGGTTTCAAAAATGGAGACAGG + Intronic
1179975513 21:44863466-44863488 CTGGGTTCAGAACTGGAGTCAGG + Intronic
1180206864 21:46266129-46266151 CTGGTTCCAGGAATGCAGACCGG + Exonic
1181292087 22:21803430-21803452 CTAGTTTAAAAAATGGACAAAGG - Intronic
1181429877 22:22872808-22872830 CTGGGTACAGACATGGAGACAGG + Intronic
1181729801 22:24836754-24836776 CTGAATTCAAAAATGGACAAAGG - Intronic
1184857085 22:47152260-47152282 ATGGGTTCAAAAATCCAGACTGG + Intronic
1185009253 22:48304070-48304092 CTGGTTTTAAAAATATAAACAGG - Intergenic
1185221098 22:49629644-49629666 CTGGGTTCAAACAGGGAGGCTGG + Intronic
1185221119 22:49629708-49629730 CTGGGTTCAAACAGGGAGGCTGG + Intronic
949583624 3:5415005-5415027 CTGATTAAAAAAATGCAGACTGG + Intergenic
952240631 3:31528550-31528572 CTGGTTTCAAAAGCACAGACAGG - Intergenic
952913437 3:38210723-38210745 CTGCCTCCAAAAATGTAGACAGG - Intronic
953804893 3:46060276-46060298 CAGGTTTCAGAAATGAAGATTGG - Intergenic
955278955 3:57575151-57575173 CTTGTTTTAAAAGTGGAGATGGG - Intronic
955485015 3:59426427-59426449 CTGTCTTCAAAGATGGAGAAAGG - Intergenic
956456236 3:69423152-69423174 CTTTTTTGAAAAATAGAGACAGG + Intronic
956466691 3:69526765-69526787 CTTATTTGTAAAATGGAGACAGG - Intronic
957171887 3:76748105-76748127 CTGGTTTCAAAAATAATGAATGG - Intronic
957238618 3:77627781-77627803 TTGGTTGAAAAAATGGAGAATGG + Intronic
957665539 3:83219865-83219887 CTCATTTTAAAAATGGGGACCGG - Intergenic
957668798 3:83273308-83273330 CTGGTTTCAAGAATGGTCTCAGG - Intergenic
957882184 3:86232279-86232301 CAGTTTTTAAAAATAGAGACAGG - Intergenic
959629165 3:108489088-108489110 CTGGATTAAAAAATGGATAAAGG - Intronic
960699764 3:120428424-120428446 CTTGTTTTTAAAGTGGAGACTGG - Intronic
961438614 3:126937099-126937121 CTTGTGTTTAAAATGGAGACAGG - Intronic
963353759 3:144184619-144184641 CTTGTTTCAAACATGAAGAAGGG + Intergenic
963844022 3:150136705-150136727 CTGAAGTCAAAAATGGAGAAGGG + Intergenic
964956945 3:162371043-162371065 CTGGTTTCAGAGATGCAGAGGGG - Intergenic
965169935 3:165250001-165250023 ATGGTGTCAGAAATGGGGACTGG - Intergenic
965201947 3:165670539-165670561 CAGGTGTCTATAATGGAGACAGG - Intergenic
966308667 3:178568404-178568426 GTGGTTTCAAAAAGGGAAACAGG - Intronic
966482058 3:180421408-180421430 CTGGCTTCAAAGATGGAGTAAGG + Intergenic
967325707 3:188236997-188237019 CTTCTTTCAAAATTGGAGTCAGG + Intronic
967527579 3:190513108-190513130 GGGGTTTCAGAAATGGGGACAGG + Intergenic
967776226 3:193388810-193388832 GTGGTTACAAAGATGGAGAATGG + Intergenic
968811065 4:2799869-2799891 CTGGTTTTGAAAAGGGAGAGGGG + Intronic
968844906 4:3035591-3035613 CTTTTTTCAAAAATAGAGATGGG + Intronic
969257684 4:6013710-6013732 CTGGGTCCAAAGATGGAGGCGGG + Intergenic
970573029 4:17401241-17401263 CTGGCTTCAAAGATGGAGGAAGG - Intergenic
970724792 4:19031052-19031074 CTGTTTTGTAAAATGGAGATGGG + Intergenic
970731405 4:19107932-19107954 CTGGTTTCAAAGATGGAAAGGGG + Intergenic
970743224 4:19263007-19263029 CTACTTTTAAAAATGGAGAAAGG - Intergenic
972056596 4:34810257-34810279 CTTTTTCCAAAAATTGAGACTGG + Intergenic
972613816 4:40679446-40679468 CTGGTTAGAACACTGGAGACAGG - Intergenic
973318970 4:48790506-48790528 CTGGTTGCAAAACTTGAGAGAGG - Intergenic
973611442 4:52639436-52639458 TTGGTTCCAAAGATGGAAACTGG - Intronic
973989853 4:56393262-56393284 CTGGTGCCAAGAATGGAGCCTGG + Intergenic
974618572 4:64324471-64324493 TTTATTTCAAAAATAGAGACTGG - Intronic
976904581 4:90220889-90220911 TTTATTTCAAAAATGGAGAAGGG - Intronic
979202988 4:118001532-118001554 ATGGTTTGAACAATGGATACAGG - Intergenic
979343996 4:119563796-119563818 CTGTTTGTAAAAATGGGGACTGG + Intronic
979390362 4:120120103-120120125 ATGATTTCAGAAATGGAGTCTGG + Intergenic
980373659 4:131913401-131913423 CTGACTTCAAGAATGGAGTCAGG + Intergenic
981575540 4:146200696-146200718 CTGGTTTTAAAAAGGAAGAAAGG + Intergenic
982376403 4:154695798-154695820 CTGGTTACAGAAATGGGGAATGG - Intronic
982392696 4:154883145-154883167 CTAGCTTCTAAAATAGAGACTGG - Intergenic
982716346 4:158812505-158812527 CTGGTTTAAAAATTTGTGACAGG - Intronic
984484551 4:180351923-180351945 CTGATGTCTAAAATGGAGATGGG - Intergenic
984823157 4:183901757-183901779 CTAGATTCAAAAATGGACAAAGG - Intronic
987211159 5:15684741-15684763 CTAGCTTTAAAAATGGAGAAGGG + Intronic
989269605 5:39516726-39516748 TTTCTTTCAAAATTGGAGACTGG - Intergenic
991718257 5:69472293-69472315 CTATTTTAAAAAATAGAGACAGG + Intergenic
992884998 5:81149845-81149867 GTGTTTTCAAAAATCAAGACTGG - Intronic
993344249 5:86762840-86762862 CCTTTTTAAAAAATGGAGACAGG - Intergenic
993433494 5:87861922-87861944 CTGGCTTCAAAAATGGAGGAAGG - Intergenic
996456775 5:123693593-123693615 CTTATTTAAAAAATAGAGACAGG + Intergenic
996488611 5:124066100-124066122 CCCGATTCAAAAATGGTGACAGG - Intergenic
996569797 5:124920305-124920327 CGGGTTTTAATAATGGATACAGG + Intergenic
997497367 5:134340841-134340863 CTGGTTTTAAAAAATGAGATGGG - Intronic
997623340 5:135314861-135314883 CTGGGTTCAAAAAGGGAGAGAGG - Intronic
998534373 5:142915770-142915792 CTGGGGTCAAAAAAGGAGAAAGG - Intronic
998896473 5:146805388-146805410 CTGTTTTCAAAAGTAGAGAAAGG + Intronic
1001680978 5:173556653-173556675 CTGATTTCAGAGATGCAGACAGG + Intergenic
1003010769 6:2425347-2425369 CTGATTTTAAAAATGGACAAAGG - Intergenic
1006083145 6:31579097-31579119 CTTTTTTAAAAAATAGAGACAGG - Intergenic
1008301518 6:49846562-49846584 CAAGTTTCAAACATGGAGAATGG - Exonic
1009042614 6:58197806-58197828 CTGGTTGCAAAATTGGAAATTGG + Intergenic
1009443912 6:63716737-63716759 CTGGCTTCAAATATGGAGGAAGG - Intronic
1009572424 6:65404162-65404184 CTGGTTTTAAAGATGGAGGAAGG - Intronic
1009976704 6:70678761-70678783 CTAGTTTCAAAGATGGAGGAAGG - Intronic
1010658305 6:78538805-78538827 CTGGGAACAAAAATGGAGGCAGG + Intergenic
1012020455 6:93911558-93911580 CTGGTTTCAAAAATGTAATTTGG + Intergenic
1012170539 6:96012466-96012488 CTGGTTACAACAATGGATTCAGG - Intergenic
1012432505 6:99179672-99179694 CTGGTGTCAAAAATGAAGCAAGG - Intergenic
1013047397 6:106500492-106500514 CTGATTTAAAAAATGGAAAAAGG - Intergenic
1013317322 6:108955199-108955221 AAGGTTTTAAAAATGGAGGCTGG + Intronic
1013782019 6:113739217-113739239 CAAGCTTGAAAAATGGAGACCGG + Intergenic
1014512571 6:122342212-122342234 CTGGCTTCACAGATGGAGAATGG + Intergenic
1015025522 6:128527750-128527772 CTTATTTGAAAAATGGAGAAGGG + Intergenic
1016194076 6:141310348-141310370 CTGGTTTCAAAGATGTAAACTGG - Intergenic
1016679347 6:146810126-146810148 CTGGTTTTAAAAATGGGCAAAGG + Intronic
1017276372 6:152573576-152573598 CTGTTTTCAAAATTAGAGAATGG - Intronic
1017578822 6:155837518-155837540 ATGTTTTCAAAACTGGATACAGG - Intergenic
1018017308 6:159724161-159724183 ATTTTTTAAAAAATGGAGACAGG + Intronic
1020966867 7:14881324-14881346 ATTGCTTCAAAAATGGTGACAGG - Intronic
1021291171 7:18847286-18847308 CTTGTTTAAAAAATGGAAATTGG - Intronic
1021892663 7:25201546-25201568 CTTCTTTCAAAAATGAAGGCAGG - Intergenic
1021910934 7:25385545-25385567 CAGTTTACAAAAATGGAGAAGGG - Intergenic
1022532018 7:31072920-31072942 CTGGTTTCAAAGAGGGAGGAAGG + Intronic
1022895887 7:34750136-34750158 TTTTTTTCAAAAAAGGAGACAGG + Intronic
1023803683 7:43856096-43856118 CTGGCTTTGAAAATGGAGGCAGG + Intergenic
1024402614 7:48942647-48942669 CTGGTTATAAAACTGGAGAGGGG + Intergenic
1024909842 7:54434599-54434621 CTGATTTAAGAAATGGAGATTGG + Intergenic
1026114073 7:67481497-67481519 CTGGTTTCAAAAAGTTAGGCTGG - Intergenic
1026650645 7:72213259-72213281 CTGGCCTCAAAGCTGGAGACAGG + Intronic
1028163300 7:87509964-87509986 CTGGTTTTGAAAATGGAGGAAGG + Intronic
1028448317 7:90950650-90950672 CTGGTTAGAAAATTGGAGACAGG + Intronic
1029991838 7:104969462-104969484 CTGGTTTGAAAAATGGAAATGGG + Intergenic
1031351068 7:120731615-120731637 TTGGTTTTAAAAATGGAGATTGG - Intronic
1031755723 7:125639399-125639421 CTGGTCTGAAATAAGGAGACTGG + Intergenic
1032479884 7:132237754-132237776 CTTGTTTCAAAGAGGGAGAACGG - Intronic
1033184254 7:139211658-139211680 CTGGTGTCAAAAATGCAAATAGG + Intergenic
1033349213 7:140548514-140548536 CAGTTTTTAAAAATAGAGACTGG - Intronic
1035283299 7:157791309-157791331 CTGTTTTCAAACATGGAATCGGG - Intronic
1036290872 8:7488949-7488971 CTGATTTAAAAAATGTAGTCAGG + Intronic
1036330618 8:7822588-7822610 CTGATTTAAAAAATGTAGTCAGG - Intronic
1036678367 8:10852910-10852932 CTGGTCTCACAAATGAAGAAGGG - Intergenic
1037644375 8:20777567-20777589 TTGGCTTCAAAAATGGAGGAAGG + Intergenic
1039156859 8:34569794-34569816 CTGGTTTCAAAAATGTACACAGG + Intergenic
1040487784 8:47890448-47890470 CTGCTTTCAAAAGTGAAGACTGG + Exonic
1041796118 8:61750650-61750672 CTGGTGTCTGAAATGGGGACTGG + Intergenic
1044020411 8:87099180-87099202 GTTGTTTTAAAAATGGAGAAAGG + Intronic
1045364745 8:101465322-101465344 CCAGATTCAAAAATGGAGAAAGG + Intergenic
1045456587 8:102386101-102386123 CTGGCTTCAAAAATGAACAGTGG + Intronic
1045559762 8:103249529-103249551 CTTTTTTAAAAAATGGGGACAGG + Intergenic
1046759044 8:118001708-118001730 CTGGTTTATAAAATATAGACTGG - Intronic
1047356323 8:124125548-124125570 CTGGCTTTGAAAATGGAGAAAGG - Intergenic
1047738094 8:127784214-127784236 CTGGTCTCCAACCTGGAGACAGG + Intergenic
1048420080 8:134269594-134269616 CTGGTTTCACAAATGAGGGCTGG - Intergenic
1048972291 8:139651941-139651963 CTGGTCTCAAAAATGGTGATGGG - Intronic
1049277776 8:141728489-141728511 ATGTTTTCAAAAAAGGAGCCTGG - Intergenic
1049489297 8:142885443-142885465 CTGGATTAAAAAATGGACAAAGG - Intronic
1050127893 9:2378442-2378464 CTGGCTTTAAAGATGGAGAAAGG + Intergenic
1051478141 9:17531233-17531255 CTGGTGACAAAAATTGACACAGG + Intergenic
1052795094 9:32916120-32916142 CTGGGTGCTGAAATGGAGACTGG - Intergenic
1055705433 9:78995422-78995444 CTTGCCTCAAAAATGGACACAGG - Intergenic
1055927223 9:81523083-81523105 CTTGTTTCAAATATGGAGAGAGG - Intergenic
1056424148 9:86459708-86459730 ATATTTTCAAAAATGGAAACTGG + Intergenic
1056483716 9:87032964-87032986 CTGGTTAGAAAAATGGAAATAGG + Intergenic
1058815335 9:108677906-108677928 ATGCTTTCAAAATGGGAGACGGG + Intergenic
1061666773 9:132164617-132164639 CAGGTTGCAAAAATAGACACCGG + Intronic
1186621912 X:11250621-11250643 CCGGCTTCAAAGATGGAGAAAGG - Intronic
1189170740 X:38906932-38906954 CTTTTTTTAAAAATAGAGACAGG - Intergenic
1190341751 X:49302515-49302537 CTATTTTTAAAAATCGAGACAGG + Intergenic
1192115525 X:68406899-68406921 ATGGTTTCTAAAATAGATACTGG + Intronic
1193203800 X:78724092-78724114 GTGGTTGCAAGAATGCAGACTGG + Intergenic
1193767781 X:85551933-85551955 CTAATTTCAAAAATGGACAAAGG - Intergenic
1194861383 X:99002832-99002854 CTGGTTTTGAAAATGGAGGGAGG + Intergenic
1198057336 X:133008057-133008079 CTGGCTTCAAATATGGAGGATGG - Intergenic
1198207748 X:134483996-134484018 CTTTTTTAAAAAATAGAGACAGG - Intronic
1198638559 X:138728369-138728391 CTGGTATCCAAATTGGAGACTGG + Intronic