ID: 1178734975

View in Genome Browser
Species Human (GRCh38)
Location 21:35141045-35141067
Sequence GGCTGGGATTATGCAAAATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 162}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178734968_1178734975 19 Left 1178734968 21:35141003-35141025 CCTTAGCTGTGTGATCTTGTACT 0: 1
1: 0
2: 2
3: 31
4: 265
Right 1178734975 21:35141045-35141067 GGCTGGGATTATGCAAAATGGGG 0: 1
1: 0
2: 1
3: 15
4: 162
1178734967_1178734975 30 Left 1178734967 21:35140992-35141014 CCTGGTTAAAACCTTAGCTGTGT 0: 1
1: 0
2: 0
3: 10
4: 138
Right 1178734975 21:35141045-35141067 GGCTGGGATTATGCAAAATGGGG 0: 1
1: 0
2: 1
3: 15
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178734975 Original CRISPR GGCTGGGATTATGCAAAATG GGG Intronic
900726402 1:4219146-4219168 GGCTGGTGTTATGGAAAACGAGG - Intergenic
900853263 1:5160645-5160667 AGATGGGATTATGCAAACCGTGG + Intergenic
902153404 1:14463105-14463127 GGGTGGGTTAATGCAAATTGAGG + Intergenic
902260117 1:15218834-15218856 GGGTGGGTTAATGCAAATTGAGG - Intronic
905764939 1:40592499-40592521 GGGTGGGTTAATGCAAATTGAGG - Intergenic
907254748 1:53170438-53170460 GGCTGGGAGGAGGGAAAATGGGG - Intergenic
907719004 1:56954094-56954116 GGCTGAGAAGATGCAAAATATGG + Intronic
908423909 1:63986489-63986511 GGCTGGAATTATGGGAAAGGAGG + Intronic
909310695 1:74144263-74144285 TCCTGGGATTATGCCAAATATGG - Intronic
911903013 1:103528866-103528888 TCCTGTGATGATGCAAAATGAGG + Intronic
912359390 1:109082359-109082381 GGGTGGGATTATCAGAAATGAGG + Intergenic
912944938 1:114077069-114077091 GTCAGGGACTATGCAAAGTGTGG + Intergenic
913349298 1:117840686-117840708 GGCAGGGACTATGCAAAATCTGG - Intergenic
913686477 1:121236714-121236736 AGCTAGGATTAAGCAGAATGGGG + Intronic
914038328 1:144024354-144024376 AGCTAGGATTAAGCAGAATGGGG + Intergenic
914151127 1:145043554-145043576 AGCTAGGATTAAGCAGAATGGGG - Intronic
915080429 1:153348376-153348398 AGCTGGGAATATGCCAGATGAGG + Intronic
916864961 1:168846549-168846571 GGCTGGGATTCTGAGAAATATGG - Intergenic
922663762 1:227451861-227451883 GGCTGGGGTCAGGAAAAATGCGG + Intergenic
924097873 1:240573019-240573041 GACTGGAATGATGCAAAGTGAGG + Intronic
1062852045 10:751606-751628 GGCTGTGATTAAGTAAAATGAGG + Intergenic
1065349104 10:24779862-24779884 GGCTGGGCTTTTTCAAACTGTGG - Intergenic
1065830207 10:29608377-29608399 GGCTGGGATTGTGCACTCTGTGG + Intronic
1068859534 10:61833212-61833234 AGATGGAATTATGCAATATGTGG + Intergenic
1069635475 10:69922417-69922439 GGTTGAGAATATTCAAAATGTGG - Intronic
1072735529 10:97876579-97876601 GGAAGGGATTATGCAAATGGAGG - Intronic
1073224358 10:101904565-101904587 GGCTTTAATTATCCAAAATGGGG - Intronic
1075982654 10:126754957-126754979 TCCTGGTAATATGCAAAATGAGG - Intergenic
1077778774 11:5301790-5301812 GGCTGTGATCATTCCAAATGAGG + Exonic
1079066314 11:17296985-17297007 GGCTGGAATTATGTCAAATAGGG - Intronic
1079537704 11:21534672-21534694 GCCAGGGATCATGCAAAGTGGGG + Intronic
1081704579 11:45173745-45173767 TGCTGGGGTCATGGAAAATGAGG - Intronic
1082083648 11:48031534-48031556 GATTGGGGTCATGCAAAATGGGG + Intronic
1082190848 11:49242648-49242670 GGCTAGTATTATACCAAATGGGG + Intergenic
1086675269 11:89598427-89598449 GGCTAGTATTATACCAAATGGGG - Intergenic
1087010385 11:93508557-93508579 GAATGGAATTCTGCAAAATGAGG + Intronic
1088396387 11:109374580-109374602 GGCTGCCATTATGCAATATTTGG - Intergenic
1088476435 11:110244471-110244493 GAATGGAATCATGCAAAATGTGG - Intronic
1088695826 11:112365164-112365186 GGCTGTGATTATACAACAAGTGG - Intergenic
1091506136 12:1070850-1070872 GGCAGGGATGATGCGAACTGGGG - Intronic
1091849729 12:3685720-3685742 GGCTGGGAGTGGGCGAAATGAGG + Intronic
1097520281 12:60659857-60659879 GGCTGGGATTATAGTAAATGAGG + Intergenic
1098940333 12:76527251-76527273 GGGGGGGATTGTGCAACATGAGG + Intronic
1102057524 12:109907797-109907819 GGCTGAGATTCTGCAAAGGGCGG + Intronic
1104504693 12:129320123-129320145 GGCTGGGGTTAATCAAAATAGGG + Intronic
1105796262 13:23856509-23856531 GGGTGGGTTAATGCAAATTGGGG + Intronic
1106504327 13:30357786-30357808 GGCTGGGCTGCAGCAAAATGAGG - Intergenic
1107218969 13:37957185-37957207 GGATGGGAGAATGCATAATGAGG + Intergenic
1107462278 13:40615619-40615641 GGCTGTGATTATCAACAATGAGG + Intronic
1112674376 13:101681710-101681732 GGTTGAGATTATGAAAAAAGAGG + Intronic
1112680744 13:101762338-101762360 GGTTGGGATTTTGCACAATGGGG - Intronic
1112751485 13:102588329-102588351 GGGTGGGTTAATGCAAACTGAGG + Intergenic
1115795313 14:36928914-36928936 AGCCTGGATTATGCACAATGAGG - Intronic
1116349450 14:43841651-43841673 GGCTGGGATTATGGGAAAATGGG - Intergenic
1116650225 14:47581321-47581343 AGCTTGGATTATTGAAAATGAGG - Intronic
1119067979 14:71549890-71549912 GCTTGGGATTAGGAAAAATGAGG + Intronic
1120611021 14:86641598-86641620 GGATGGGATTATAAATAATGGGG - Intergenic
1121336238 14:93079089-93079111 GCCTGGGATGATGTAAAATGTGG - Intronic
1125071290 15:35556985-35557007 GGCTGGGGTAATAGAAAATGGGG + Intergenic
1126131908 15:45349779-45349801 GCCTGGGATTTTGCAATGTGGGG + Intergenic
1126268045 15:46778027-46778049 GGCAGGGATTAAGTGAAATGGGG + Intergenic
1126389626 15:48132715-48132737 GGCTGGGAATTTTCAAAATCTGG + Intronic
1131087373 15:89588380-89588402 GGTTGGGATTTTCCCAAATGAGG + Intronic
1133987697 16:10681216-10681238 TGCTGGGAGTATGAAAAAGGTGG - Intronic
1134901770 16:17944578-17944600 GGTTGGGTTTCTGCAAAATGTGG - Intergenic
1135643165 16:24138740-24138762 GGCTGGGAGTAGAGAAAATGGGG - Intronic
1135841980 16:25885235-25885257 AGCTGGGATTCAGCAAGATGGGG + Intronic
1135986364 16:27187630-27187652 GGCTGGGGTTATGCATTTTGGGG - Intergenic
1137083910 16:36099192-36099214 GGAAGGTGTTATGCAAAATGTGG - Intergenic
1139165735 16:64563196-64563218 GGCTGTGATTATGGAAAAGCAGG + Intergenic
1140293011 16:73681464-73681486 GGCAGGGCTAATCCAAAATGGGG + Intergenic
1142158017 16:88541555-88541577 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1143698272 17:8637062-8637084 GGCATGCATTATGCTAAATGAGG + Intergenic
1146494422 17:33308501-33308523 GGCTGGTCTTAGGCAAGATGAGG - Intronic
1149613248 17:57974304-57974326 GGCTGGGATTATTCAAAGTAGGG - Exonic
1153684342 18:7529942-7529964 GGCTGGCTTTATGGAAAAAGAGG - Intergenic
1156293502 18:35770435-35770457 GGCTGGGAGGATGCAGCATGGGG - Intergenic
1158956356 18:62543458-62543480 GGCTGAAATTCTGCAAACTGAGG - Intronic
1160027158 18:75227933-75227955 GATGGGGATTCTGCAAAATGGGG - Intronic
1160075273 18:75668418-75668440 GGCAGGTATTATACAAAGTGTGG - Intergenic
1164087199 19:21913681-21913703 GGCTGGGCATATCCAAAATGGGG + Intergenic
1165185755 19:34019589-34019611 TGGAGGGATTCTGCAAAATGAGG - Intergenic
1166081858 19:40448728-40448750 GGCTGGAATTATGCACAGTATGG + Intronic
1167108758 19:47446953-47446975 GGCTGGGATTTAGGAAAATGGGG - Intronic
925630640 2:5889497-5889519 GGATGGCATTATGAAAAAAGTGG + Intergenic
927017932 2:18986500-18986522 GGCTGGGGTCAAGAAAAATGGGG - Intergenic
929214673 2:39399343-39399365 GGCTAGGATTATGCTAAAACTGG + Intronic
930213881 2:48672939-48672961 GGCTTGGAGTAGGGAAAATGGGG - Intronic
934341357 2:92271228-92271250 GGCTGGGAGGAGGGAAAATGGGG + Intergenic
934405328 2:93296461-93296483 GACTGGGATTAAGAAAAATGGGG + Intergenic
938750747 2:134327407-134327429 GGCTGCTATTAAGCAAAATGAGG + Intronic
940146044 2:150544887-150544909 GGATGTGATTAAGCAACATGAGG + Intergenic
941313263 2:163961002-163961024 ACCTGGTATAATGCAAAATGTGG + Intergenic
942312333 2:174667341-174667363 GGGTGGGATCATGCAAGATCAGG + Intronic
943571901 2:189583209-189583231 GGCTGGGATTTTTAAAAAGGTGG - Intronic
945695046 2:213091674-213091696 GGCTGGATTTATGAAAGATGTGG + Intronic
946053347 2:216881574-216881596 GGCTGGGATCAGGCAACAGGTGG + Intergenic
946299474 2:218813929-218813951 GAGTGGGTGTATGCAAAATGTGG - Intronic
947414002 2:229874296-229874318 GACTAGGATTTGGCAAAATGAGG + Intronic
1171094984 20:22324064-22324086 GGTAGCGATTTTGCAAAATGTGG + Intergenic
1171890831 20:30713227-30713249 TCCTGGGACTATGCAAAATATGG + Intergenic
1177688639 21:24474090-24474112 GGTTTGGATTATGCCAAATGTGG + Intergenic
1178247425 21:30967458-30967480 GTCTGTGATTATACAACATGTGG - Intergenic
1178734975 21:35141045-35141067 GGCTGGGATTATGCAAAATGGGG + Intronic
1182664405 22:31946455-31946477 TGCTGGGATTATGCAGGCTGAGG + Intronic
950663685 3:14482303-14482325 GGCTGGGATGATCCTAAATTTGG - Intronic
951578550 3:24138056-24138078 GGCTGGTCTTATGCAAATCGTGG + Intronic
952765984 3:36954871-36954893 GGCTGTGCTCATTCAAAATGGGG - Intergenic
954306570 3:49729101-49729123 GGCTGGGAGGAGGGAAAATGAGG - Intronic
954894198 3:53961987-53962009 GGTTAGGATTATGGATAATGTGG + Intergenic
955613507 3:60782009-60782031 GGCTGGGAGTAGGGGAAATGGGG - Intronic
956170797 3:66431980-66432002 GACAGGCAGTATGCAAAATGGGG - Intronic
957376183 3:79361434-79361456 GGCTCTGGTTATGCAAAATTTGG - Intronic
958120432 3:89280402-89280424 GGTTGGGGTTAGGCAAAGTGTGG + Intronic
958670632 3:97199232-97199254 GGCTGCGATTTTGTAAAATAGGG + Intronic
959689635 3:109184671-109184693 GAATGGGATTATACAATATGTGG + Intergenic
960222703 3:115133530-115133552 GGCTGGGAGAAGGAAAAATGGGG - Intronic
960410777 3:117321525-117321547 GGGTGGGAAGGTGCAAAATGAGG + Intergenic
961406981 3:126686603-126686625 AGCAGGGATTATGGAAAGTGTGG - Intergenic
961617111 3:128191617-128191639 GGCTGGGAGTAGGGAGAATGGGG - Intronic
965214788 3:165848875-165848897 GGTTGGGAGTATACAATATGGGG - Intergenic
965606908 3:170506827-170506849 AGCTGGGAGTAGGCAAAAGGAGG + Intronic
967754606 3:193155287-193155309 GGCTGGGATTATTCAAAGTAGGG - Intergenic
968529765 4:1085391-1085413 TGCTAGGATTAACCAAAATGGGG - Intronic
970631180 4:17947396-17947418 GGCTGGGGGTATGGGAAATGGGG + Intronic
972138866 4:35930299-35930321 TGCTCGGATTATGTACAATGAGG - Intergenic
973858423 4:55036449-55036471 GGCTGGGAAGAAGCAAAGTGAGG + Intergenic
974876302 4:67707457-67707479 GGCTAAGATTATGCTAAATGGGG - Intergenic
976380429 4:84392656-84392678 GGCTGGGATCTCTCAAAATGTGG - Intergenic
977593411 4:98851527-98851549 GGCTTTTATTATGCGAAATGAGG + Intergenic
977685102 4:99838480-99838502 GGCTGGTTTTGTGGAAAATGCGG + Intronic
980026526 4:127774555-127774577 GGCTGTGAATGGGCAAAATGGGG + Intergenic
982575321 4:157102337-157102359 GGCTGGGGGTAGGGAAAATGGGG - Intronic
983258549 4:165429939-165429961 GGCTGGCCTCATGCCAAATGAGG - Intronic
984817168 4:183849536-183849558 GGCTGGCTTTATCTAAAATGTGG + Intergenic
987537959 5:19212523-19212545 AGCTAGTATTATGCTAAATGAGG + Intergenic
992651368 5:78864140-78864162 GGCTAGAATTATGCAAAAGAGGG + Intronic
995832378 5:116367627-116367649 GGCTGCAATTATGAAAAAGGAGG + Intronic
996317370 5:122175539-122175561 TGCTGGGATTATGCACTCTGGGG - Intronic
996929963 5:128874542-128874564 TGTTGAGATTATGCAAGATGAGG - Intronic
997032010 5:130141257-130141279 TGGTGGGATTATGCTTAATGAGG - Intronic
998054670 5:139064220-139064242 TGCTGGGAGTATCCAAACTGAGG - Intronic
998295406 5:140965472-140965494 TGCTGTCATTAAGCAAAATGTGG - Intronic
1002166421 5:177350305-177350327 GGCTGAGATTAGGCAAGCTGGGG + Intronic
1002881115 6:1253640-1253662 TGCTGAGATTATCCACAATGTGG - Intergenic
1006804232 6:36778017-36778039 GGCTGGGATTCTGCAGAATGAGG - Intronic
1007093619 6:39199996-39200018 GGCTGGGATTATGCAGGAAGAGG + Intronic
1009811082 6:68667883-68667905 AGCTGGGATTGTTCTAAATGTGG - Intronic
1009939340 6:70271381-70271403 GGCTGAGAGTCTGTAAAATGAGG + Intronic
1010675913 6:78742752-78742774 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1013433477 6:110077624-110077646 GCTTTGGATTCTGCAAAATGTGG + Intergenic
1013670086 6:112392164-112392186 GACTGGGATTATGGAAGATATGG + Intergenic
1017720372 6:157239479-157239501 GGCTGGGGTTATGCTCAAGGTGG + Intergenic
1017980741 6:159399174-159399196 GGCTGGCACTTTGCAAAATATGG + Intergenic
1018828663 6:167425208-167425230 GGATGGGACCATGTAAAATGGGG + Intergenic
1020153955 7:5706379-5706401 GGCTGGGAGAAGGCAAAGTGGGG - Intronic
1024747671 7:52427161-52427183 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1027500201 7:78940727-78940749 AGCTGGGATTAGGCAAGCTGTGG + Intronic
1030092808 7:105872707-105872729 GACTGGGATGATGGAAAATTTGG + Intronic
1033261363 7:139846704-139846726 GTCCAGGATTATTCAAAATGAGG - Intronic
1045169136 8:99644168-99644190 GGCTTGAAGTAAGCAAAATGAGG - Intronic
1045527414 8:102953074-102953096 GTGTGGGGTTATCCAAAATGAGG - Intronic
1047292656 8:123542973-123542995 GGATGTGATTATGAACAATGTGG + Intergenic
1047344155 8:124010885-124010907 TCCAGGGATTTTGCAAAATGAGG - Intronic
1050977800 9:11964232-11964254 GGCTGGAAATTTCCAAAATGTGG - Intergenic
1051858223 9:21594103-21594125 GGCTGGGGGTAGGGAAAATGGGG - Intergenic
1054358023 9:64082525-64082547 TCCTGGGACTATGCAAAATATGG - Intergenic
1055798738 9:80007032-80007054 GGCTGGGATGGTGCAAGAGGGGG - Intergenic
1186320430 X:8418197-8418219 TGCTGGGCATATGCAAAGTGAGG - Intergenic
1186680818 X:11871703-11871725 GGCTTAGAAGATGCAAAATGTGG + Intergenic
1188214752 X:27462789-27462811 GGCTGAGATCTTGAAAAATGAGG - Intergenic
1188385916 X:29557668-29557690 GGCTGAGAGTAGGGAAAATGGGG - Intronic
1188524564 X:31075146-31075168 GGCTGGCCTGATGCAAACTGGGG + Intergenic
1191641709 X:63434018-63434040 GGCTGGGAGGGTGAAAAATGTGG + Intergenic
1192455816 X:71274541-71274563 GGCTGGGAGGATGGGAAATGGGG - Intergenic
1195373931 X:104207065-104207087 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1195646946 X:107242911-107242933 GCCTGAGACTATGTAAAATGAGG + Intronic
1196918539 X:120562795-120562817 GGCTGGGAGTAAGGAAGATGAGG + Intronic
1198213748 X:134537959-134537981 GGCTGGACTTGTGTAAAATGAGG + Intergenic