ID: 1178730065

View in Genome Browser
Species Human (GRCh38)
Location 21:35093669-35093691
Sequence GGATGTCCCCAGATGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 170}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178730065_1178730072 22 Left 1178730065 21:35093669-35093691 CCCTGCTCCATCTGGGGACATCC 0: 1
1: 0
2: 0
3: 17
4: 170
Right 1178730072 21:35093714-35093736 TAATGCATTGTTCCTTTTTATGG 0: 1
1: 1
2: 5
3: 32
4: 472
1178730065_1178730068 -10 Left 1178730065 21:35093669-35093691 CCCTGCTCCATCTGGGGACATCC 0: 1
1: 0
2: 0
3: 17
4: 170
Right 1178730068 21:35093682-35093704 GGGGACATCCATGTCCCTACAGG 0: 1
1: 0
2: 1
3: 6
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178730065 Original CRISPR GGATGTCCCCAGATGGAGCA GGG (reversed) Intronic
902994887 1:20216632-20216654 CGGGGTCCCCAGATGGGGCAGGG + Intergenic
904709837 1:32421881-32421903 GGATGTCCCCAGATGATGTGGGG - Intergenic
905356592 1:37389147-37389169 GGAAGTCCCCAGAAGGAAGATGG + Intergenic
905940728 1:41861171-41861193 CATGGTCCCCAGATGGAGCATGG - Intronic
907011565 1:50968490-50968512 GCCTGTCCCCAGCTGGAGCGGGG - Exonic
908528575 1:65011692-65011714 TGCTGTCCCAGGATGGAGCAAGG + Intergenic
915479103 1:156173051-156173073 GGATGCCCCCAGGTTGAGGAGGG + Intronic
915623443 1:157099762-157099784 GGAGGTCCCCAGAGGGGGCTGGG - Exonic
916541149 1:165755746-165755768 AGATGTCCCCAGAAGGTGGATGG - Intronic
918410517 1:184253737-184253759 GGACCTTCCCAGATGGAGCCAGG - Intergenic
919495890 1:198267634-198267656 GGATTTCCCCATATTGATCAGGG + Intronic
921814769 1:219550896-219550918 GATTGTCCCCAGATAGAGAAGGG - Intergenic
1063429948 10:5978992-5979014 GGATTTCCCCAGTTGGAGTAAGG - Intergenic
1067563371 10:47319744-47319766 GGATTTTCTCAGATGGACCAGGG + Intergenic
1071674761 10:87645015-87645037 GGCTGTCCTCAGAGGGAGCCAGG + Intergenic
1077054057 11:581630-581652 GGGCGTCCCCAGGAGGAGCAGGG + Intronic
1077533934 11:3110086-3110108 GGATGGCCCAGGAAGGAGCATGG + Intronic
1078347011 11:10559035-10559057 TGATTTCCCCAGCTGGGGCAGGG + Exonic
1081603966 11:44515228-44515250 AAATGTCCCCAGCTGGGGCAAGG + Intergenic
1083852116 11:65374306-65374328 CCATGTGCCCAGGTGGAGCAGGG + Intergenic
1083852123 11:65374332-65374354 CCATGTGCCCAGGTGGAGCAGGG + Intergenic
1089524843 11:119090098-119090120 GGATGTGCCCAGAAGATGCAGGG + Intronic
1090796864 11:130142804-130142826 GGATTTCCCCATATTGACCAGGG + Intronic
1091681504 12:2530845-2530867 TGATGGCCCCAGAGGGAACACGG + Intronic
1092768722 12:11877529-11877551 GGATGTCCCCAGAAGCCACAGGG + Intronic
1094474088 12:30827967-30827989 GGATGTGCCCAGATGGGCCTTGG - Intergenic
1098910503 12:76203969-76203991 GGGTGTCTCCAGAGGGATCATGG + Intergenic
1104035239 12:125093004-125093026 TGGTGTCCCCAGAGGGAGAATGG + Intronic
1104067537 12:125317767-125317789 AGAGCTCCCCAGATGAAGCAAGG - Intronic
1104397193 12:128444392-128444414 GGAAGGCTCCGGATGGAGCAAGG + Intronic
1104810428 12:131617171-131617193 GGAGGTCTCCACATGGAGCCAGG + Intergenic
1105590785 13:21791080-21791102 GGATGTCCAAAGATGGGGCATGG - Intergenic
1108364697 13:49698192-49698214 CGAAGTCCCCAGACAGAGCATGG + Intergenic
1108481243 13:50874146-50874168 GGAAGTGCCCAGATGGGGCTAGG + Intergenic
1110732028 13:78889774-78889796 GGATGTCACAAGATGGATCAAGG - Intergenic
1111861636 13:93714730-93714752 GCTTCTCCACAGATGGAGCAAGG + Intronic
1112332118 13:98484745-98484767 GCACGTCCCCAGAAGGATCAGGG - Intronic
1113274425 13:108712718-108712740 GGTTCTTACCAGATGGAGCAGGG - Exonic
1113305736 13:109076593-109076615 GGATTTCTTGAGATGGAGCATGG - Intronic
1113581218 13:111430882-111430904 GTGTCTCCCCAGATGGAACAAGG + Intergenic
1114431984 14:22669702-22669724 GGATATGCCCAGAATGAGCAAGG - Intergenic
1114618278 14:24080005-24080027 GGAAGTCCCCACCTGGAGCTGGG - Intergenic
1118725670 14:68627387-68627409 GTGTGTCCACAGTTGGAGCAGGG + Intronic
1118777805 14:68984487-68984509 GGAGGTCCTGAGATGGACCAAGG + Intergenic
1119777353 14:77257367-77257389 AGATGTCCCCAGGAGCAGCAGGG + Exonic
1121640186 14:95480161-95480183 GGATGTCCCCAGACAGGGCTTGG - Intergenic
1124442597 15:29698148-29698170 GGGTTTCCCCAGATGGAGTGTGG - Intergenic
1127127192 15:55823148-55823170 CAATGTCCCCAGATGGAGATAGG + Intergenic
1127136363 15:55927827-55927849 GGATGGCCCCAGTTGGAGTAGGG + Intronic
1128936157 15:71748283-71748305 GCATGTCACCAGCTGGGGCAGGG - Intronic
1129292768 15:74581083-74581105 TGGTGTGCCCAGATGGGGCAGGG - Intronic
1132750892 16:1457130-1457152 GGCTGTCCTCAGATGGGGCTGGG + Intronic
1135646201 16:24164226-24164248 GGAGGTCTCCAGAGGAAGCAAGG - Intronic
1138536266 16:57661998-57662020 GGGTGTCTACACATGGAGCAAGG + Intronic
1139351051 16:66336051-66336073 GGATGTCCCGAGTTGGGACAAGG - Intergenic
1140819154 16:78647138-78647160 GGATGTCCCCAGCTAGACCCAGG - Intronic
1141016102 16:80451270-80451292 AGAAGTCCCGAGATGGAGCTGGG - Intergenic
1141578690 16:84982476-84982498 GACTGTCCCCAGGTGGGGCAGGG + Intronic
1143135863 17:4711910-4711932 GGAGGTGCCCAGTGGGAGCAGGG - Intronic
1143167295 17:4903196-4903218 AAATGTCCCCAGCTGCAGCAGGG - Intergenic
1144155154 17:12493262-12493284 AGATGTCACCAGATGGAACCTGG + Intergenic
1144301577 17:13926377-13926399 AGATTTCCTCAGTTGGAGCACGG - Intergenic
1147382528 17:40063825-40063847 GGAGGGCCCCAGATGGAGAAGGG - Intronic
1148887026 17:50781315-50781337 GGAAGCCTCCAGATGGAGCGCGG + Intergenic
1148991182 17:51668625-51668647 GGAGGTCCCGAGAGCGAGCAAGG - Intronic
1149531214 17:57396889-57396911 GGCTGTCCCCACATGGTGCAAGG + Intronic
1152013995 17:77737544-77737566 GGAGAGCCCCAGAGGGAGCAAGG + Intergenic
1153544190 18:6189068-6189090 TGATGTTCCCAGATGGAGTGTGG - Intronic
1157627396 18:49061925-49061947 GGATGGAGCCAGATGGAGGATGG - Intronic
1160862942 19:1245310-1245332 GGTTGGCCCCAGATGGAGTGGGG + Intergenic
1162781171 19:13007654-13007676 TTGTGTCCCCAGATGGGGCAAGG + Intronic
1162810326 19:13160678-13160700 GGATGGCCCCAGATCAAGCAGGG - Intergenic
1165105270 19:33465500-33465522 AGATGTCCCCAGCTGAAGCGAGG - Intronic
1167237996 19:48326452-48326474 AGATGTCTCCTGATGGAGGAAGG - Intronic
1167622397 19:50567314-50567336 GGGTGACCCCAGAGGGAGAAGGG + Intronic
925896537 2:8476606-8476628 GGATTTTGCCAGATGCAGCAGGG + Intergenic
926082244 2:9996915-9996937 TGATATCCCCACAGGGAGCATGG - Intronic
926158090 2:10469179-10469201 GGATGTCCCACAATGGAGCATGG - Intergenic
926188860 2:10712383-10712405 TGATGTGGCAAGATGGAGCAAGG + Intergenic
926372583 2:12194971-12194993 GGGATTTCCCAGATGGAGCAGGG + Intergenic
927185618 2:20480045-20480067 AGTTATCCCCAGCTGGAGCATGG - Intergenic
931255457 2:60568315-60568337 GGCTGGCACCAGATGGAGCGGGG - Intergenic
935190853 2:100777708-100777730 GGATGTCCCTGGAAGGAGAAGGG + Intergenic
935271241 2:101436050-101436072 GGGTGCCCACAGATGCAGCAGGG - Intronic
935802643 2:106714232-106714254 GGATGTCCCCACCTGCTGCAGGG - Intergenic
943759087 2:191588946-191588968 GTATGTCCTCACATGGAGAAAGG - Intergenic
945280437 2:208030643-208030665 AGATGTCCCCACATGTAGGAGGG - Intergenic
946831078 2:223728618-223728640 GTAAATCCCCAGATGAAGCATGG + Intergenic
947461036 2:230305611-230305633 AGAGGTCCCAAGATGGAGCTGGG + Intronic
947570315 2:231228522-231228544 GAATGTCCCCAGAGAGAGCCAGG + Intronic
947794030 2:232883219-232883241 GCCTGTCCCCAGGTGGAACAAGG - Intronic
948685883 2:239669604-239669626 GAATGAACCCAGCTGGAGCATGG + Intergenic
1169665724 20:8033456-8033478 GGATGTCACTAGATGGTGCAGGG - Intergenic
1170590220 20:17765861-17765883 GGCTGTGACCAGATGGAGCATGG + Intergenic
1171414773 20:24970020-24970042 GGATGTCACAAAATGGAACAAGG - Intronic
1171429792 20:25075366-25075388 ACATGTCCCCAGATTGAGAAGGG + Intronic
1172702228 20:36860877-36860899 GGATGTCCCCAGCTGGACCCCGG + Intronic
1173374740 20:42473196-42473218 TGATGTTCCCAGAGGGACCAGGG - Intronic
1174949190 20:55025871-55025893 TCATGTCTCCAGATGGAGAAAGG - Intergenic
1175923607 20:62461549-62461571 GGAGGTCCCCAAAGGGAACAGGG - Intergenic
1175925315 20:62468549-62468571 GCCTGGCCCCAGATGAAGCAGGG - Intronic
1178076653 21:29019019-29019041 CGAGGTCCCCGGCTGGAGCAGGG + Intronic
1178474842 21:32928743-32928765 GCTTGCCCCCAGATGGAGCTTGG - Intergenic
1178730065 21:35093669-35093691 GGATGTCCCCAGATGGAGCAGGG - Intronic
1181593442 22:23898133-23898155 AGAAGTCTCCAGATGGAGCCGGG + Intronic
1183272352 22:36870051-36870073 GGATGTCATGAGATGGAGCAAGG + Intronic
1183716934 22:39538562-39538584 CCTTGTCCACAGATGGAGCAGGG - Intergenic
950652247 3:14414461-14414483 AGCTGTCCCCAGAAGGGGCATGG + Intronic
951545288 3:23818801-23818823 GGATGTCTTCAGATGGAGGATGG + Intronic
952953546 3:38542875-38542897 GGATGCCCTCGGATGGAGCTTGG + Intergenic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
953461984 3:43088815-43088837 GGATGTCCAGAGATGGGGCTTGG - Intronic
955808204 3:62758669-62758691 GGATGTGCCCAGATAGAACTGGG - Intronic
956192739 3:66622647-66622669 GGGCTTCCCCAGATAGAGCAGGG - Intergenic
956868247 3:73390329-73390351 GGATGTCCCCAAATGCAGAAAGG + Intronic
957443769 3:80288522-80288544 GGATGTCCTCAGATGCCTCAAGG + Intergenic
957696725 3:83649470-83649492 GGACGTCCCCAGGTGCAGGAGGG - Intergenic
960673321 3:120172313-120172335 GCATGTCTACAGATGGAGAAGGG - Intronic
961210640 3:125122727-125122749 GGATTTCCCCAGCTGTCGCATGG - Intronic
961581270 3:127884938-127884960 GGATGTCCCTATATGGACCCTGG + Intergenic
967312721 3:188121326-188121348 GGGTGTGGCCAGATGGGGCATGG + Intergenic
967934205 3:194713667-194713689 GGATTTCCCCAGATCTAGGATGG - Intergenic
968902617 4:3438639-3438661 GGAGGTCACCAGATGTGGCAGGG + Intronic
969156132 4:5211501-5211523 GGAGGTCCCCAGGAGGACCAGGG + Intronic
969585107 4:8087155-8087177 GGGTGTCCCCAGACAGAGGAGGG - Intronic
971618690 4:28827849-28827871 GGATGTGCCGAGATTGAGCGAGG - Intergenic
971724840 4:30296998-30297020 GGATGTGCCCAGATTGATTAAGG + Intergenic
974144810 4:57934076-57934098 ATTTGTCCCCAGGTGGAGCAAGG - Intergenic
975202701 4:71609904-71609926 TGGTGTGCCCAGATGGGGCATGG + Intergenic
976477262 4:85498531-85498553 GGATTTCCCCATTTGGGGCAGGG - Intronic
987117428 5:14736805-14736827 GGATCTCTCCAGATGGATCTTGG - Intronic
991330300 5:65485939-65485961 GGAGGCGCCCAGATCGAGCAAGG + Intergenic
998225220 5:140321726-140321748 GGATGACTCCAGCTGGAGAATGG - Intergenic
1003578367 6:7317241-7317263 GGAGGCCCCCAGAGCGAGCAAGG + Intronic
1004760166 6:18657003-18657025 GAATGTCCCCTGGTGGAGGAGGG - Intergenic
1005452974 6:25992050-25992072 CGGTGTCCCCAGCTGGAGCAGGG + Intergenic
1007625028 6:43241348-43241370 AGCTGTCCCCAGTTGAAGCAAGG + Intergenic
1010119815 6:72362358-72362380 TGATGTCCCGACTTGGAGCAAGG - Intronic
1018426897 6:163691195-163691217 GGCTGTGCCCAGCTGGAGAACGG + Intergenic
1018647499 6:165961850-165961872 GGTTGTGCCCAGATGGAGGGTGG - Intronic
1019273749 7:165017-165039 GGATGTGCCCAGAAGGCGGAGGG + Intergenic
1019453540 7:1112524-1112546 GGATGGCCCCACATGAAGCCAGG + Intronic
1019524303 7:1473886-1473908 GCATGTGCCCAGATGGATGAGGG + Intronic
1019544509 7:1567056-1567078 GTCTGTCCCCAGCTGCAGCACGG + Intergenic
1021036469 7:15805959-15805981 GGATGATCCCAAATGGAGCCTGG - Intergenic
1021981371 7:26058804-26058826 GCCTTTCCCCAGATGCAGCATGG - Intergenic
1022470273 7:30677717-30677739 GGAGGCCCCCAGATGGAGACAGG + Intronic
1022470945 7:30681671-30681693 GGCTGTCACCGCATGGAGCACGG + Intronic
1024300488 7:47884009-47884031 CTATGTTCCCAGATGGATCACGG - Intronic
1024596889 7:50946113-50946135 AGATGATCCCAGATGGGGCATGG - Intergenic
1026498437 7:70922833-70922855 AGTTGTCCCCATTTGGAGCAGGG + Intergenic
1026501705 7:70948274-70948296 AGATGTCCTCACATGGAGGAAGG - Intergenic
1028727099 7:94100746-94100768 GGAGGTGCCCAGAGCGAGCAAGG - Intergenic
1029264152 7:99325439-99325461 GGCTTTCCACAGAGGGAGCACGG + Intergenic
1033455714 7:141501679-141501701 TGAAGTCCCCAGAAGGAGAAGGG + Intergenic
1036612152 8:10359701-10359723 GGATGGTCTCAGATGGAGGATGG + Intronic
1036612160 8:10359752-10359774 GGATGGTCTCAGATGGAGGACGG + Intronic
1036952146 8:13150996-13151018 AGATGTCTACAGATGGAACAGGG + Intronic
1038431738 8:27505728-27505750 GGAGGTCCCAGGATGCAGCATGG - Intronic
1040026471 8:42786628-42786650 GGAGGTGCCGAGAGGGAGCAAGG - Intronic
1040477086 8:47788267-47788289 GCAAGTCTCCAGATGGAGGAGGG + Intronic
1043146712 8:76666009-76666031 GGAGGTCTCCAGATTGAGCCTGG + Intergenic
1047721162 8:127641006-127641028 CTGTCTCCCCAGATGGAGCATGG - Intergenic
1048813433 8:138309196-138309218 TGATGTCCACAGAGAGAGCAGGG - Intronic
1048861529 8:138727613-138727635 GGGTGCCCCCAGAGGGAGAAAGG - Intronic
1049043392 8:140129560-140129582 GGATGTCCACACAGGGGGCAGGG + Intronic
1049308347 8:141920020-141920042 AGCTGGCCCCAGATGCAGCAGGG - Intergenic
1049331813 8:142058638-142058660 GGGTGTTGTCAGATGGAGCAGGG - Intergenic
1050530734 9:6586813-6586835 GCGTGTTCCCAGATGAAGCATGG - Intronic
1050685934 9:8169278-8169300 GGCTGATCCCAGAGGGAGCATGG + Intergenic
1052738821 9:32373908-32373930 AGATGCCTGCAGATGGAGCATGG + Intergenic
1054922385 9:70555194-70555216 GGATGCACCCAGGTGAAGCATGG - Intronic
1059168682 9:112103911-112103933 AAATGGCTCCAGATGGAGCATGG - Intronic
1060803064 9:126556886-126556908 GGGAGTCCCCCCATGGAGCAGGG + Intergenic
1061162271 9:128902248-128902270 GGATGTTCCCAGACCAAGCACGG + Intronic
1061176185 9:128998782-128998804 GGATATCCTGAGATGGAGCAGGG + Intronic
1061313133 9:129777106-129777128 GAGTGTCCCCAGATGGCGCCCGG + Intergenic
1061402177 9:130374415-130374437 GGCTGCTCCCAGATGGATCAGGG - Intronic
1061840795 9:133357435-133357457 GGATGGCTCCACCTGGAGCAAGG - Intronic
1186094245 X:6082687-6082709 GGATCTTCCCAGATGGAGAGTGG + Intronic
1188930402 X:36102564-36102586 TGATGGACCCATATGGAGCATGG - Intronic
1189366801 X:40395150-40395172 AGATGTCCCCAGTTGAGGCAAGG + Intergenic
1196650500 X:118163854-118163876 AGATGTGCCCAGAAGCAGCATGG - Intergenic
1197727040 X:129783253-129783275 GGATTTCTCCAGGTGGAGCTCGG - Intronic
1198842766 X:140876628-140876650 TGGTGTACCCAGAGGGAGCACGG + Intergenic
1199208138 X:145173671-145173693 AAAAGTCCTCAGATGGAGCAAGG + Intergenic
1199691037 X:150309132-150309154 AGTTCTCCCCAGATGGTGCAGGG - Intergenic
1199984262 X:152939044-152939066 GGAGGGCCACAGATGGAGCAGGG + Intronic