ID: 1178744147

View in Genome Browser
Species Human (GRCh38)
Location 21:35231260-35231282
Sequence CTTGTTCACCAGGAAGTTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178744142_1178744147 29 Left 1178744142 21:35231208-35231230 CCAGAGAATGAGGCCTAGCGGTG 0: 1
1: 0
2: 0
3: 8
4: 57
Right 1178744147 21:35231260-35231282 CTTGTTCACCAGGAAGTTTAAGG 0: 1
1: 0
2: 0
3: 16
4: 133
1178744143_1178744147 16 Left 1178744143 21:35231221-35231243 CCTAGCGGTGTGCATATTTAACA 0: 1
1: 0
2: 1
3: 16
4: 94
Right 1178744147 21:35231260-35231282 CTTGTTCACCAGGAAGTTTAAGG 0: 1
1: 0
2: 0
3: 16
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178744147 Original CRISPR CTTGTTCACCAGGAAGTTTA AGG Intronic
904713023 1:32445317-32445339 CTGGTTTACCAGAAATTTTAGGG + Intergenic
905219998 1:36438866-36438888 CATGTTCAATAGAAAGTTTATGG - Exonic
905871318 1:41406133-41406155 CTGGTCCTCCAGGAAGCTTAGGG - Intergenic
905998054 1:42399263-42399285 CTTGTACACCAGGATGTCCAGGG + Intronic
908042635 1:60131265-60131287 CTTGTTCAACAGGAAGCTAAGGG - Intergenic
910330145 1:86063714-86063736 CTTGTTCACCTGGAAGTCCTGGG + Exonic
912194861 1:107385734-107385756 CCTGTGCAGCAGGAAGTTTTAGG - Intronic
913671620 1:121102038-121102060 CTTTTTCAATAGTAAGTTTACGG + Intergenic
914023395 1:143889478-143889500 CTTTTTCAATAGTAAGTTTACGG + Intergenic
914661872 1:149797422-149797444 CTTTTTCAATAGTAAGTTTACGG + Intronic
915679782 1:157570007-157570029 CTTGTTCAATAGGAAGTAGAAGG + Intergenic
917235109 1:172883542-172883564 CTTTTTCACCAGAATGTCTATGG + Intergenic
921548321 1:216500848-216500870 CTTGTTCTTCATGAAGTTAAAGG - Intergenic
922879980 1:228973567-228973589 CTTGATAACCAGTAACTTTAGGG - Intergenic
924235466 1:241996334-241996356 GTTGTTCACCAGCAAGTAAAAGG + Exonic
1073724273 10:106211476-106211498 CTCATTCACCAGGAAGGTTGGGG - Intergenic
1079573240 11:21970532-21970554 CTTGATCACTAGGAAGTTCAAGG - Intergenic
1081298286 11:41419227-41419249 CTTGTTCATCAGGAGCTGTATGG - Intronic
1081562797 11:44234197-44234219 GTTGGCCACCAGGAAGTTCATGG - Exonic
1083850294 11:65361927-65361949 CTTGTTCACCATTGACTTTAAGG - Intergenic
1085592881 11:77780403-77780425 CTTGTCCACCTGTAAGTTGATGG - Intronic
1087094235 11:94305050-94305072 CTTCTTCCCCAGGATGTTTGAGG + Intergenic
1087394741 11:97583545-97583567 CTTGTTAACCAGGGTGTTTATGG + Intergenic
1087604212 11:100356203-100356225 AGTTTTCACCAGGAAGTTGAAGG - Exonic
1088079050 11:105888134-105888156 CTTGTTAACCATGTAGTGTAGGG + Intronic
1088425619 11:109698092-109698114 CTCCTTCACTAGGAAGATTAAGG - Intergenic
1088616390 11:111633758-111633780 CTTGTTCTCCAGGACTTTTATGG + Intronic
1098141366 12:67453291-67453313 CTTGTTCCCATGGAAGCTTAAGG - Intergenic
1099799250 12:87436294-87436316 CTTTTTCACCAGCATGTTTTTGG + Intergenic
1101201236 12:102438586-102438608 TTTGTTCCTCAGGAAGTTAATGG - Intronic
1104085884 12:125473805-125473827 CTCCTTCAACAGGAAGTTTTTGG - Intronic
1104356201 12:128089259-128089281 CTACTTCCCCAGGGAGTTTATGG - Intergenic
1109131036 13:58586085-58586107 TTTGTTCAACAGTAAGTTTAAGG - Intergenic
1111520731 13:89400199-89400221 CAAGTTCACCAGGAACTCTAGGG + Intergenic
1111673162 13:91354011-91354033 GTTGTTCTCCAGGAAGTTGCAGG - Intergenic
1112988190 13:105478250-105478272 CAGATTCACCAGGAAGATTATGG + Intronic
1114135793 14:19848148-19848170 TTTGTCTACCAGGAAGTTTGTGG - Intergenic
1114588611 14:23838080-23838102 CCTGGTCACCAGGAAGATCAAGG - Intergenic
1114945866 14:27679244-27679266 CTTTTCAACCAGGAAGTTTAAGG + Intergenic
1115066682 14:29270442-29270464 CATGTTCAACATGAAGCTTAGGG - Intergenic
1121320967 14:92991419-92991441 CTAGATCAGCAGGAAGTGTAGGG - Intronic
1121665914 14:95672152-95672174 CTTGAGCATCAGGAAGCTTAGGG + Intergenic
1122177537 14:99932092-99932114 GTTGTTTACAAGGAAGATTAGGG + Intronic
1122444484 14:101759491-101759513 CTTGTTCACCATGAAATTTCTGG + Intergenic
1128193205 15:65724539-65724561 TTTGTTCTGTAGGAAGTTTAGGG - Intronic
1128640022 15:69329095-69329117 CTTGTTCACCAGGCACTGCAAGG + Intronic
1142922947 17:3207183-3207205 TTTATTCTCAAGGAAGTTTAGGG - Intergenic
1143047418 17:4093166-4093188 CTTGTTTAACAGCAGGTTTAGGG + Intronic
1143618748 17:8069181-8069203 CTTGTGCAACAGGAACTTTCAGG - Intergenic
1145898664 17:28475642-28475664 TTTGGTCACAAGGAAGTTGATGG - Intronic
1151146186 17:72043619-72043641 GTTGTTTACGAGGAAATTTATGG - Intergenic
1151378750 17:73710304-73710326 CCTGTTACCCGGGAAGTTTAGGG + Intergenic
1154459882 18:14571628-14571650 TTTGTCTACCAGGAAGTTTGTGG - Intergenic
1157421383 18:47550397-47550419 TTTGTTAACCAGGATGTTGATGG - Intergenic
1162322672 19:9979167-9979189 CTTGTTCACCAGGAGGTCCAGGG + Exonic
1162460138 19:10809986-10810008 CTTGTACCCCAAGAGGTTTAGGG + Intronic
925359697 2:3268694-3268716 CCTGTTGACCAGGAAGCTTTGGG + Intronic
925423835 2:3732715-3732737 CTTGTTAGCCAGGAGGTGTAGGG + Intronic
928339414 2:30428803-30428825 CCTGTTCACCAGTAACCTTAAGG + Intergenic
929581129 2:43082385-43082407 CCTGTTCACCAGGAAGGAAATGG - Intergenic
931129886 2:59323451-59323473 CATGTTCACAAGAAACTTTAAGG - Intergenic
933017161 2:77142243-77142265 CTTGTTCACCACAAAGATTTTGG + Intronic
935818121 2:106866738-106866760 CTTATTCATCAGGAAGCTGAAGG + Intronic
940680354 2:156777600-156777622 CTTATTCACCAAGTAGTTAATGG + Intergenic
941198213 2:162476213-162476235 AATTTTCACCAGAAAGTTTAAGG - Intronic
944949708 2:204733871-204733893 CTTTTTCTCCAGAAATTTTATGG - Intronic
947567892 2:231206827-231206849 CTTTAGCACCAGAAAGTTTAAGG - Intronic
947855810 2:233323778-233323800 TTTGTTCACAAGGATGTTCATGG - Intronic
1170704435 20:18732658-18732680 CTTGTTCCCCAGTAGGGTTAGGG + Intronic
1173183875 20:40824515-40824537 ATTTTTCTCCAGGGAGTTTAAGG + Intergenic
1173962643 20:47086954-47086976 CTGGTTCACTTGGTAGTTTAAGG - Intronic
1174586592 20:51613444-51613466 CTTGAGCACCAAGAAGTTCAGGG + Intronic
1176814233 21:13581198-13581220 TTTGTCTACCAGGAAGTTTGTGG + Intergenic
1178280663 21:31279912-31279934 CTTGTTCCACAGCAAATTTAAGG - Intronic
1178686639 21:34716787-34716809 CATGTTCTCCAGTAAGTTTTCGG - Exonic
1178744147 21:35231260-35231282 CTTGTTCACCAGGAAGTTTAAGG + Intronic
1180713273 22:17854509-17854531 CCTGTTCACCAGGCAGTTCTCGG - Intronic
1182966315 22:34524922-34524944 GTAGCTCACCAGGAAGTGTAGGG - Intergenic
1183410400 22:37651736-37651758 CTTGCTCATCAGGAAATTCAAGG - Intronic
949482567 3:4508031-4508053 CTTGGTCATCAGGAAATTAATGG + Intronic
951236817 3:20245893-20245915 CTTGTGCACCTGAAAGTTGATGG + Intergenic
952941256 3:38445918-38445940 CTTGGTCACCAAGAAGTGTCTGG + Intergenic
955412545 3:58665151-58665173 CTTGGGCACCTGGAGGTTTAGGG - Intronic
955668702 3:61378544-61378566 GTTATTCATCAGGAAGTTAATGG - Intergenic
956642173 3:71425529-71425551 GTTATACACCAGGAAGTTGAGGG - Intronic
956660345 3:71591280-71591302 CTTCCTCCCCAGGATGTTTAGGG - Intergenic
957912176 3:86634333-86634355 CTTATTCTCCAGGAAGTGTATGG - Intergenic
957917320 3:86703148-86703170 CTTGTTCCTCAAGAAGTTTGGGG + Intergenic
959003538 3:100992845-100992867 CCTGTTGACCAGGAAGCTGAGGG - Intronic
959049381 3:101510393-101510415 CTTGTTTAGCAGAAAGTTTAGGG + Intronic
961053750 3:123768800-123768822 CCTGTTCACCAGACAGTGTATGG - Intronic
961794806 3:129401841-129401863 CTTGTTTTCCAGGAAGCTGAAGG - Exonic
962375740 3:134857429-134857451 CTTTTTCACCAGGACGCGTATGG + Intronic
962433067 3:135338318-135338340 CTTTTCCACCAAGAAGTATAGGG + Intergenic
962434163 3:135349003-135349025 CTTGGTCACCAGGGAGGATAAGG + Intergenic
963031011 3:140976328-140976350 CTTGTTCAAGAAGAAGGTTATGG + Exonic
964706632 3:159625392-159625414 CTTATTAACCAGGAAGCTTATGG + Intronic
965704712 3:171494736-171494758 CTTTGACACCAGAAAGTTTATGG + Intergenic
968329907 3:197858921-197858943 GTAATTCACCAGGAAGTTTGGGG + Intronic
970187643 4:13478284-13478306 ATTGTTCAGCAAGAGGTTTAAGG - Intronic
974813103 4:66971390-66971412 CTTTTCCTCCAGGAATTTTAAGG + Intergenic
976151253 4:82094525-82094547 CTTGTTTACCAAGAAATTTTAGG + Intergenic
978050583 4:104194554-104194576 ATTGTTAACTGGGAAGTTTACGG + Intergenic
978413177 4:108447125-108447147 CTTGTTCACCAGGATGTGCATGG - Intergenic
979410946 4:120378927-120378949 CTTTTTAACCAGAAATTTTATGG - Intergenic
980294317 4:130891003-130891025 CTGGTTCACATTGAAGTTTATGG - Intergenic
986180414 5:5387747-5387769 CATGTTCACTAAGAAGTTAAAGG + Intergenic
986634884 5:9811444-9811466 CCTCTTCACCACTAAGTTTAGGG - Intergenic
986957989 5:13178966-13178988 CTTATTTTCCAGAAAGTTTATGG + Intergenic
990401560 5:55443044-55443066 CTTGTTCAAAAGGAATTTAAGGG + Intronic
991172649 5:63646510-63646532 CTTGTTCACATGGAAGTTTTCGG + Intergenic
997821886 5:137073624-137073646 CTTGGTCTTCAAGAAGTTTAAGG - Intronic
997828118 5:137125681-137125703 GTTGTTTATCAGGCAGTTTATGG + Intronic
1001974347 5:175984627-175984649 GTTGGTCACCAGAAAGATTAGGG - Intronic
1002243087 5:177859152-177859174 GTTGGTCACCAGAAAGATTAGGG + Intergenic
1003608302 6:7585468-7585490 CTTGTTGACCCGGAAGTGCATGG + Exonic
1006325847 6:33353290-33353312 CTGGTTTACCAGAAATTTTAGGG + Intergenic
1006621577 6:35368443-35368465 CATATTCACCAGGGAGTTTTGGG + Intronic
1007520944 6:42451662-42451684 CTTGCTCACTAGTAAGTTTCTGG - Intronic
1007629919 6:43267664-43267686 TTTGTTCTCAAGGAAATTTAAGG + Intronic
1013818816 6:114131529-114131551 CATGTTCCCTAAGAAGTTTAAGG - Intronic
1016475263 6:144420384-144420406 CAGGTTCACCAGGTAGTTAAAGG + Intronic
1017442241 6:154475084-154475106 CTTGTACACGAGGAAGCTGATGG + Intronic
1017867847 6:158459979-158460001 CTGATTCACCAGGATGTTTTTGG + Intronic
1018560879 6:165099807-165099829 CTTCTTCCCTAGGAGGTTTAGGG - Intergenic
1022239099 7:28491445-28491467 CTCCTTCACCAAGAAGTTCAAGG - Intronic
1024679030 7:51664411-51664433 CATGTTGACCAGGTAGTTTTTGG - Intergenic
1028431433 7:90751222-90751244 CTTACTCACCAGGATGTCTAAGG + Intronic
1031349303 7:120709499-120709521 CTTGTTCACCAGCAAGCTGAAGG - Intronic
1033715745 7:144000357-144000379 CATGTTCACCAGGAAGGTGATGG + Intergenic
1034236182 7:149571435-149571457 CTGGTTTACCAGAAATTTTAGGG - Intergenic
1036107836 8:5860602-5860624 CTTTTTCACGAGGAAATTTTTGG + Intergenic
1039551004 8:38442763-38442785 CTAATTCATCAGCAAGTTTAGGG - Intronic
1043369572 8:79575221-79575243 CCTGATCATCAGGAAGGTTAAGG + Intergenic
1044912638 8:97076825-97076847 CTTGAACAACAGGGAGTTTAGGG + Intronic
1047079576 8:121444650-121444672 CTTGTACACCAGTAATTTAAAGG + Intergenic
1047541057 8:125767164-125767186 CCTGTTCTCCAGGAACTTTGGGG - Intergenic
1050216856 9:3335911-3335933 CTTATTCACTAGGATGATTATGG + Intronic
1050772099 9:9215301-9215323 CTTGTTCACCGGGAAAGTTATGG + Intronic
1053592613 9:39529308-39529330 CTTGTTCAACAGGAATTATCAGG + Intergenic
1053850348 9:42284029-42284051 CTTGTTCAACAGGAATTATCAGG + Intergenic
1054573689 9:66835968-66835990 CTTGTTCAACAGGAATTATCAGG - Intergenic
1061203356 9:129149596-129149618 CTTACTCACCAGGAAGTAGAGGG + Intergenic
1062532956 9:137009712-137009734 CGTGCTCACCAGGAAGTCAAAGG + Intronic
1185622673 X:1463101-1463123 TTTGTTTACAAGGCAGTTTAGGG + Exonic
1187452535 X:19411617-19411639 GTTGTTCAACAGGATGTTCAGGG + Intronic
1190537472 X:51443691-51443713 CTTGTTCTCCAAAAAGTTTGAGG - Intergenic
1196148618 X:112346940-112346962 ATTGTTCTCCAGAAAGTTTGAGG + Intergenic
1199849059 X:151712294-151712316 CATGTTCACGTGGAAGTTTCAGG - Intergenic
1201369422 Y:13245538-13245560 CTTCTCCACCAGGAAGATAATGG + Intergenic