ID: 1178745685

View in Genome Browser
Species Human (GRCh38)
Location 21:35248160-35248182
Sequence TAGGCTCAATTGTGTACCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 74}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178745685 Original CRISPR TAGGCTCAATTGTGTACCTG TGG Intronic
911213064 1:95163340-95163362 TCAGCTCCATTGGGTACCTGAGG + Intronic
915124807 1:153656441-153656463 TAGGCTCTAATGTGTTCCCGTGG - Intergenic
1068485836 10:57657285-57657307 TAGGTTTGAGTGTGTACCTGTGG + Intergenic
1069965795 10:72114882-72114904 TTGGCACAGTTGTGTACTTGTGG - Intronic
1074952327 10:118349741-118349763 TAGACTCAATTCTGTTCCTTTGG + Intergenic
1084150968 11:67287851-67287873 TAAGCTGAAATGTGGACCTGGGG + Intergenic
1090267723 11:125364048-125364070 TAGGCTCAGGTGTGGACCAGGGG - Intronic
1092430879 12:8407812-8407834 TAGGCTGAGTTGTGTCCATGTGG - Intergenic
1093649642 12:21627711-21627733 TAAGCTCAATTGTGTATTTCTGG - Intergenic
1094220644 12:27989534-27989556 TAGGCTCACTCATGTGCCTGTGG + Intergenic
1096044056 12:48546274-48546296 TAGACTCCATTGTGTATGTGTGG - Intergenic
1098382569 12:69884302-69884324 TAGGCTCAGGTGTGTGCCTTGGG + Intronic
1101889996 12:108704703-108704725 TGGGCTCACCTGTGTACATGTGG + Intronic
1107095947 13:36535445-36535467 TAGATTCAATTGTTTAACTGAGG - Intergenic
1108960277 13:56218203-56218225 TAGGCTCAGCTATGTACTTGAGG - Intergenic
1113985930 13:114315652-114315674 TAATCTCAATTCTGTGCCTGAGG - Intronic
1115268779 14:31528148-31528170 TAAGCTCAATTGTGTCCCCCCGG - Intronic
1125072021 15:35566421-35566443 TAGGGTCAAATGTGTAATTGTGG + Intergenic
1125145702 15:36465661-36465683 AAGGATCAATGGTGTTCCTGAGG - Intergenic
1131315486 15:91333099-91333121 TGGGCTCACTTGTGCCCCTGAGG + Intergenic
1133721582 16:8499271-8499293 TAGGCTCATTGGTGTGTCTGTGG + Intergenic
1135882044 16:26267215-26267237 TGGGCTCACTTGTGCATCTGTGG - Intergenic
1140801403 16:78491658-78491680 GAGGGTGCATTGTGTACCTGTGG + Intronic
1142145509 16:88491333-88491355 CAGGGACCATTGTGTACCTGTGG + Intronic
1144242352 17:13325269-13325291 TAGGGACAATTGTGGAACTGAGG + Intergenic
1151746945 17:76016764-76016786 TGGGCTCAGTGTTGTACCTGTGG + Intronic
1156795395 18:41039218-41039240 CAGGCTCATTTGTTTACCAGTGG + Intergenic
1157248001 18:46071125-46071147 CAGTCTCAACTGTGTCCCTGAGG + Intronic
1157301822 18:46484915-46484937 TAGGCCCATTTGTGTACCTATGG + Intronic
1162833589 19:13302027-13302049 TATGCTCACTTGGGAACCTGTGG - Intronic
1164811153 19:31157057-31157079 TATGTTCAATTCTGTACCTAGGG - Intergenic
1165649730 19:37475536-37475558 CAGGTTCTATTCTGTACCTGGGG + Intronic
1168387815 19:55980560-55980582 CAGGCTCACTTGTGTGGCTGTGG + Intronic
926726277 2:16000765-16000787 TTAGATCAATTGGGTACCTGAGG + Intergenic
929163846 2:38860796-38860818 AAGGCTCAATTGTGTTGCTGTGG - Intronic
930547502 2:52787224-52787246 TCGGTTCAACTGTGTACATGTGG + Intergenic
945095422 2:206214482-206214504 TGGGCACATCTGTGTACCTGAGG + Intronic
947125410 2:226863545-226863567 GAGACTCACTTGTATACCTGTGG + Intronic
1170272836 20:14547765-14547787 TCTCCTCGATTGTGTACCTGAGG + Intronic
1171030136 20:21669569-21669591 TAGGATCAAGTGTTCACCTGTGG - Intergenic
1175707904 20:61194729-61194751 TAAGCTCCAGTGGGTACCTGGGG + Intergenic
1176693905 21:9950173-9950195 TTGTCTCACATGTGTACCTGTGG + Intergenic
1178745685 21:35248160-35248182 TAGGCTCAATTGTGTACCTGTGG + Intronic
1180536723 22:16399087-16399109 AAGACTAATTTGTGTACCTGAGG + Intergenic
950668585 3:14511868-14511890 CAGGCTCTATTGTGTGCTTGGGG + Intronic
957133398 3:76252064-76252086 TCTGCTCAAATGTCTACCTGTGG - Intronic
957853293 3:85839585-85839607 AAGGCTAAATTGTGTGCCTGAGG - Intronic
965852434 3:173044942-173044964 GGGGCTCAACTGAGTACCTGAGG + Intronic
967187496 3:186957605-186957627 AAGGCCCACTTGAGTACCTGGGG + Intronic
977201192 4:94119007-94119029 TGGGCTCAATCATGTATCTGGGG + Intergenic
980366528 4:131810370-131810392 TTGTCTCACATGTGTACCTGTGG + Intergenic
983315355 4:166125799-166125821 TAGGCACAATTTTGTACACGAGG - Intergenic
990067262 5:51733775-51733797 TAGTCTCAAATAGGTACCTGAGG - Intergenic
992388990 5:76313039-76313061 TAGGCTGAGTGGTGTCCCTGAGG - Intronic
996516069 5:124370834-124370856 TAGCCACAATTGTTTACATGAGG - Intergenic
1000691414 5:164326371-164326393 AAGGCTCATTTGGCTACCTGAGG - Intergenic
1000790436 5:165600355-165600377 TAGACTAGATTTTGTACCTGAGG - Intergenic
1003471058 6:6433412-6433434 TAAACTCTATTCTGTACCTGAGG + Intergenic
1005023165 6:21436864-21436886 TAAGCTCATTTGTGCAGCTGTGG - Intergenic
1008933604 6:56966064-56966086 TAGGCTTAACTCTGAACCTGTGG + Intronic
1016886434 6:148964010-148964032 GAGGGCCAATTGTGTCCCTGTGG + Intronic
1027594862 7:80160402-80160424 TAGGCTCAATTTTGTATTTTAGG + Intronic
1029712817 7:102308809-102308831 TCGGCTCCATTCTCTACCTGGGG - Exonic
1032214515 7:129947407-129947429 TAGTGTCAATTGGGAACCTGTGG - Intronic
1036527420 8:9548168-9548190 TAGGGTCAATGCTGTCCCTGTGG - Intergenic
1045958288 8:107935653-107935675 TAGGTTCACTTGTCTAACTGAGG + Intronic
1046334319 8:112764525-112764547 TAGGCTCAATGGTAAACTTGAGG + Intronic
1053542968 9:38993766-38993788 TAGGCTGATGTGTGTACATGGGG + Intergenic
1053630876 9:39936273-39936295 TTGTCTCACATGTGTACCTGTGG + Intergenic
1053774892 9:41527232-41527254 TTGTCTCACATGTGTACCTGTGG - Intergenic
1053807411 9:41817283-41817305 TAGGCTGATGTGTGTACATGGGG + Intergenic
1054213011 9:62314425-62314447 TTGTCTCACATGTGTACCTGTGG - Intergenic
1054623181 9:67370144-67370166 TAGGCTGATGTGTGTACATGGGG - Intergenic
1056045772 9:82714036-82714058 TCTGCCCAATTGTGTGCCTGAGG - Intergenic
1056174848 9:84024302-84024324 TATGAACAATTGTGTTCCTGTGG + Intergenic
1060870869 9:127039159-127039181 GAGGCCCAAGTGAGTACCTGAGG + Intronic
1191100911 X:56727576-56727598 TGGGGACAATTGTGTACCCGAGG + Intergenic
1194859333 X:98977279-98977301 TAGGTTCATTTTTGTACCTGTGG - Intergenic
1200367055 X:155677800-155677822 CATGCTCCATTGTGTATCTGGGG + Intergenic