ID: 1178743463

View in Genome Browser
Species Human (GRCh38)
Location 21:35225006-35225028
Sequence TCCCCTAAATGGCAATGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 80}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178743463_1178743468 10 Left 1178743463 21:35225006-35225028 CCAGCTCATTGCCATTTAGGGGA 0: 1
1: 0
2: 0
3: 9
4: 80
Right 1178743468 21:35225039-35225061 CGAGCACACCTGGGTGGTGATGG 0: 1
1: 0
2: 2
3: 9
4: 147
1178743463_1178743467 4 Left 1178743463 21:35225006-35225028 CCAGCTCATTGCCATTTAGGGGA 0: 1
1: 0
2: 0
3: 9
4: 80
Right 1178743467 21:35225033-35225055 GAAAGACGAGCACACCTGGGTGG 0: 1
1: 0
2: 2
3: 17
4: 117
1178743463_1178743466 1 Left 1178743463 21:35225006-35225028 CCAGCTCATTGCCATTTAGGGGA 0: 1
1: 0
2: 0
3: 9
4: 80
Right 1178743466 21:35225030-35225052 TCTGAAAGACGAGCACACCTGGG 0: 1
1: 0
2: 0
3: 6
4: 57
1178743463_1178743465 0 Left 1178743463 21:35225006-35225028 CCAGCTCATTGCCATTTAGGGGA 0: 1
1: 0
2: 0
3: 9
4: 80
Right 1178743465 21:35225029-35225051 GTCTGAAAGACGAGCACACCTGG 0: 1
1: 0
2: 0
3: 5
4: 70
1178743463_1178743469 16 Left 1178743463 21:35225006-35225028 CCAGCTCATTGCCATTTAGGGGA 0: 1
1: 0
2: 0
3: 9
4: 80
Right 1178743469 21:35225045-35225067 CACCTGGGTGGTGATGGCTATGG 0: 1
1: 0
2: 1
3: 21
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178743463 Original CRISPR TCCCCTAAATGGCAATGAGC TGG (reversed) Intronic
901381898 1:8879546-8879568 TTCCCTAGATGGGAATGAGAGGG - Intergenic
906211669 1:44015746-44015768 TCACCTACATGGCACTGAGTAGG + Intronic
909743858 1:79067987-79068009 TCCCCTAACTGACAAGGAGAGGG - Intergenic
909769805 1:79407338-79407360 TACCATAAATGGCAATGTGATGG - Intergenic
910917327 1:92303958-92303980 TCCCCTAAAATGAAATGAGAGGG - Exonic
911583276 1:99660002-99660024 AGCCCAAACTGGCAATGAGCAGG + Intronic
919703710 1:200656602-200656624 TTCCTTAAATGCCAAGGAGCTGG + Intronic
924633410 1:245763253-245763275 TCCCTTGCATGGCACTGAGCTGG + Intronic
1062854489 10:772960-772982 TTCCATGAATGGCAAGGAGCAGG - Intergenic
1065348513 10:24773136-24773158 TCCCCTAAATGGGAAGGAAATGG - Intergenic
1076453935 10:130576217-130576239 TCCCCTGAATGAGAAGGAGCCGG - Intergenic
1078459886 11:11506437-11506459 TCCCCCAAATAGCTATGAGGGGG + Intronic
1081569087 11:44278521-44278543 TCCCCTGAAAGGCCAAGAGCTGG - Intronic
1085982239 11:81738267-81738289 ACCCCTAAATGGTAATAAACTGG + Intergenic
1086999734 11:93404068-93404090 TTCTCTAAGTGGAAATGAGCAGG - Intronic
1098258734 12:68645882-68645904 TCCCCAAACTGGAAATCAGCTGG + Intronic
1105786007 13:23749962-23749984 TCCCCCAAGTGGCAATGAAAAGG + Intronic
1109117711 13:58409799-58409821 TACCCTAAATGGCAGGGAGAGGG - Intergenic
1110042746 13:70785814-70785836 TCCCTTGAATGGCATTGAACTGG + Intergenic
1113339469 13:109408113-109408135 TCCCATGAATGGGAATGAGCAGG - Intergenic
1121292876 14:92791895-92791917 TCCAAAAAATGGCAATGGGCAGG - Intergenic
1121404269 14:93709537-93709559 GCCCCTGAAAGGCACTGAGCTGG + Intergenic
1125108574 15:36003775-36003797 TCCCCAAAATGTCCATGAGCAGG + Intergenic
1126584724 15:50272627-50272649 CCCCCAAAATGGCCATGAACTGG + Intergenic
1132351154 15:101140572-101140594 TCCCCTCCAGGGCAATGAGCTGG + Intergenic
1135001004 16:18776534-18776556 TCCCCTAACTGACAAAGAGAAGG + Intergenic
1139349007 16:66323565-66323587 TCCCCCAAAACCCAATGAGCAGG + Intergenic
1145797783 17:27666012-27666034 TCCACGAAATTGGAATGAGCAGG + Intergenic
1145812230 17:27771348-27771370 TCCACAAAATTGGAATGAGCAGG + Intronic
1146314892 17:31798962-31798984 TCCCCTCAAAGGCAAGGACCAGG + Intergenic
1148330848 17:46813102-46813124 TGACCTAAATCGCAAAGAGCTGG - Intronic
1149845416 17:60006680-60006702 TCCCCAAAATTGGAATGAGCAGG + Intergenic
1150083764 17:62263263-62263285 TCCCCAAAATTGGAATGAGCAGG + Intergenic
1154217038 18:12423067-12423089 TCCCCTAAGTGGCCATGTGAAGG + Intronic
1154960722 18:21305838-21305860 GCCCCTAGCTGGGAATGAGCTGG - Intronic
1160021391 18:75184434-75184456 ACACATAAATGGCAATGAACAGG - Intergenic
1160967059 19:1751344-1751366 TCCCCCAAATGCCAATGTGGGGG - Intergenic
1162225472 19:9217837-9217859 TCCCCTAATTAACAATGATCCGG - Intergenic
1164477440 19:28586309-28586331 TCTCCTAAATGGCTCTGAGGGGG + Intergenic
928264285 2:29798281-29798303 TTCCCAAAATGGAAAGGAGCTGG - Intronic
932318360 2:70801599-70801621 TCCCCTAAAGCACAATGAGTGGG + Intergenic
932504397 2:72214717-72214739 TCCCATCAATGGCATTGATCTGG - Intronic
932775847 2:74527974-74527996 TCCCCTAGTTGGCGATGAACAGG + Exonic
936461915 2:112720625-112720647 TTCTCTAAATGGCCTTGAGCTGG + Intergenic
937683273 2:124667462-124667484 TGACCAAAATGGCAAGGAGCAGG - Intronic
939668507 2:144980265-144980287 TCCCCTAATTGGAAGTGAGTAGG - Intergenic
941727702 2:168881475-168881497 TCCCCAAAATGCCAATCAGGGGG + Intronic
943257890 2:185619477-185619499 TACCCTAAATTGCAACGAGAAGG - Intergenic
946130827 2:217605359-217605381 TGCCCCAAATGGCAGAGAGCAGG - Intronic
947682422 2:232046782-232046804 TCCCCAAAATGGGAAGGAGGTGG - Intronic
1168989374 20:2081098-2081120 TCCCCTAACAGGCAATGGACTGG - Intergenic
1169020063 20:2323878-2323900 GCCCATAAATAGCAACGAGCAGG - Intronic
1178666042 21:34547342-34547364 TCCCATACATGGCAGTGAGCAGG - Intronic
1178743463 21:35225006-35225028 TCCCCTAAATGGCAATGAGCTGG - Intronic
1182396791 22:30041851-30041873 TCCCCTAACTGTAAGTGAGCAGG - Intergenic
1183262882 22:36807293-36807315 TCCCCTAAACCTCATTGAGCTGG + Intronic
1183771112 22:39926807-39926829 TCCCCTAATTGGCAGTGATCAGG - Intronic
1184596863 22:45519171-45519193 CCCCAAAAATGCCAATGAGCCGG + Intronic
1185068864 22:48645453-48645475 TCCCCTAAATTCCAAGGAGAAGG - Intronic
951654022 3:24984211-24984233 TAACCTAAATGGCAAAGAACAGG + Intergenic
952531777 3:34270196-34270218 TGCCCTAAATCACACTGAGCAGG + Intergenic
954238838 3:49277454-49277476 TACCCTAAATCGCCATGAACTGG + Exonic
954966856 3:54619619-54619641 TCCCCCAAATTGCAAACAGCTGG + Intronic
956862591 3:73339318-73339340 TGCCCTAAATGTCAATCAGCCGG - Intergenic
959245069 3:103855792-103855814 TACTCTAAATGTCAATAAGCAGG - Intergenic
962497130 3:135952088-135952110 TTACCTAAATGTCCATGAGCAGG + Intergenic
962597137 3:136957775-136957797 CTCCCTAAAAGCCAATGAGCAGG - Intronic
962920853 3:139949307-139949329 TCCCCCACAAGGCAAAGAGCTGG - Intronic
964109759 3:153076114-153076136 TCATTTAAATGGCAATGAGATGG - Intergenic
964507555 3:157415960-157415982 TACCCTAAGTGGCCCTGAGCAGG + Intronic
976330975 4:83830742-83830764 TGTGCTTAATGGCAATGAGCTGG + Intergenic
977730376 4:100343928-100343950 TCCTCTTAATGGCTATGAGGTGG - Intergenic
986403135 5:7398159-7398181 TCTTCTAAATGGAAAGGAGCAGG + Intronic
987679990 5:21122851-21122873 TCATCTAAATGGAAATGAGCAGG - Intergenic
993899895 5:93578384-93578406 TCCCCAAAAAGGCGATGAGAAGG - Intergenic
1003109268 6:3239880-3239902 TCCAATAAAGGGCAACGAGCAGG - Intronic
1014852722 6:126361660-126361682 TTCCCTAAATGCCCAGGAGCAGG - Intergenic
1017149589 6:151266755-151266777 GCCCCTGAATGACAATGATCAGG - Intronic
1019099203 6:169614054-169614076 ACCCCTAAATGACACTCAGCAGG + Intronic
1028968397 7:96828216-96828238 TAGGCTAACTGGCAATGAGCAGG - Intergenic
1031056770 7:117000221-117000243 CCCTCAAAATGGCAATGAGTTGG + Intronic
1031958038 7:127962471-127962493 TCCCCCAAATGGCAAAGCGTAGG + Intronic
1035590690 8:811267-811289 TCCCCTTCCTGGGAATGAGCAGG + Intergenic
1036618417 8:10406091-10406113 TCCCCTTACTGGGAAAGAGCAGG - Intronic
1037583705 8:20261986-20262008 TCCCCTAAGCTGCAAAGAGCAGG + Intronic
1038892563 8:31742896-31742918 CCCGCTAACTGGTAATGAGCTGG + Intronic
1057500572 9:95594196-95594218 TCCCCTAAGTGGGAAGGTGCAGG + Intergenic
1057831493 9:98410433-98410455 TTCCCTAAATGGAAACCAGCTGG - Intronic
1189971189 X:46420007-46420029 TCCCCGAGATGGCAAAGAGGAGG - Intergenic
1197887098 X:131230034-131230056 TCCCCTCAAGGGCCATCAGCAGG + Intergenic