ID: 1178736987

View in Genome Browser
Species Human (GRCh38)
Location 21:35161380-35161402
Sequence CTTACATTTCAAAGGGAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 171}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178736987_1178736992 16 Left 1178736987 21:35161380-35161402 CCAGGTTCCCTTTGAAATGTAAG 0: 1
1: 0
2: 1
3: 28
4: 171
Right 1178736992 21:35161419-35161441 CCCTGCTTAAAACTCTATTGTGG 0: 1
1: 0
2: 2
3: 25
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178736987 Original CRISPR CTTACATTTCAAAGGGAACC TGG (reversed) Intronic
901243551 1:7710297-7710319 CTTACATAAAAAAGGGAACTTGG + Intronic
901838302 1:11938249-11938271 CTTACTTAGCAAAGGGATCCTGG - Intronic
901885785 1:12222044-12222066 CTTACATTTCAAAACCAATCAGG + Intergenic
903396496 1:23005703-23005725 CTTATAATTAAAAGGGAAGCAGG + Intergenic
909023594 1:70459464-70459486 CTTACATTTCAATTTGCACCTGG - Intergenic
909867102 1:80686783-80686805 CTTATGTTTAAAAGGGAAGCAGG - Intergenic
911095957 1:94055252-94055274 CTTGCTCTTCAAAGCGAACCAGG + Exonic
919434542 1:197541543-197541565 CTCATGTTTCACAGGGAACCTGG + Intronic
919786638 1:201262333-201262355 CTTCCATTTCAAAGTGGAGCAGG - Intergenic
921729472 1:218561359-218561381 TTTACATTTCAAAGTGTTCCAGG + Intergenic
922238085 1:223736455-223736477 CTTGCCTTTCACAGGGATCCTGG + Intronic
922274809 1:224067484-224067506 CTCTCATTTCAAAGGTAATCAGG + Intergenic
922391844 1:225151709-225151731 CTTACATAGTAAAAGGAACCTGG - Intronic
923097085 1:230784176-230784198 TATACATTTAAAAGGGAAGCAGG + Intronic
923233011 1:232006631-232006653 CTTATGTTTAAAAGGGAAGCAGG + Intronic
1064136865 10:12758486-12758508 CTTACATTTCAAACTGCACCAGG - Intronic
1066422321 10:35274650-35274672 ATTACACTTGAAAGGGACCCGGG - Intronic
1068151164 10:53134012-53134034 CTTAGATTTCAAAAGGAATAGGG - Intergenic
1068645159 10:59457931-59457953 CTTACATTTAAAAGGAACACTGG + Intergenic
1072270387 10:93770525-93770547 CTCAGAGTTCAGAGGGAACCAGG - Intronic
1072723065 10:97792567-97792589 CTGACATTCTAAAGGGAAGCTGG + Intergenic
1074260427 10:111848200-111848222 CTTATATTTGAAAGGGAAGCAGG + Intergenic
1074970400 10:118531677-118531699 CTAACTTATCAAAGGGAGCCAGG + Intergenic
1076384957 10:130049154-130049176 CTGACATTGCAAAGGAAGCCCGG - Intergenic
1076454689 10:130581962-130581984 TTTGGATTTCAAATGGAACCTGG + Intergenic
1076474992 10:130745589-130745611 CTTACATGTGAAAGAGAAGCAGG + Intergenic
1077848987 11:6056190-6056212 CTTGCATTTTATAGGGAGCCAGG - Intergenic
1078747524 11:14129223-14129245 CTTATGTTTAAAAGGGAAGCAGG - Intronic
1079554377 11:21740756-21740778 CTTATATTTAAAGGGGAAGCAGG - Intergenic
1079750598 11:24191529-24191551 CTTATGTTTAAAAGGGAAGCAGG - Intergenic
1081667905 11:44927219-44927241 CTTACCTTTCAAGGGGACTCTGG - Intronic
1083790745 11:64983982-64984004 CTTATATTTAATAGGGAAGCTGG - Intergenic
1084494704 11:69497202-69497224 CCGGCATTTCAATGGGAACCTGG - Intergenic
1089371248 11:117960023-117960045 CTTACAATTCACAGGGAATTAGG + Intergenic
1089651854 11:119919807-119919829 ATGGCATTTCAAAGGGAACCTGG - Intergenic
1090090547 11:123693548-123693570 CTTACATTCCAATGAGAGCCAGG + Intergenic
1091552788 12:1549581-1549603 CTTAAATTTAAAAGGGAAGCAGG + Intronic
1093952413 12:25178606-25178628 CTTACAATTCAAATGTAAACAGG + Intronic
1094455576 12:30629036-30629058 CCTGCATTTCCAAGGTAACCAGG + Exonic
1094591796 12:31828466-31828488 CTTACACCTCCAAGGGAGCCTGG - Intergenic
1094823356 12:34245586-34245608 CTTACATTTCAAGAGTACCCAGG + Intergenic
1095091325 12:38109425-38109447 CTTACATTTCAAGAGTACCCAGG - Intergenic
1095838894 12:46670104-46670126 CTTATATTTAAAAGGGAAGCAGG - Intergenic
1098559165 12:71852526-71852548 CTTATATTTAAAAGGTAAGCAGG - Intronic
1099173955 12:79399085-79399107 GTAGCATTTCAAAGGAAACCAGG - Intronic
1100898771 12:99215109-99215131 CTTACGTTTAAAAGGGAAGCAGG + Intronic
1102227857 12:111241562-111241584 CTCCCCTTTCACAGGGAACCTGG - Intronic
1103239293 12:119399582-119399604 ATTATACTTCAAAGGGAATCTGG + Intronic
1107951820 13:45469370-45469392 CTGTCATTTCAAAGGGATCCAGG - Intronic
1109369576 13:61404708-61404730 GTTACAATTCCAAGGGAACTTGG - Intergenic
1109503655 13:63270591-63270613 CTTATATTTAAAAGGGAAGCAGG - Intergenic
1112825102 13:103382784-103382806 CTTATGTTTAAAAGGGAAGCAGG - Intergenic
1116123950 14:40757431-40757453 CATACATTTCAAAGAGAAAAAGG - Intergenic
1116684473 14:48019790-48019812 CTTACATTTCAGAGGCAAGGTGG - Intergenic
1117230377 14:53710962-53710984 TTCCCATTTGAAAGGGAACCTGG + Intergenic
1119308985 14:73630995-73631017 CTTACTTTTCAAAGAAAACAGGG + Intergenic
1120230482 14:81836128-81836150 CTTATATTTAAAAGGGAAACAGG + Intergenic
1121878089 14:97473212-97473234 CCTGCATTTCCAAGGTAACCAGG - Intergenic
1126612311 15:50542077-50542099 CTTAAATTTCTAAGGCAGCCTGG + Intronic
1128720801 15:69947048-69947070 CCTTCACTTCAAAGGGTACCAGG + Intergenic
1134097763 16:11430178-11430200 TTTACATTTTGAAGGGTACCGGG - Intronic
1134168871 16:11952467-11952489 TTTACATTTCAAATGGAAATAGG + Intronic
1135173589 16:20208663-20208685 TTTACATTTCAAAGCTCACCTGG - Intergenic
1138071852 16:54000306-54000328 CTCACATTTCAAAGAAAAACAGG + Intronic
1138315842 16:56069465-56069487 CATACATTTAAAAGGAAACAAGG - Intergenic
1138556697 16:57775117-57775139 CTTGCATCACAATGGGAACCTGG + Intronic
1143881773 17:10035387-10035409 CTTACATTTTAAAGGTTCCCGGG + Intronic
1148519757 17:48261552-48261574 CTTACATTTAAAAGGTCACCAGG - Intronic
1155456645 18:26022905-26022927 CTTACAATTCAAAGGGCATTGGG + Intronic
1156227360 18:35122728-35122750 CTCTCATCTCAAAGGGATCCAGG + Intronic
1156466580 18:37351495-37351517 CTTTCATATCAAAGGCAACCTGG - Intronic
1156914435 18:42448372-42448394 TTTATATTTCAAAGGGAAGCAGG - Intergenic
1157077191 18:44479069-44479091 CTTATGTTTAAAAGGGAAGCAGG + Intergenic
1157591870 18:48841131-48841153 CCTACATTTAAGAGGGCACCTGG + Intronic
1158381947 18:56941467-56941489 CTTGAATTGCAGAGGGAACCAGG + Intronic
1158480156 18:57814829-57814851 CTTAGTTTTCAAAGGGAGCTTGG - Intergenic
1159395696 18:67853217-67853239 CTTATGTTTAAAAGGGAAGCAGG - Intergenic
1164797569 19:31046384-31046406 CTTTCATTTCACTGGGATCCTGG - Intergenic
1167819270 19:51911109-51911131 CTTACATTTCAAAAGAATTCAGG - Intronic
927059756 2:19405942-19405964 CTTACATTACAAATGGAGCGAGG + Intergenic
929639276 2:43559902-43559924 ATTACATGTCCAAGGGAACAGGG + Intronic
930119320 2:47747288-47747310 CTTATATTGAAAAGGGAAGCAGG + Intronic
930790299 2:55319483-55319505 CAAATATTTCAAAGGGAAGCAGG + Intronic
932320280 2:70817191-70817213 CTAACATTTCCAAGGGAAATGGG + Intronic
932648580 2:73531187-73531209 CTTATGTTTAAAAGGGAAGCAGG - Intronic
935798666 2:106670811-106670833 CTTATATTTGAAAGAGAAGCAGG + Intergenic
938678766 2:133667162-133667184 TTTGCATTTCAAAGAGAAGCAGG - Intergenic
939355088 2:141091303-141091325 CTTACGTTTCAAAAGGATCAAGG + Intronic
939812619 2:146853279-146853301 CTTACAGTTAAAAGGGAAACAGG + Intergenic
940018837 2:149135296-149135318 TTGACATTACAAAGGGACCCTGG - Intronic
940121966 2:150277143-150277165 CTTATATTTAAAAGGAAAGCAGG - Intergenic
940382637 2:153033269-153033291 CATGCATCTCCAAGGGAACCAGG + Intergenic
942018950 2:171847811-171847833 CTTCCATTGAAAAGGGAACTGGG + Intronic
944785015 2:203061266-203061288 CTTAGTTTTCAAAGGGAACTGGG + Intronic
948057394 2:235018809-235018831 CTTACCTTCCAGAGGGAGCCAGG + Intronic
1169698889 20:8424336-8424358 TTTACATTTGAAAGGCAACAGGG + Intronic
1170714698 20:18821553-18821575 CTTGCATTTGAAGGGGCACCAGG + Intronic
1172412777 20:34738482-34738504 CTAAGAATTAAAAGGGAACCTGG - Intronic
1178363663 21:31970401-31970423 CTTAGGTTACCAAGGGAACCTGG + Intronic
1178736987 21:35161380-35161402 CTTACATTTCAAAGGGAACCTGG - Intronic
1180922313 22:19527279-19527301 GTGACATTTCACAGGGATCCGGG + Exonic
1182810129 22:33109132-33109154 GTCACATTTCAAAGGTCACCTGG + Intergenic
1183756744 22:39774233-39774255 TTTACATTTCACAGGAAACAGGG - Intronic
1183773689 22:39948460-39948482 CTTCCATTACAAAGAGAACCTGG + Intronic
1184205845 22:43002108-43002130 CAAGCATCTCAAAGGGAACCTGG - Intronic
1184832306 22:46996509-46996531 CTTACATGGCAAGGGGAACCAGG - Intronic
951098273 3:18656785-18656807 CTGCCATTTCAAAAAGAACCAGG - Intergenic
952718304 3:36505305-36505327 CTAGTATATCAAAGGGAACCAGG - Intronic
953750300 3:45603522-45603544 CTTCCATGTCAATGGAAACCTGG - Intronic
956564080 3:70615682-70615704 CTTACATTTAAAAGAAAAGCAGG - Intergenic
956644275 3:71440942-71440964 CTCACATTTTAAAGTGAAACTGG + Intronic
956681199 3:71783631-71783653 CTTATATTGCAAAGGGATCTTGG + Intronic
956706560 3:72004176-72004198 ATTACATTTCAAAGAGAAAGAGG + Intergenic
958419575 3:93915097-93915119 TTTACAATTAAAAGGGAATCAGG - Intronic
959540235 3:107528895-107528917 CTTACATTTCATAAAGAACATGG + Intronic
959749486 3:109816342-109816364 CTTTCATTTCAAATGGAAACAGG - Intergenic
964055739 3:152454563-152454585 TTTACATGTCAAAGAGAACAAGG + Intronic
964104667 3:153026359-153026381 CTTACCTTTCAAAAGGACACAGG - Intergenic
964426292 3:156557416-156557438 CTTGCTTTTTAAAGGGAACTAGG - Intergenic
964544355 3:157817205-157817227 TTTGCATTTCAAAAAGAACCTGG - Intergenic
966348447 3:179004239-179004261 CTTACAGTTGAAAGGAAAACTGG + Intergenic
966972743 3:185060597-185060619 CTTATATTTAAAAGGGAAGCAGG + Intergenic
968534493 4:1114224-1114246 CTTCCGTTTCAGAGGGAAGCAGG - Intergenic
969167688 4:5330991-5331013 CTTACATAGCAAAGGCAAGCAGG - Intronic
971743738 4:30552170-30552192 CTTACATTTCAGAACCAACCAGG - Intergenic
971773038 4:30924195-30924217 CTTACATAGCAAAGGCAAACTGG - Intronic
972101917 4:35431207-35431229 CTTATGTTTAAAAGGGAAGCAGG + Intergenic
972824058 4:42736363-42736385 CTTTCATTTCATAGGGAAAATGG + Intergenic
974806038 4:66882384-66882406 CTTATGTTTCAAAGGGAAGCAGG + Intergenic
975050135 4:69852833-69852855 CTTACTTCTCAAATGGAAACAGG - Intronic
978649780 4:110986764-110986786 CTTAGATTTCAACAGGATCCAGG + Intergenic
982851539 4:160322833-160322855 CTTTCATTTAATAGGGCACCGGG - Intergenic
986017325 5:3768778-3768800 CTTTCTTTCCAAAGGGACCCAGG + Intergenic
988272390 5:29033331-29033353 CTTATATTTAAAAGGGATGCAGG - Intergenic
988931086 5:36036102-36036124 ATTAAATTTCAAGGGGAACCAGG - Intronic
989515744 5:42340361-42340383 CTTATGTTTTAAAGGGAAGCAGG - Intergenic
992128428 5:73666506-73666528 CCTACATTTCAAAGGACACGTGG - Intronic
993130009 5:83884609-83884631 CTTACATTTCATAGGGGGCTGGG - Intergenic
993324703 5:86518844-86518866 CCTACATTACAAAGAAAACCAGG - Intergenic
993574704 5:89586863-89586885 CTTAGATTTTAAAGGATACCAGG - Intergenic
994019222 5:95004289-95004311 CTTATATTTAAAAGGGAAGCAGG + Intronic
995491520 5:112697217-112697239 CTTTCATTTTAAAGTAAACCTGG + Intergenic
998775684 5:145598957-145598979 CATATATTTCAAAGGCAACATGG + Intronic
1001102735 5:168827635-168827657 CTTACATGGCAAAAGGGACCTGG - Intronic
1003792648 6:9564394-9564416 TATAGATTTCAAAGGGAAGCAGG - Intergenic
1004165952 6:13256499-13256521 CTTACATTTAAAGGGGAAACAGG - Intronic
1004205295 6:13586882-13586904 CTTAAATATTAAAGGGAACGTGG - Intronic
1007745780 6:44042289-44042311 CTTGAAGTTCAGAGGGAACCTGG - Intergenic
1008311514 6:49981240-49981262 TTTACATTTCAAAGGAAAAGGGG - Intergenic
1008434957 6:51465213-51465235 CTGGCATTTCCAAGGGTACCTGG + Intergenic
1010486620 6:76422126-76422148 CTTACTTATAAAATGGAACCTGG - Intergenic
1011979259 6:93351754-93351776 TTTACATTTCAAAAAGTACCAGG + Intronic
1013644524 6:112123379-112123401 CTGACATTTCAATGGGAATAGGG - Intronic
1014892030 6:126854589-126854611 TATACCTTTCAAAGGGAAGCAGG + Intergenic
1015045244 6:128768623-128768645 CTTATATTTAAAAGTGAAGCAGG - Intergenic
1016683733 6:146858139-146858161 CTTGCTTTTAAAAGGGAGCCAGG + Intergenic
1016732124 6:147438495-147438517 CTTACATTTCAAATGTAATGAGG - Intergenic
1017179399 6:151536131-151536153 CTCAAAGTTCAAAGGGAAGCAGG - Intronic
1017750778 6:157488584-157488606 CTTTCATTGCAAAGTGTACCTGG + Intronic
1017848515 6:158281543-158281565 GTTACATTTCACAGCGAAGCAGG + Intronic
1018823439 6:167391796-167391818 GTTTCATATCAAAGGGATCCAGG - Intergenic
1020647946 7:10838297-10838319 CTTACATTTAAAAAAGAACTTGG - Intergenic
1021062575 7:16131880-16131902 CTTAAATTTCAAAGGTCATCAGG + Intronic
1024232743 7:47375085-47375107 CTTCCATCTCAAAGGGAGCATGG + Intronic
1030216606 7:107049513-107049535 TTTACAGTTCAAAGGGAATTTGG + Intronic
1030311952 7:108077839-108077861 CTTACATTTCAAAGCCACCTGGG + Intronic
1031732808 7:125319532-125319554 CTTATATTTAAAAGGGAAGCAGG + Intergenic
1031872457 7:127102211-127102233 CTTATATTTAAAAGGGAAGCAGG + Intronic
1032560915 7:132892415-132892437 CTTATGTTTAAAAGGGAAGCAGG + Intronic
1034689968 7:153006530-153006552 CTTTCATGTCAGAGGGGACCAGG + Intergenic
1036001586 8:4611001-4611023 GTTACATTTCTAAGGGAAAAAGG - Intronic
1037492573 8:19410108-19410130 CTTACATTCCACAGGGAATGGGG + Intronic
1039532452 8:38275754-38275776 CTTCCAGTGCAGAGGGAACCAGG + Exonic
1043587069 8:81781793-81781815 CTTACATGCCAAAAGGAACTTGG - Intergenic
1045132974 8:99178302-99178324 CTTACATTTCAAGGGGAGGGGGG - Intronic
1045559170 8:103244387-103244409 CTTAGATATCAAAGGGACCAGGG + Intergenic
1045706676 8:104931483-104931505 CTTACAATTTAAAGGGGAACTGG - Intronic
1045935528 8:107674420-107674442 CTTACTTTTCAAATGGACTCTGG + Intergenic
1047280203 8:123438981-123439003 CTCACATCTCAAGGGGAAACAGG - Intronic
1047938764 8:129807422-129807444 CTTACATTTAAAAGGGAAACAGG + Intergenic
1048726475 8:137390973-137390995 CTTACATCTCAGAGGGCACAAGG + Intergenic
1050972916 9:11899779-11899801 ATTACATTTCAAAGGGAAAGAGG + Intergenic
1051863500 9:21652343-21652365 CTGACATTTGAATGGGAACTTGG + Intergenic
1056712337 9:89001123-89001145 CATTCATTTCAAAGGGAAGCGGG - Exonic
1057116582 9:92528635-92528657 CTTACAATTCACAGGGCATCTGG + Intronic
1057484695 9:95473452-95473474 AATACATTTAAAAGAGAACCAGG + Intronic
1059604898 9:115824156-115824178 CTTCTATTTAAAAGGGAAGCAGG + Intergenic
1060204019 9:121671435-121671457 CTTACATGGCAAAAGGAACTTGG - Intronic
1060283010 9:122226668-122226690 CTTATTTTTCAGACGGAACCCGG + Intronic
1186167570 X:6843246-6843268 CTTACATTCCCAAGGGCTCCAGG - Intergenic
1186206798 X:7209062-7209084 CTTACATGGCAAAGGGCACTTGG - Intergenic
1187042098 X:15607784-15607806 CTTACATTTAAAAGAAATCCTGG + Intergenic
1193077652 X:77372449-77372471 CATACCTTTCTAAGGGAACATGG - Intergenic
1193948366 X:87765731-87765753 TTTATATTTAAAAGGGAAGCAGG - Intergenic
1194943603 X:100041880-100041902 CTTATATTTAAAAGGGAAGCAGG - Intergenic
1195822010 X:108956159-108956181 CTTATGTTTAAAAGGGAAGCAGG + Intergenic
1197440049 X:126476462-126476484 CTTGTATTTAAAAGGGAAGCAGG - Intergenic
1198874137 X:141204511-141204533 CTTATATTTAAAAGGGAAGCAGG - Intergenic
1199112757 X:143954891-143954913 CTTATGTTTAAAAGGGAAGCAGG + Intergenic
1199318892 X:146414939-146414961 CTTACATGCCAAAAGGAACATGG + Intergenic
1201578669 Y:15488207-15488229 CTTACATGGCAAAGGGCACTTGG - Intergenic