ID: 1178728693

View in Genome Browser
Species Human (GRCh38)
Location 21:35079005-35079027
Sequence TGCCATGCCAAGACATGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 194}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178728693_1178728702 6 Left 1178728693 21:35079005-35079027 CCAGCCCATGTCTTGGCATGGCA 0: 1
1: 0
2: 2
3: 10
4: 194
Right 1178728702 21:35079034-35079056 TGGGACTGGGCATCTACTCTGGG 0: 1
1: 0
2: 0
3: 14
4: 128
1178728693_1178728703 13 Left 1178728693 21:35079005-35079027 CCAGCCCATGTCTTGGCATGGCA 0: 1
1: 0
2: 2
3: 10
4: 194
Right 1178728703 21:35079041-35079063 GGGCATCTACTCTGGGCTAGAGG 0: 1
1: 0
2: 0
3: 6
4: 123
1178728693_1178728704 14 Left 1178728693 21:35079005-35079027 CCAGCCCATGTCTTGGCATGGCA 0: 1
1: 0
2: 2
3: 10
4: 194
Right 1178728704 21:35079042-35079064 GGCATCTACTCTGGGCTAGAGGG 0: 1
1: 0
2: 0
3: 12
4: 139
1178728693_1178728698 -8 Left 1178728693 21:35079005-35079027 CCAGCCCATGTCTTGGCATGGCA 0: 1
1: 0
2: 2
3: 10
4: 194
Right 1178728698 21:35079020-35079042 GCATGGCATAGCCTTGGGACTGG 0: 1
1: 0
2: 4
3: 13
4: 120
1178728693_1178728699 -7 Left 1178728693 21:35079005-35079027 CCAGCCCATGTCTTGGCATGGCA 0: 1
1: 0
2: 2
3: 10
4: 194
Right 1178728699 21:35079021-35079043 CATGGCATAGCCTTGGGACTGGG 0: 1
1: 0
2: 2
3: 10
4: 145
1178728693_1178728701 5 Left 1178728693 21:35079005-35079027 CCAGCCCATGTCTTGGCATGGCA 0: 1
1: 0
2: 2
3: 10
4: 194
Right 1178728701 21:35079033-35079055 TTGGGACTGGGCATCTACTCTGG 0: 1
1: 0
2: 0
3: 5
4: 106
1178728693_1178728705 28 Left 1178728693 21:35079005-35079027 CCAGCCCATGTCTTGGCATGGCA 0: 1
1: 0
2: 2
3: 10
4: 194
Right 1178728705 21:35079056-35079078 GCTAGAGGGCATTGCCAAACTGG 0: 1
1: 0
2: 0
3: 4
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178728693 Original CRISPR TGCCATGCCAAGACATGGGC TGG (reversed) Intronic
900270952 1:1788362-1788384 TGCTCTGCCAAGGCCTGGGCTGG + Intronic
900487305 1:2929270-2929292 TGTCATGCCAGGGCTTGGGCTGG + Intergenic
902079469 1:13811473-13811495 TGCCATCCCTGGACAGGGGCCGG + Intronic
905370726 1:37481426-37481448 TGCCACGCCAAGGGAGGGGCTGG + Intronic
905861712 1:41356408-41356430 TGCCATGTGAAGACACAGGCGGG + Intergenic
908161202 1:61410161-61410183 TGCCATGTGAAGACATGGGAGGG + Intronic
908777000 1:67649997-67650019 TGCCATGCTCTGACATTGGCTGG + Intergenic
909040956 1:70650856-70650878 TGACATGCCAAGTAATGGGAAGG - Intergenic
913958706 1:143323498-143323520 TGCCAGGGCAAGACCAGGGCAGG + Intergenic
914053023 1:144148878-144148900 TGCCAGGGCAAGACCAGGGCAGG + Intergenic
914126174 1:144817663-144817685 TGCCAGGGCAAGACCAGGGCAGG - Intergenic
916549223 1:165833328-165833350 TGCCATGCCAAGAGTGGGTCTGG - Intronic
917299542 1:173559290-173559312 TGCCTTTCCAAGACAGGGTCTGG + Intronic
918240524 1:182616322-182616344 TGCAATGCAAAGAAATGGGGTGG - Intergenic
919817278 1:201449336-201449358 TGCCACTCCAGGAGATGGGCTGG - Intergenic
921633547 1:217464330-217464352 TGCCATATCAACACCTGGGCAGG + Intronic
1066758964 10:38737090-38737112 TGCCAGGGCAAGACCAGGGCAGG - Intergenic
1066962665 10:42235679-42235701 TGCCAGGGCAAGACCAGGGCAGG + Intergenic
1067148667 10:43711878-43711900 TGCTATGCCAAGAGGTGGGCAGG + Intergenic
1068629537 10:59285137-59285159 TGCCATGCCTGGAGATGGGGTGG + Intronic
1073079364 10:100848758-100848780 CACAATGCCAAGCCATGGGCAGG + Intergenic
1075556751 10:123438283-123438305 TGCCATGGGAAGACAGGGACAGG + Intergenic
1076527990 10:131124379-131124401 TGCGGTGCCAAGACAAAGGCTGG - Intronic
1077154104 11:1083865-1083887 TGCCCTTCCAGGCCATGGGCCGG - Intergenic
1080013699 11:27483232-27483254 AGCCATGCTCAGTCATGGGCTGG + Intergenic
1085231222 11:74972554-74972576 TGCCACGCCAGGCCCTGGGCTGG - Intronic
1086902658 11:92385266-92385288 TGGCATCCCAGGAAATGGGCTGG + Intronic
1088922015 11:114266548-114266570 AGCCATGCAAAGATATGGGGTGG - Intronic
1088933903 11:114379474-114379496 TTGCATGCCAAGGCAGGGGCGGG - Intergenic
1089401380 11:118166523-118166545 TGCCAGGCCAAGCACTGGGCAGG + Exonic
1089973298 11:122711539-122711561 TGCCTTGCAAGGACATGTGCCGG + Intronic
1090881204 11:130832612-130832634 TGCCAGGCCCAGAGCTGGGCTGG - Intergenic
1090944716 11:131419712-131419734 TGCAATGGCAAGACATTGGAGGG + Intronic
1091005883 11:131953170-131953192 TGCCATGGCAACAGATGGTCCGG - Intronic
1101431523 12:104631498-104631520 TCCCATGCCCAGAGATGGGAAGG + Intronic
1101617281 12:106350513-106350535 TGCCATGCTAAAATTTGGGCGGG + Intergenic
1102412660 12:112733595-112733617 TGCCATGCCCAGTCATTGACTGG + Intronic
1102432132 12:112891755-112891777 TGCCAGGCCCAGTCATTGGCTGG + Intronic
1104520220 12:129467418-129467440 TTCCATCCCAGGACATTGGCTGG - Intronic
1104669200 12:130668797-130668819 TGCCATGCCAAGCTATGCCCTGG + Intronic
1104952556 12:132448289-132448311 TGCGATGACAAGGCAGGGGCGGG - Intergenic
1108055598 13:46481939-46481961 TGCCATGTCCATACATTGGCCGG + Intergenic
1114696253 14:24630357-24630379 TGCCAGGGCATGAGATGGGCTGG + Intergenic
1119408608 14:74414021-74414043 GGCCAGGCCAAGCCAAGGGCAGG - Intronic
1119422712 14:74517042-74517064 TGCCATGCTGAGGCCTGGGCAGG + Intronic
1119437753 14:74609330-74609352 AGGCATGTGAAGACATGGGCTGG - Intronic
1122633095 14:103116809-103116831 TGCCATGCCAGCACCTGGGAGGG - Intergenic
1202929698 14_KI270725v1_random:26694-26716 TGCCAGGGCAAGACCAGGGCAGG - Intergenic
1124400538 15:29344150-29344172 GGCCAGGCCACGACCTGGGCTGG + Intronic
1125766584 15:42140626-42140648 GGCCAGGCCAAGACACAGGCTGG + Exonic
1126783967 15:52161668-52161690 TGCCAAGCCAAGACCCAGGCAGG - Intronic
1127991641 15:64123157-64123179 TACCATGCCAATATTTGGGCTGG - Intronic
1131114403 15:89785109-89785131 TGCCATGCCAGGCCTAGGGCGGG + Exonic
1131450999 15:92539863-92539885 TGCCACCCCAAGACGTCGGCTGG - Intergenic
1134285740 16:12860620-12860642 TGCCATGCCAAGGCCCAGGCTGG - Intergenic
1136186908 16:28593623-28593645 TGCCAAACCAAGAGATGAGCTGG - Intronic
1136189491 16:28607132-28607154 TGCCAATCCAAGAGATGAGCTGG - Intronic
1136723839 16:32342119-32342141 TGCCAGGGCAAGACCAGGGCAGG + Intergenic
1136773107 16:32858226-32858248 TGCCAGGGCAAGACCAGGGCAGG - Intergenic
1136897508 16:34003293-34003315 TGCCAGGGCAAGACCAGGGCAGG + Intergenic
1138657088 16:58497822-58497844 TCCCCTGCCAGGACCTGGGCAGG + Intronic
1139185094 16:64796856-64796878 GGCCATGCCAATACCTGGGGTGG + Intergenic
1139310356 16:66023346-66023368 AGCCATGCCAAAGCCTGGGCTGG - Intergenic
1140426796 16:74867855-74867877 TGACATGCCAAGACACGCCCGGG + Intergenic
1141267286 16:82508636-82508658 AGCCATGGCAAGACAGAGGCAGG + Intergenic
1141610820 16:85180249-85180271 TGCCCTGCCAAGCCAGGGCCCGG + Intronic
1203002592 16_KI270728v1_random:175646-175668 TGCCAGGGCAAGACCAGGGCAGG - Intergenic
1203075532 16_KI270728v1_random:1120336-1120358 TGCCAGGGCAAGACCAGGGCAGG - Intergenic
1203134198 16_KI270728v1_random:1712052-1712074 TGCCAGGGCAAGACCAGGGCAGG - Intergenic
1143114920 17:4576901-4576923 GGCCAGGCCAAGGCAGGGGCTGG - Intergenic
1144459343 17:15445578-15445600 TGCAATTCCAAAACAAGGGCAGG - Intronic
1144708747 17:17386750-17386772 TGACAGGCCAAGATCTGGGCGGG - Intergenic
1146510642 17:33445138-33445160 TGCAATCAGAAGACATGGGCTGG + Intronic
1147365644 17:39957423-39957445 TGCCTTCCCTAGCCATGGGCGGG - Intergenic
1148468151 17:47877307-47877329 TGCCATGCCCTGAGAGGGGCTGG + Intergenic
1151459936 17:74248442-74248464 TCACCTGCCAAGACATGGGGTGG - Intronic
1152013985 17:77737513-77737535 TGCCATGCCACGCCATGTGGGGG + Intergenic
1153728660 18:7983472-7983494 TGCCATGGCAGGACAGGGGCAGG - Intronic
1157110174 18:44813271-44813293 TGCCATGTAAAAACATGGGGAGG - Intronic
1160037985 18:75319059-75319081 CGCCATGCAAAGACAGAGGCGGG - Intergenic
1160495054 18:79368454-79368476 GGCCAGGCGCAGACATGGGCTGG - Intronic
1160585863 18:79913049-79913071 TGTCCAGCCAGGACATGGGCTGG - Intronic
1162529126 19:11225477-11225499 TCCCATGCCAGGAGATGGCCTGG - Intronic
1164526496 19:29017093-29017115 TGCCTGGCTCAGACATGGGCTGG + Intergenic
1164856809 19:31531237-31531259 TGCATGTCCAAGACATGGGCTGG - Intergenic
1165465455 19:35972100-35972122 CGCCCTGCCAAGATTTGGGCAGG + Intergenic
1165942942 19:39424358-39424380 TTCCATGCCAAGACAAAGGCTGG - Exonic
1166303059 19:41922892-41922914 TCCCATGCCCAGGCCTGGGCTGG + Intronic
1202692419 1_KI270712v1_random:101301-101323 TGCCAGGGCAAGACCAGGGCAGG + Intergenic
925973371 2:9123500-9123522 TGCCACTCCAAGGGATGGGCTGG + Intergenic
926061670 2:9808551-9808573 TGGCATGCCAAGCCTGGGGCTGG - Intergenic
928265328 2:29806572-29806594 TGCCAGGTGAGGACATGGGCAGG - Intronic
929657931 2:43752635-43752657 TGCCATGACAACACAGTGGCTGG - Intronic
931647113 2:64434037-64434059 TGCCATGCCAAGACACAAGAGGG + Intergenic
932044974 2:68339345-68339367 TGCCATGCCCAGAGAGGGTCTGG + Intergenic
932129369 2:69173935-69173957 TGCCTTGGCCAGACCTGGGCTGG + Intronic
933953979 2:87352670-87352692 TGCCAGGGCAAGACCAGGGCAGG - Intergenic
934238181 2:90248913-90248935 TGCCAGGGCAAGACCAGGGCAGG - Intergenic
934275017 2:91567820-91567842 TGCCAGGGCAAGACCAGGGCAGG + Intergenic
934460596 2:94212252-94212274 TGCCAGGGCAAGACCAGGGCAGG - Intergenic
934948823 2:98562489-98562511 TGCCGTGCCGGGACATGGCCTGG + Intronic
935716920 2:105947627-105947649 TGCCATGCCAAGGCTTCAGCTGG + Intergenic
937010625 2:118559835-118559857 TGCCCTGCCCAGCCATTGGCTGG - Intergenic
944438078 2:199712770-199712792 TGCCATGTGATGACAGGGGCAGG - Intergenic
944493076 2:200278139-200278161 TACCATGCCCAGTCATTGGCTGG - Intergenic
945154896 2:206828214-206828236 TGCAATGCAAAGATCTGGGCTGG - Intergenic
946290909 2:218744828-218744850 TCCCGTGACAAGACATTGGCTGG - Intronic
948657794 2:239487358-239487380 GGCGCTGCCAGGACATGGGCAGG + Intergenic
1168808618 20:688402-688424 TGACGTGCCAGGACCTGGGCTGG + Intergenic
1169455885 20:5752097-5752119 TGCCATGACTAGAGATGGGCTGG + Intronic
1170427665 20:16251461-16251483 TGCCAGGGCAAGTCTTGGGCAGG - Intergenic
1171401129 20:24873556-24873578 TGCCATGACCAGACAGGGGCAGG - Intergenic
1174015796 20:47487200-47487222 TGCAATGCAAATACAAGGGCAGG - Intergenic
1175049088 20:56136662-56136684 GGCCATGCTATGACATGGCCAGG + Intergenic
1176591720 21:8655293-8655315 TGCCAGGGCAAGACCAGGGCAGG - Intergenic
1177725104 21:24956600-24956622 AGCCATGCCAAGACATTTTCTGG + Intergenic
1178728693 21:35079005-35079027 TGCCATGCCAAGACATGGGCTGG - Intronic
1178757235 21:35363414-35363436 TGTCATGCGAAGACACAGGCAGG + Intronic
1180274568 22:10632405-10632427 TGCCAGGGCAAGACCAGGGCAGG - Intergenic
1180549050 22:16527349-16527371 TGCCAGGGCAAGACCAGGGCAGG - Intergenic
1180713846 22:17858288-17858310 TGCCATGACCTGACCTGGGCAGG + Intronic
1181355650 22:22294503-22294525 TGCCAGGGCAAGACCAGGGCAGG + Intergenic
1183106221 22:35617176-35617198 TGACATCCCAGGCCATGGGCAGG - Exonic
1183383951 22:37504303-37504325 TGCAATGCCATGACAGGGCCTGG + Intronic
1184246868 22:43240327-43240349 TGCCATGGCAGGAGATGGGAGGG - Intronic
1184677159 22:46050018-46050040 TGTCCTGCCAAACCATGGGCAGG + Exonic
1185392765 22:50571536-50571558 GGCACTGCCAAGACATGGGAAGG + Exonic
949810208 3:7999504-7999526 TTGCATTCCAAGACATGGGGAGG + Intergenic
949865915 3:8547247-8547269 TCCCACACCATGACATGGGCTGG + Intronic
950102058 3:10363483-10363505 CACCATGCCAAGAAATGTGCTGG - Intronic
950635389 3:14310887-14310909 TCCCATGCCAACACGTGGCCTGG + Intergenic
951861135 3:27253948-27253970 TGGCATGCCAGGGCGTGGGCTGG - Intronic
952907484 3:38151635-38151657 AGCCATGCAAAGTCATGGGCAGG - Intergenic
957591864 3:82209606-82209628 TGCCATGCTAAGACATTGGCTGG - Intergenic
961006100 3:123406349-123406371 TGCCATGCCATGCCATGCGGGGG - Intronic
961564472 3:127753904-127753926 TCCCATGCCAAGTCAAGGGTGGG - Intronic
962416941 3:135191878-135191900 TGCCATGCTCAGTCATTGGCTGG - Intronic
962653458 3:137518779-137518801 GGCCAAACCAAGAGATGGGCAGG - Intergenic
963011610 3:140775582-140775604 TACCCTGCCAAGCCATAGGCTGG - Intergenic
966721272 3:183064674-183064696 AGCCATGCCAGGACGTGGGTCGG - Intronic
968905206 4:3447687-3447709 GGCCAGGCCCAGACAGGGGCAGG + Intronic
969968949 4:11026429-11026451 TGCCATGCGAGGACCTGGGTAGG + Intergenic
972354654 4:38269101-38269123 TGCCCTGCCAAGCCCTGGACAGG - Intergenic
972460845 4:39300791-39300813 AGCCATGAAAAGACATGGGGGGG + Intronic
975528637 4:75377899-75377921 TGACTTGCCCAGACATGGGATGG - Intergenic
977545822 4:98375238-98375260 TGCCATGTGAAGACAGAGGCAGG - Intronic
978318774 4:107470008-107470030 TGCCATGCTTAGTCATTGGCTGG + Intergenic
984548961 4:181138311-181138333 TGCCATGCTCAGTCATTGGCTGG + Intergenic
993347619 5:86804756-86804778 TGCCATGCCATGCCATGAGTTGG + Intergenic
994402250 5:99296067-99296089 TGTCATGCCAATACATTGGGAGG - Intergenic
995083213 5:108078162-108078184 TGCAATGCCACCACATGGGCTGG + Intronic
995860796 5:116638286-116638308 GGCCATGCCAAAGCATGGTCTGG - Intergenic
996021992 5:118601657-118601679 TGCCATGCTCAGTAATGGGCAGG - Intergenic
996248537 5:121297041-121297063 TGCCATGCTCAGTCATTGGCTGG - Intergenic
997183338 5:131856469-131856491 TGTTATGCCCAGACATTGGCTGG - Intronic
997280518 5:132641146-132641168 TGCCCTGCTAAGACATCTGCAGG + Intronic
999619401 5:153457105-153457127 TGCCATGGCGAGGCTTGGGCAGG - Intergenic
1000049012 5:157546095-157546117 TGCCAAGCCAGGAGAGGGGCAGG - Intronic
1001290214 5:170451948-170451970 TGCCCTGCCCAGGCCTGGGCTGG + Intronic
1002058737 5:176613646-176613668 TCCCATCCCACCACATGGGCTGG - Intergenic
1002576466 5:180176957-180176979 TGCCAGGGGGAGACATGGGCAGG - Intronic
1003697820 6:8429219-8429241 TGACCTTCAAAGACATGGGCTGG - Intronic
1010037733 6:71345489-71345511 TGCCATGCCCAGCTCTGGGCAGG - Intergenic
1010277030 6:73980451-73980473 TGTAATGCCAAGACTTGGGGGGG - Intergenic
1012330018 6:97973660-97973682 TTCCCTGCCAAGCCATGGGCTGG + Intergenic
1013457150 6:110340437-110340459 TGCCAGGTTAAGACATGGCCAGG - Intronic
1017807251 6:157956347-157956369 TGCTTTTCCAAGACAGGGGCAGG - Intergenic
1020078987 7:5276434-5276456 AGCAATTCCAAGACAGGGGCAGG - Intronic
1020747231 7:12092769-12092791 TGCCATGTCAAGCCATGCCCAGG - Intergenic
1020835896 7:13150298-13150320 TGCAATGCCCAAACATGGTCAGG + Intergenic
1021415058 7:20374570-20374592 TGCCATGGAAACACAGGGGCGGG + Intronic
1024096259 7:45985198-45985220 TGCCCTGCCCAGCTATGGGCTGG + Intergenic
1024505381 7:50158104-50158126 GGCCAGGAAAAGACATGGGCGGG - Intronic
1024540555 7:50472237-50472259 CGCCATGCCAAGCCAGGTGCTGG - Intronic
1024682607 7:51708644-51708666 GGCCATGCAGAAACATGGGCTGG + Intergenic
1027346542 7:77265849-77265871 TGCCAAGTCGAGACTTGGGCAGG + Intronic
1028766561 7:94566033-94566055 TTCCATGCCCAGTCATTGGCTGG + Intergenic
1030499037 7:110335952-110335974 GGCCATGCAAAGACAGAGGCAGG - Intergenic
1034265704 7:149779675-149779697 TGCCATGCCCAGGTATGGGTGGG + Intergenic
1035067852 7:156121286-156121308 AGCCATGCCAAGGAATGGTCGGG + Intergenic
1039029928 8:33298340-33298362 TGTAATGCTAAGACATGGGCTGG - Intergenic
1041521334 8:58759675-58759697 TGCCAAGCCCAGATATGGTCAGG + Intergenic
1042194507 8:66220974-66220996 TGCCATGCTCAGCCCTGGGCTGG + Intergenic
1047698739 8:127429418-127429440 TGCCATGCCAAGAAATGGCCTGG - Intergenic
1049002608 8:139835730-139835752 TGCTTTGCCAAGACATGAGAGGG + Intronic
1053691095 9:40587949-40587971 TGCCAGGGCAAGACCAGGGCAGG - Intergenic
1054273710 9:63049542-63049564 TGCCAGGGCAAGACCAGGGCAGG + Intergenic
1054302354 9:63388920-63388942 TGCCAGGGCAAGACCAGGGCAGG - Intergenic
1054401130 9:64715426-64715448 TGCCAGGGCAAGACCAGGGCAGG - Intergenic
1054434735 9:65199740-65199762 TGCCAGGGCAAGACCAGGGCAGG - Intergenic
1054495654 9:65821941-65821963 TGCCAGGGCAAGACCAGGGCAGG + Intergenic
1055781624 9:79827604-79827626 GGCCATGCCAAGACCTGGAGAGG + Intergenic
1057222792 9:93266887-93266909 TGCCATGGCAGGAAAGGGGCAGG + Intronic
1057443194 9:95096578-95096600 TGCCATGTGAAGCCACGGGCAGG + Intergenic
1058058427 9:100472759-100472781 TTGCATACCAAGAAATGGGCAGG - Intronic
1058359981 9:104133727-104133749 TTCTATGGCAAGACAGGGGCAGG + Intronic
1058699115 9:107586590-107586612 TGCCAGGCCCAGAAATGGCCAGG + Intergenic
1060402974 9:123358859-123358881 TTCCATGCCAAAACCTGGGGTGG - Intronic
1186673069 X:11786865-11786887 TACCGTGCCAAGACATGGTATGG + Intergenic
1189419565 X:40844664-40844686 TGCCATGCTACGTCATTGGCTGG + Intergenic
1192334238 X:70204286-70204308 TGCCCTGCAAAGAGAGGGGCAGG - Exonic
1193947428 X:87755505-87755527 TGCCCTGCCCAGAAATGGGAAGG - Intergenic
1194939654 X:99994698-99994720 TGCCATGCTAAGTCAGTGGCTGG - Intergenic
1195479491 X:105327165-105327187 TGCCATGCTCAGTCATTGGCTGG + Intronic
1197758543 X:130012742-130012764 TGCCATCCCAGGAAGTGGGCAGG + Intronic
1198155420 X:133955208-133955230 TGCCATGCTCAGTCATTGGCTGG - Intronic
1202583843 Y:26405323-26405345 TGCCAGGGCAAGACCAGGGCAGG + Intergenic