ID: 1178730330

View in Genome Browser
Species Human (GRCh38)
Location 21:35096176-35096198
Sequence CTTGACATGCTTATGTTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 162}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178730330 Original CRISPR CTTGACATGCTTATGTTGAA GGG (reversed) Intronic
902385914 1:16075840-16075862 CTTTATATGCATCTGTTGAACGG - Intergenic
908339342 1:63160683-63160705 CTAGAAATGTTTATGCTGAAGGG - Intergenic
909515694 1:76504615-76504637 CTTTATATGCTTGTGTTAAATGG + Intronic
910246096 1:85140014-85140036 CTTGACATGGATGGGTTGAAAGG - Intergenic
910509744 1:87990568-87990590 CTTTACATGCTGATGGTGCAGGG + Intergenic
911285138 1:95982336-95982358 CTTGGTATGTTTCTGTTGAATGG + Intergenic
912050350 1:105522008-105522030 GTTGAAATGCTTATGTTCACAGG - Intergenic
912087912 1:106033254-106033276 CTTGAAATGCCTATTTTTAAGGG + Intergenic
913036753 1:114974301-114974323 GTTGATATGCATAAGTTGAATGG + Intronic
913326392 1:117632078-117632100 CTTGAAAGGCTTCTGTTGGAAGG - Intergenic
917477532 1:175381639-175381661 CTTGACTTGCTGACGTTGCAGGG - Intronic
917622738 1:176813856-176813878 TTTCCCATGCCTATGTTGAATGG + Intronic
918115984 1:181498045-181498067 CTTTCCATGCTAATATTGAAAGG - Intronic
924838760 1:247685017-247685039 CTTGACATTCTTTTTTTGATGGG + Intergenic
1067323756 10:45246723-45246745 CTTGACCTGCTGATGTGGAGGGG + Intergenic
1069356621 10:67594059-67594081 ATTGACTTGTATATGTTGAACGG + Intronic
1070210822 10:74318884-74318906 GTTTACATGCTTTTGTTGAGAGG + Intronic
1070381650 10:75885456-75885478 CATGTCATGCTTAAGCTGAAAGG - Intronic
1070978159 10:80622247-80622269 CTTCACATGTATCTGTTGAAAGG + Intronic
1073615629 10:104991967-104991989 CTTGACATGCATATGTCTTATGG - Intronic
1073674147 10:105626527-105626549 CTTGTCATGCTCATGTTCACTGG + Intergenic
1078423936 11:11234228-11234250 CTGGACATGTGTTTGTTGAATGG + Intergenic
1082142814 11:48630046-48630068 TTTTACATGCTTAGGTGGAAGGG - Intergenic
1083649817 11:64195857-64195879 CTAGAAATCTTTATGTTGAATGG + Intronic
1085723587 11:78934275-78934297 CCTGACATGCTTATCTTAAAAGG + Intronic
1087011742 11:93520834-93520856 CGTGACATGCTGAAGGTGAAAGG - Intronic
1087246554 11:95845029-95845051 CTTGCCATGCTCATGTTGGATGG - Exonic
1087429010 11:98027437-98027459 ATGGACATGCTTATCTGGAATGG - Intergenic
1091181566 11:133609118-133609140 TTTGATTTGCCTATGTTGAAGGG - Intergenic
1091698548 12:2644286-2644308 CTTGGCAGGCTGATTTTGAAAGG - Intronic
1093134284 12:15431840-15431862 CTAGACATGCTTATCTAGATTGG - Intronic
1096434573 12:51578022-51578044 CTGGACATTTTTATGTTCAAGGG - Intergenic
1100043942 12:90355929-90355951 TGTGGCATGTTTATGTTGAAAGG + Intergenic
1100061716 12:90586679-90586701 TTTGGGATGCTTAGGTTGAAGGG - Intergenic
1101011127 12:100450578-100450600 ATTGACTTGCTTCTGTAGAAGGG - Intergenic
1103624489 12:122207543-122207565 CTTGTCCAGCATATGTTGAATGG + Intronic
1106814413 13:33391271-33391293 CATGATCTGCTTATTTTGAAGGG - Intergenic
1106995969 13:35479950-35479972 TTTGAAATGCTTATATTGAATGG + Intronic
1113233660 13:108243476-108243498 CTGGAAATTCTGATGTTGAAAGG + Intergenic
1116075646 14:40106988-40107010 CTTGCCATGGTTATTTTGAATGG + Intergenic
1116417156 14:44692521-44692543 ATTTACATGCTTATGTTAGAAGG - Intergenic
1120048511 14:79837124-79837146 CTTTTGATTCTTATGTTGAAAGG + Intronic
1120289656 14:82551244-82551266 CTTGACATTGTTATGATGGATGG + Intergenic
1120616437 14:86711115-86711137 CTGGGCATGCTTAAGTTGAGAGG + Intergenic
1121457061 14:94045064-94045086 CTTGACGTGTTTATGATGCATGG + Intronic
1121669021 14:95693860-95693882 CATGAAATCCTTATGTTGACTGG - Intergenic
1122277238 14:100599213-100599235 CATGAAATGCTTATGTTATAAGG - Intergenic
1123887404 15:24740283-24740305 CTTGAAATCCTTATGTCAAAAGG + Intergenic
1124118809 15:26870605-26870627 CTTGCCTTGCTTATCTTGAGTGG + Intronic
1124253625 15:28123406-28123428 CTTGACAAGATGATCTTGAAGGG - Intronic
1124446235 15:29735836-29735858 TTTGACATGCTAAGTTTGAAGGG + Intronic
1125195413 15:37040626-37040648 CTGGGCATGCTTCTTTTGAAAGG + Intronic
1126004282 15:44241769-44241791 TTTCACAGGCATATGTTGAAAGG - Intergenic
1127771606 15:62235814-62235836 CTTGATGGGTTTATGTTGAAAGG + Intergenic
1128604514 15:69026944-69026966 ATTGACAAGCTTATCTTGAGAGG - Intronic
1130670739 15:85910320-85910342 GCTGACCTGCTTATGCTGAAAGG + Intergenic
1131401466 15:92128811-92128833 CTTGACATACTTCTGGTGATGGG - Intronic
1136872692 16:33822987-33823009 TTTGACTTGTGTATGTTGAAGGG - Intergenic
1141335159 16:83147649-83147671 CTTGACATCCTTATGGGAAAGGG + Intronic
1203099480 16_KI270728v1_random:1293067-1293089 TTTGACTTGTGTATGTTGAAGGG + Intergenic
1151431974 17:74069878-74069900 CTTGAGCTGCTTGTGTTGGAGGG - Intergenic
1155124377 18:22857135-22857157 CTTCACATGCTTTTGATGGAAGG + Intronic
1157103564 18:44752041-44752063 GTTGAAATCCATATGTTGAAAGG - Intronic
1158927217 18:62279891-62279913 CTTGACAGGCACATTTTGAAAGG - Intronic
1159187367 18:64992834-64992856 CTTGAGATGCCAATGTTGACTGG - Intergenic
1159569269 18:70093606-70093628 ATTGATTTGCATATGTTGAACGG + Intronic
1162639101 19:11993755-11993777 GTTGACATGTAAATGTTGAAGGG - Intergenic
1167487336 19:49770361-49770383 CTTAGCAAGCGTATGTTGAACGG + Intronic
925603757 2:5636666-5636688 ATTCACATACATATGTTGAATGG - Intergenic
925869815 2:8260217-8260239 CTTCACATGCCAATGTGGAAAGG + Intergenic
926792109 2:16584486-16584508 TTAGGCATGCTTATGTTTAAAGG - Intronic
930950095 2:57130618-57130640 CTTGAAAAGCTGTTGTTGAATGG + Intergenic
933269661 2:80219835-80219857 CTTGATGTGTTTATGTTAAATGG - Intronic
936496092 2:113022734-113022756 CCTGAGATGGTGATGTTGAAAGG + Exonic
936712926 2:115153662-115153684 CTTGGCATACTTTTTTTGAAAGG - Intronic
936880273 2:117242182-117242204 CTTGGAATGATGATGTTGAAAGG + Intergenic
937012877 2:118577360-118577382 AATGAAATGCTGATGTTGAAAGG - Intergenic
938852850 2:135279512-135279534 CTTGACATGTACATTTTGAAAGG - Intronic
939626891 2:144488483-144488505 ATGGACATGCTTCTCTTGAAAGG + Intronic
939936953 2:148304756-148304778 CTTGACAGGGTTATTTTAAAAGG + Intronic
941028742 2:160487903-160487925 TTTGACATGCTTATTTTCCAGGG + Intronic
943165520 2:184319358-184319380 CATTATATGCTTATGTTGTAAGG - Intergenic
1169989776 20:11488526-11488548 CTTGACATACTTCTGTTTTATGG - Intergenic
1170643377 20:18175698-18175720 CTTGACTTGCATTTGCTGAATGG - Intronic
1171565959 20:26187786-26187808 CTTGAAATGTTGATGTTTAAGGG - Intergenic
1174876553 20:54232504-54232526 AGTGACATGCTTCTGATGAATGG + Intergenic
1174948037 20:55010380-55010402 CTAGACCTACCTATGTTGAAGGG + Intergenic
1176911106 21:14566310-14566332 TTTGAAATACTTATGTTAAAAGG - Intronic
1177740388 21:25146945-25146967 CTTGAGATCCCTTTGTTGAATGG - Intergenic
1177977307 21:27867542-27867564 CTTGGTAAGCCTATGTTGAATGG + Intergenic
1178730330 21:35096176-35096198 CTTGACATGCTTATGTTGAAGGG - Intronic
949319128 3:2789137-2789159 TTTGCTATGCTTATTTTGAATGG - Intronic
949319292 3:2790787-2790809 CTTGACTTGCTTCTGTTACAAGG + Intronic
954550495 3:51477132-51477154 TTTGACTTGATTCTGTTGAAAGG - Intronic
956436553 3:69239758-69239780 CTGGACGTGTTTATGTTGTACGG - Intronic
956458945 3:69452331-69452353 ATTGGCATGCTTAAGTAGAAAGG + Intronic
956887380 3:73573941-73573963 CTTGGCCAGCTTATCTTGAATGG - Intronic
957296443 3:78339050-78339072 ATTAACATTCTTATCTTGAAAGG + Intergenic
957328395 3:78726815-78726837 CTTCAAATGTTTCTGTTGAAAGG - Intronic
957485880 3:80862202-80862224 ATTGATTTGCATATGTTGAATGG - Intergenic
958013522 3:87911991-87912013 CTTGTCATGCTGATTTTCAAGGG - Intergenic
958747836 3:98158849-98158871 CTTGAGATACTTATGTTAAAAGG - Intergenic
959524414 3:107360685-107360707 CTTGAGATGCCTATATGGAATGG + Intergenic
960393735 3:117111112-117111134 ATTGAAATGCTTAGGTGGAATGG - Intronic
961951827 3:130757530-130757552 CTTGACATGCATCAATTGAAAGG - Intergenic
967525875 3:190492129-190492151 CATAACATGCTAATGATGAAAGG - Intergenic
967641118 3:191864188-191864210 CTTGGCCTACTTATGGTGAAAGG + Intergenic
970670667 4:18393220-18393242 CTAGACATCCATATGTTAAAAGG - Intergenic
972029433 4:34434757-34434779 CTTGAAATGTTGATGTTTAAGGG - Intergenic
972154396 4:36140969-36140991 CTTATTATGCTTTTGTTGAAAGG - Intronic
972926366 4:44014074-44014096 CTTGAAAATCTTATGGTGAAGGG - Intergenic
973707917 4:53598315-53598337 CTTGACCTCCTTATGATTAAGGG + Intronic
975465464 4:74704326-74704348 CTTGACATGCATATACTGAGGGG - Intergenic
977297941 4:95231673-95231695 CTGGACATGTTTATTTTGAATGG - Intronic
980797027 4:137698245-137698267 GATGACATGCTTATCTTAAAAGG - Intergenic
981178814 4:141714974-141714996 CTGGACATGCTGAGTTTGAAAGG - Intronic
983387616 4:167085221-167085243 TTTGAGATGCTTATCTTGGAAGG + Intronic
988024670 5:25669674-25669696 GTAGACATGCTAATGGTGAATGG + Intergenic
990670765 5:58127576-58127598 CTTCACTGGCCTATGTTGAACGG + Intergenic
995276652 5:110285113-110285135 CTTGACAAGTTTATTTTAAACGG - Intergenic
995392709 5:111656589-111656611 CTGGACATGTTTATGATCAATGG - Intergenic
996268392 5:121571798-121571820 CTTGCTATGATTATGTTCAATGG + Intergenic
998520877 5:142799377-142799399 CTTGACAAGCATTTGTAGAATGG - Intronic
1000298794 5:159936669-159936691 CTGGGCCTGCTTAGGTTGAAGGG - Intronic
1000668970 5:164036346-164036368 CTTGGAATGCTTATGTTATAGGG - Intergenic
1001610837 5:173000596-173000618 CTTGGCACGATTATGTTGTAGGG + Intronic
1003332409 6:5140701-5140723 TTTAACATGCTTTTGTTGAATGG - Intronic
1003665836 6:8110487-8110509 ATCCACATGCTGATGTTGAAGGG + Intergenic
1004403498 6:15310627-15310649 CTGCAGATGCTTATGTAGAAGGG - Intronic
1004993114 6:21161169-21161191 CATGAAAACCTTATGTTGAATGG + Intronic
1007114321 6:39332699-39332721 CTTCACATGCAGATGTTGATCGG + Exonic
1007425148 6:41741760-41741782 CTGCACATGCTTGTGTTGACTGG + Intronic
1010738732 6:79472903-79472925 CTTGACTTACTTATGTTCCAGGG - Intergenic
1012576019 6:100799597-100799619 TTTGAAATGTTTATCTTGAAAGG + Intronic
1014645880 6:123972021-123972043 CTTGTCATCTTCATGTTGAATGG - Intronic
1015088140 6:129321065-129321087 CCTGAGAAGCTTATGTTAAAGGG - Intronic
1015908290 6:138140575-138140597 TATGACATGCTTATTTTAAAAGG + Intergenic
1017338364 6:153289322-153289344 CTTGACTTGCGTAAGTGGAAAGG - Intergenic
1020229012 7:6303140-6303162 CTGAAAATTCTTATGTTGAAAGG - Intergenic
1021865649 7:24954308-24954330 TTTGACATCCTTATGGAGAAAGG - Intronic
1022489568 7:30806245-30806267 CTTGGCATGGTGAGGTTGAAAGG + Intronic
1024140279 7:46456039-46456061 CTTGGCATGCTTAGGTTCCAGGG - Intergenic
1028193084 7:87875291-87875313 TTAGACAGGTTTATGTTGAAGGG - Intronic
1031194413 7:118593747-118593769 TCTGCCATGCTTATGTTGAATGG + Intergenic
1031649692 7:124272937-124272959 CTTAAAATGCTTAAGTTTAATGG + Intergenic
1032374636 7:131399367-131399389 CATGACAAGCTGGTGTTGAAGGG + Exonic
1034415548 7:150962700-150962722 TTTGACAGGGTTATTTTGAAAGG - Intronic
1037360188 8:18065081-18065103 CTTAACATGTTAATGTTAAATGG - Intronic
1037630263 8:20649419-20649441 CTTAACAAGCTTTTGTTTAAGGG + Intergenic
1042765672 8:72318924-72318946 CATGATATACTTATTTTGAAAGG - Intergenic
1042836392 8:73082501-73082523 ACTGACATGTTTATGTTGCATGG - Intronic
1044245454 8:89939305-89939327 CTTGACTTGCTTTTGCTGCATGG - Intronic
1044691317 8:94882450-94882472 ATTTACATGACTATGTTGAAGGG + Intronic
1046898807 8:119501709-119501731 CTGGACATGCTTAGATTCAAAGG + Intergenic
1055012957 9:71587020-71587042 CATGACAAGGTTATGTTGTATGG - Intergenic
1055378639 9:75681187-75681209 ATTGATTTGCTTATGTTTAAAGG - Intergenic
1056602412 9:88056490-88056512 CTTGAGCTGCTTCTGTGGAATGG - Intergenic
1056646792 9:88419727-88419749 TTTGCCATGTTCATGTTGAATGG + Intronic
1056719954 9:89063071-89063093 CTTGACATTCTTTCCTTGAAGGG + Intronic
1058814300 9:108669142-108669164 CTTGAGATTTTTATGTTGGAAGG + Intergenic
1187495959 X:19796034-19796056 CCTGACAAGCATCTGTTGAATGG + Intronic
1187890905 X:23934045-23934067 CATGACATGCTTGGGTTGAGAGG - Intronic
1188258844 X:27998570-27998592 CTTCACATCCTTATTTTTAAAGG + Intergenic
1188508472 X:30908637-30908659 ATTGGCATGCTCATCTTGAAAGG + Intronic
1188582799 X:31735691-31735713 CTTGAGCTGCATGTGTTGAATGG - Intronic
1193781748 X:85711593-85711615 TTTGACATCAATATGTTGAAAGG - Intergenic
1194318188 X:92408441-92408463 CTTGTCAAGCTCATGTAGAAGGG + Intronic
1194985436 X:100485124-100485146 TTTGGCATGCTGATGCTGAAAGG - Intergenic
1195378213 X:104248257-104248279 CTTGACATCCTTATGTGTGAAGG + Intergenic
1198977963 X:142358455-142358477 CTTCACACACTTATGTTCAACGG + Intergenic
1200626358 Y:5521730-5521752 CTTGTCAAGCTCATGTAGAAGGG + Intronic