ID: 1178737452

View in Genome Browser
Species Human (GRCh38)
Location 21:35165903-35165925
Sequence CTGGCTTGCAACTCCTACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 113}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178737446_1178737452 5 Left 1178737446 21:35165875-35165897 CCCTTGAGGAGAAAACACCTGGG 0: 1
1: 0
2: 1
3: 12
4: 183
Right 1178737452 21:35165903-35165925 CTGGCTTGCAACTCCTACTCTGG 0: 1
1: 0
2: 2
3: 11
4: 113
1178737448_1178737452 4 Left 1178737448 21:35165876-35165898 CCTTGAGGAGAAAACACCTGGGA 0: 1
1: 0
2: 0
3: 24
4: 276
Right 1178737452 21:35165903-35165925 CTGGCTTGCAACTCCTACTCTGG 0: 1
1: 0
2: 2
3: 11
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178737452 Original CRISPR CTGGCTTGCAACTCCTACTC TGG Intronic
903368479 1:22819274-22819296 CTGCCTTGAAACTCCATCTCCGG + Intronic
905277905 1:36830893-36830915 CTGGCTTGTATCTGCTATTCCGG - Intronic
907069120 1:51518717-51518739 CTGGAAGGCAACTCCTACTGGGG + Intronic
909289814 1:73867980-73868002 TTTGCTAGCAAATCCTACTCAGG + Intergenic
909295799 1:73947133-73947155 CTGGCTTGGGTCTCATACTCTGG - Intergenic
909828412 1:80154563-80154585 CTAACTTGCAGCTCCCACTCAGG - Intergenic
910987162 1:93016715-93016737 CTGGCCTGCAAATCCAACTCTGG + Intergenic
911265950 1:95743271-95743293 CTAGCTTGCAGCTCCCACTTGGG - Intergenic
912033178 1:105275047-105275069 CTAGCTTGCAGCTCCCGCTCAGG - Intergenic
912651556 1:111443958-111443980 CTGGCCTGCAACTGCTCCTTTGG - Intronic
914935806 1:151979047-151979069 CTGGCCAGTAACTCCTACTCTGG + Intergenic
917961696 1:180150827-180150849 CTAGCCCCCAACTCCTACTCAGG + Intergenic
919277840 1:195444576-195444598 CTAGATTGCAGCTTCTACTCCGG + Intergenic
1062812128 10:474888-474910 CTGGCTTGCAGCTCCTCCAGTGG - Intronic
1063726535 10:8643133-8643155 CTGGCTTGGAACACATATTCAGG + Intergenic
1065353782 10:24819310-24819332 CTGGTCTCCAACTCCTGCTCAGG + Intergenic
1067303713 10:45038285-45038307 CTAACTTGCAGCTCCCACTCAGG + Intergenic
1068301823 10:55153297-55153319 CTGGATTTCACCTCCCACTCAGG - Intronic
1070022340 10:72599160-72599182 CTGGCTTGCAGCTCTCACCCTGG + Intronic
1070780972 10:79137454-79137476 CTGGCCTGCCACACCTAGTCCGG - Intronic
1073773290 10:106759067-106759089 CTGGCTTTCAACTCCCACAGGGG + Intronic
1076259962 10:129057653-129057675 CTGGTCTCAAACTCCTACTCAGG + Intergenic
1078198145 11:9153858-9153880 CAGGCTTGCAAATACTATTCAGG - Intronic
1081729690 11:45361595-45361617 CTGTCTTCCCACTCCCACTCAGG + Intergenic
1083505787 11:63156409-63156431 CTGGCCTGCAACTCCCCCACTGG + Intronic
1088096850 11:106110789-106110811 CTGGCTTTCAAAGCCTACTACGG - Intergenic
1088349576 11:108870441-108870463 CTAGCTTCCAGCTCCTTCTCTGG + Intronic
1089361476 11:117890780-117890802 CTAGCTGGCCATTCCTACTCCGG - Intergenic
1090764336 11:129863831-129863853 CTGGTTTGCAACTCTTGCTCTGG + Intronic
1092190675 12:6517793-6517815 ATGGCTTCCCACTCCTCCTCTGG - Exonic
1092664769 12:10783832-10783854 ATGGTTTGCAAGTCCTGCTCAGG - Intergenic
1096478153 12:51921189-51921211 CTGGCTTGGCACTCTGACTCTGG - Intronic
1102672313 12:114630548-114630570 CTGGCATGCAACCCCACCTCTGG - Intergenic
1102800612 12:115730052-115730074 TGGGCATGCTACTCCTACTCAGG - Intergenic
1112392420 13:98997712-98997734 CTGGCTTGCAATTCCAGCCCTGG + Intronic
1112997977 13:105597679-105597701 CTGTCTTGCAACACCTGCACTGG + Intergenic
1117880641 14:60310060-60310082 CTGCCTTTGAACTGCTACTCTGG - Intergenic
1118633483 14:67726709-67726731 CTGGCTTCCAACTCCCACTCTGG - Intronic
1128305381 15:66594819-66594841 CTGGCTGCCACCTCCTAGTCTGG - Intronic
1129175636 15:73837967-73837989 CTGCCTTGCAGCTCCTCCCCAGG + Intergenic
1130134868 15:81174126-81174148 CAGGCTAGGAATTCCTACTCAGG - Intronic
1132657413 16:1047026-1047048 CTGGCACGGAACTCCTGCTCTGG - Intergenic
1133216975 16:4298523-4298545 CTGGCTTGCATCTCCCAGCCAGG - Intergenic
1136359365 16:29768367-29768389 CTGGTCTCCAACTCCTAATCTGG - Intergenic
1136572949 16:31107683-31107705 CTCCCTTGCAAGTCCTACTCAGG + Intronic
1139373144 16:66480677-66480699 CTGGATGGCACCTCCGACTCAGG + Exonic
1143020284 17:3914044-3914066 CAGGCTTCCAGCTCCTGCTCAGG - Intronic
1144811762 17:18004944-18004966 CTGCCTTGTAACACATACTCTGG - Intronic
1145944331 17:28761628-28761650 CTGGTTAGCAACTCCTGCTCTGG + Intronic
1146658306 17:34648304-34648326 CTGCCTTGGAGCTGCTACTCTGG - Intergenic
1152256923 17:79245267-79245289 CTGGTTTGGAACTCCTAATGGGG + Intronic
1156936284 18:42712758-42712780 CTAGCTTGCAGCTCCCACTTGGG - Intergenic
1157927177 18:51779316-51779338 CAGTCTTCCAACTCCTCCTCAGG - Intergenic
1162512598 19:11128585-11128607 GTGGCTTGCACCAGCTACTCAGG - Intronic
1162606066 19:11709014-11709036 CTATCTTGCAACTACTACTGTGG + Intergenic
927171633 2:20375291-20375313 CTGGCTTCCAGCTCCAACACTGG + Intergenic
927177278 2:20419627-20419649 CTGGCTTCCAGCTCCAACACTGG + Intergenic
927323928 2:21781145-21781167 CAGGCCTGCAGCTCCTCCTCTGG + Intergenic
927432480 2:23038765-23038787 CTGCTTAGGAACTCCTACTCTGG - Intergenic
928586179 2:32760872-32760894 CTCGCTGGCAGCTCCTTCTCAGG + Intronic
935135153 2:100293606-100293628 CTGGCTTGCAACACCCTCTCTGG + Intronic
939272058 2:139952019-139952041 CTGGCTTTCAAACCCTACTAAGG + Intergenic
943129550 2:183839190-183839212 CTAGATTGCAGCTCCAACTCAGG + Intergenic
946493634 2:220173608-220173630 GTGGCTTGCAACACCTACTCCGG - Intergenic
1169779660 20:9295254-9295276 ATGGCTAGCACCTCCTACTAAGG + Intronic
1172582671 20:36060757-36060779 CTGGCTTGTAACAATTACTCAGG - Intergenic
1177437082 21:21069421-21069443 TTGGTTTGCAATTACTACTCTGG - Intronic
1177797832 21:25797727-25797749 CTGGTCTCAAACTCCTACTCAGG - Intergenic
1178737452 21:35165903-35165925 CTGGCTTGCAACTCCTACTCTGG + Intronic
1178802626 21:35810416-35810438 TTGGCATGCAACTCCTCCCCTGG + Intronic
949777227 3:7646775-7646797 CTGGATTGCAATTCCTCTTCAGG + Intronic
952953930 3:38545048-38545070 CTGGCCTGCAACCCTTCCTCTGG - Intergenic
954013605 3:47665151-47665173 CTGGGTTCCAACTGCTGCTCAGG + Intronic
954442076 3:50527403-50527425 CTGACTGGCAACACCTCCTCTGG + Intergenic
954643850 3:52118653-52118675 CTGGCTTTCGACTGCTACGCTGG + Intronic
955756059 3:62226204-62226226 CAGGCATGCTACTCCTCCTCTGG - Intronic
956336377 3:68168539-68168561 CTGGATTTCAACTCCTAGACTGG - Intronic
959880554 3:111440234-111440256 ATGACTTGCAGCCCCTACTCAGG - Intronic
961157717 3:124694570-124694592 CTGGGGTGCAACTTCTGCTCTGG + Intronic
962323071 3:134407137-134407159 CTCGCTCCCAACTCCGACTCAGG - Intergenic
962676554 3:137762433-137762455 GTCGCTGGCAACCCCTACTCAGG - Intergenic
970035301 4:11728018-11728040 CTGGCTTCAAACTCCCACCCAGG - Intergenic
973570745 4:52236999-52237021 CAGGCTTGCAACCTCCACTCTGG - Intergenic
977907437 4:102494138-102494160 CTGGCTTGCTAGTACTACTAGGG - Intergenic
979120913 4:116899876-116899898 CTGCCTTCCAACTCCAACTGTGG + Intergenic
982152559 4:152477115-152477137 CTGTCCTTCAACTCCAACTCAGG + Intronic
984648724 4:182246525-182246547 CTGGATTCAAACTACTACTCCGG - Intronic
986633915 5:9801419-9801441 CTAGCTTGCAGCTCCCACTCAGG + Intergenic
988642404 5:33055511-33055533 GTGGCTGGCAACTCCAACTAAGG + Intergenic
992522463 5:77568820-77568842 CTGGCTTCCCACACCTAATCTGG + Intronic
993740891 5:91538017-91538039 CTGGCTTGCAACACAGAATCAGG - Intergenic
996704830 5:126486592-126486614 CTGGCTTGGTACTCCAACTTGGG + Intronic
997199443 5:132000888-132000910 CAGGCTTGCAACACCTTCCCTGG + Intronic
999516184 5:152303919-152303941 CAGGCTGGCAACTCCTCCACTGG + Intergenic
1000258733 5:159565656-159565678 CTAACTTGCAGCTCCCACTCAGG + Intergenic
1004444323 6:15684382-15684404 CTGGTTAGAAAATCCTACTCTGG + Intergenic
1004865789 6:19852956-19852978 CAGGCTTGCAAATCGTATTCTGG - Intergenic
1004888466 6:20074435-20074457 TTAGCTTGCAGCTCCCACTCAGG + Intergenic
1013621796 6:111897473-111897495 CTTGGTTCCAAGTCCTACTCTGG - Intergenic
1013856400 6:114578762-114578784 CTGCCATGCAACTCCTAATCGGG - Intergenic
1015066195 6:129032032-129032054 CTGGTCTTGAACTCCTACTCAGG + Intronic
1016216375 6:141608357-141608379 CTAACTTGCAGCTCCCACTCAGG - Intergenic
1016239158 6:141908313-141908335 CTGCCTTTCAGCTGCTACTCTGG - Intergenic
1016256020 6:142106295-142106317 CTGGCTTGCAGTTGCTAGTCTGG + Intergenic
1018372322 6:163179487-163179509 CTGGCCTGGAACTCCTTCCCGGG - Intronic
1023488631 7:40713568-40713590 CTGCCTTGCAAGTCCTACCAAGG + Intronic
1024082640 7:45867728-45867750 CTGGCTTGCAGCTTCTTCCCAGG + Intergenic
1026475153 7:70728837-70728859 CTGCCTTGGCACTCTTACTCAGG - Intronic
1026942133 7:74293286-74293308 CTGGCAGGCAGCTCCTCCTCTGG + Intronic
1028962301 7:96762231-96762253 CTAGATTGCAACTCTGACTCAGG - Intergenic
1033595540 7:142855672-142855694 CTGGCTTGGGAGTCCTAATCTGG + Intronic
1034353702 7:150434170-150434192 CAGGCCTGCCGCTCCTACTCAGG + Intergenic
1036220928 8:6921185-6921207 CTGGCCTGCAGCTCCTCCCCGGG - Intergenic
1039846081 8:41326514-41326536 CAGGGTGGCAACTCCAACTCTGG + Intergenic
1042683667 8:71414111-71414133 CTGGCCTGTAGCTCCTACTCAGG - Intronic
1043876558 8:85492595-85492617 CTAGCTTGCAGCTCCTGCTCAGG - Intergenic
1047890501 8:129303350-129303372 CTAGCTTGCAGCTCCCATTCGGG - Intergenic
1048884843 8:138901803-138901825 CTGGCTTGCACCTACCTCTCCGG + Intronic
1055244128 9:74219942-74219964 CTGTCTTGCAGCTCCCACTCAGG + Intergenic
1057111299 9:92473917-92473939 CTGGCACACAACTCCCACTCAGG - Intronic
1058636230 9:107041227-107041249 AAGGCTTGCATCTCATACTCCGG - Intergenic
1060034151 9:120240712-120240734 CTGCCTTGCAACTCTTACAAAGG + Intergenic
1060827521 9:126695407-126695429 CTGGCTTGCCTCCCCTGCTCTGG + Intronic
1186816028 X:13238925-13238947 CCAGCTTGTAATTCCTACTCTGG - Intergenic
1187494379 X:19781978-19782000 CTGAATTGCTACTCCTACTGTGG + Intronic
1188964960 X:36539611-36539633 CTGGATTCCAATTCCTGCTCTGG - Intergenic
1200296834 X:154928450-154928472 GTGTCTTGAAACTCTTACTCTGG - Intronic