ID: 1178749219

View in Genome Browser
Species Human (GRCh38)
Location 21:35284498-35284520
Sequence CAGGGCAAAGACCCTGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1667
Summary {0: 1, 1: 6, 2: 66, 3: 349, 4: 1245}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178749219_1178749223 -6 Left 1178749219 21:35284498-35284520 CCCACCTCAGGGTCTTTGCCCTG 0: 1
1: 6
2: 66
3: 349
4: 1245
Right 1178749223 21:35284515-35284537 GCCCTGCAGTGCCCTTGGACTGG 0: 1
1: 0
2: 3
3: 17
4: 195
1178749219_1178749225 -5 Left 1178749219 21:35284498-35284520 CCCACCTCAGGGTCTTTGCCCTG 0: 1
1: 6
2: 66
3: 349
4: 1245
Right 1178749225 21:35284516-35284538 CCCTGCAGTGCCCTTGGACTGGG 0: 1
1: 0
2: 3
3: 27
4: 212
1178749219_1178749229 21 Left 1178749219 21:35284498-35284520 CCCACCTCAGGGTCTTTGCCCTG 0: 1
1: 6
2: 66
3: 349
4: 1245
Right 1178749229 21:35284542-35284564 CTCTCCCTGTGATCTTCCCAAGG 0: 1
1: 0
2: 5
3: 26
4: 302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178749219 Original CRISPR CAGGGCAAAGACCCTGAGGT GGG (reversed) Intronic
900867773 1:5280696-5280718 AAGTGCAAAGGCCCTGAGGTGGG - Intergenic
900939158 1:5786744-5786766 AGGTGCAAAGGCCCTGAGGTGGG + Intergenic
901099403 1:6707839-6707861 CAGGGCAAAGCCTTTGAGGCAGG + Intergenic
901102045 1:6726446-6726468 CAGGGCAAAGGCCCTGAGGCAGG - Intergenic
901115381 1:6839760-6839782 CTGTGCAAAGGCCCTGAGGCAGG + Intronic
901145419 1:7061650-7061672 CTGTGCAAAGGCCCTGAGGCAGG + Intronic
901336841 1:8456739-8456761 CAGTGCAAAGGCCCTGAGGTGGG - Intronic
901434461 1:9238207-9238229 AAGTGCAAAGGCCCTGAGGCAGG + Intronic
901675658 1:10882260-10882282 CAGTGCAAAGGCCCGGAGGCAGG - Intergenic
901690115 1:10967323-10967345 CAGTGCAAGGGCCCTGAGGCAGG - Intronic
901860017 1:12068358-12068380 CAGTGCAGAGGCCCAGAGGTAGG + Intronic
902050131 1:13557320-13557342 CTGGGCAAATCACCTGAGGTCGG + Intergenic
902080186 1:13815456-13815478 CAGGACAAAGATCCTGACCTTGG + Intronic
902150441 1:14438539-14438561 CAGTGCAAAGGCCCTGGGGCAGG + Intergenic
902183843 1:14710563-14710585 TAGTGCAAAGGCCCTGAGGTGGG - Intronic
902202398 1:14843597-14843619 ATGGGCAAAGACCCAGAGGTGGG + Intronic
902369225 1:15994877-15994899 CAGAGCCAAGGCCCTGAGGTGGG - Intergenic
902421881 1:16287204-16287226 CAGTGCAAAGACCCAGAGTTGGG - Intronic
902447055 1:16474205-16474227 CAGGGAAAAGGCCCTGAGGCGGG + Intergenic
902451058 1:16497519-16497541 CAGTGCAAAGGCCCAGAGGTGGG - Intergenic
902501799 1:16915835-16915857 CAGTGCAAAGGCCCAGAGGTGGG + Intronic
902535048 1:17114821-17114843 AACTGCAAAGGCCCTGAGGTGGG + Intronic
902571756 1:17351769-17351791 CAGTGCAAAGGCCCTGGGGCAGG + Intronic
902619420 1:17642306-17642328 AAGTACAAAGGCCCTGAGGTAGG + Intronic
902627573 1:17685390-17685412 CAGTGCAAAGGCCCGGAGGCAGG - Intronic
902907069 1:19566215-19566237 CAGTGCAAAGGCCCTAAGGTAGG + Intergenic
903064611 1:20692199-20692221 CAGGGCAAAGGCCTTGGGGCAGG - Intronic
903208856 1:21803923-21803945 AAGTGCAAAGGCCCTGAGGCAGG - Intergenic
903209873 1:21811933-21811955 GAGTGCAAAGGCCCTGAGGCAGG + Intergenic
903286337 1:22279332-22279354 AAGTGCAAAGGCCCTGAGGTGGG + Intergenic
903349101 1:22707416-22707438 AGAGGCAAAGGCCCTGAGGTGGG - Intergenic
903353022 1:22729585-22729607 CAGTGCAAAGGCCCTGTGGTGGG - Intronic
903539261 1:24087536-24087558 AAGTGCAAAGGCCCAGAGGTGGG - Intronic
903543401 1:24109106-24109128 GTGGGCAAAGGCCCAGAGGTAGG - Intronic
903662842 1:24989263-24989285 ACGTGCAAAGGCCCTGAGGTGGG + Intergenic
903765149 1:25729226-25729248 ATGTGCAAAGGCCCTGAGGTAGG - Intronic
903772532 1:25772883-25772905 AAGTGCAAAGGCCCTGAGGTGGG - Intronic
903849275 1:26296536-26296558 GAGGTCAAAGACCCAGAGGAAGG + Intronic
903853688 1:26322950-26322972 CAGTGCAAAGGCCCTGAGGAAGG - Intronic
903926008 1:26831246-26831268 AAGTGCAAAGGCCCTGAGGTAGG + Intronic
903946964 1:26970088-26970110 TGGTGCAAAGGCCCTGAGGTTGG + Intergenic
903972156 1:27126037-27126059 AAATGCAAAGGCCCTGAGGTGGG - Intronic
904290552 1:29483087-29483109 AGGTGCAAACACCCTGAGGTCGG - Intergenic
904377691 1:30092042-30092064 AAGTGCAAAGGCCCTGATGTAGG - Intergenic
904380553 1:30107650-30107672 AAGTGCAAAGGCCCTGAGGCAGG - Intergenic
904602055 1:31678958-31678980 CGGTGCAAAGGCCCAGAGGTGGG - Intronic
904799931 1:33085460-33085482 AGGTGCAAAGGCCCTGAGGTGGG + Intronic
904850775 1:33457722-33457744 AAGTGCAAAGGCCCTAAGGTGGG - Intergenic
904863771 1:33560504-33560526 AAGTGCAAAGGCCCTGAGGCAGG - Intronic
904888049 1:33756572-33756594 AAGGGCAAAGGCCCTGGGGTGGG + Intronic
904900068 1:33850055-33850077 AACTGCAAAGACCCTGAGGCAGG - Intronic
904905875 1:33896883-33896905 ACGTGCAAAGGCCCTGAGGTGGG + Intronic
904910325 1:33929802-33929824 AAGTGCAAAGGCCCTGAGGTGGG - Intronic
904938126 1:34146193-34146215 CAGGGCACAGGTCCTGAGCTGGG - Intronic
904989238 1:34578228-34578250 GAGTGCAAAAGCCCTGAGGTGGG - Intergenic
904995016 1:34624955-34624977 CAAGGGAAAGATCCTGAGGCTGG + Intergenic
905232779 1:36525402-36525424 GAGGCCCAAGCCCCTGAGGTGGG + Intergenic
905321716 1:37122315-37122337 AAATGCAAAGGCCCTGAGGTGGG + Intergenic
905410219 1:37763564-37763586 CATGGCAAATACTCTAAGGTTGG + Intronic
905451748 1:38061478-38061500 AAGTGCAAAGGCCCTGCGGTGGG + Intergenic
905726388 1:40255419-40255441 AAGTGCAAAGGCCCTGAGATTGG - Intergenic
905791900 1:40794166-40794188 CAGAGCAAAGGCCTTGAGATGGG + Intronic
905889759 1:41511663-41511685 AAGGGCAAAGAGCCTCAGGTGGG - Intronic
905913975 1:41672403-41672425 CAGGGCAGAGAAGCTGAGGCCGG - Intronic
905934879 1:41815527-41815549 AAGTACAAAGCCCCTGAGGTAGG + Intronic
905937310 1:41834878-41834900 AAGTGCAATGGCCCTGAGGTGGG + Intronic
906178612 1:43798516-43798538 AAGCACAAAGACCCTGAGGCAGG - Intronic
906187629 1:43872947-43872969 CAGTGCAAAAGCTCTGAGGTGGG + Intronic
906259382 1:44375181-44375203 GAGAGCACAGACCCTGAGGCAGG + Intergenic
906326835 1:44851611-44851633 AAGGGCAAAGACAGTGAGATGGG + Intronic
906610472 1:47198433-47198455 AAGTGCAAAGGCCCTGAGGAAGG + Intergenic
906721082 1:48005278-48005300 CTGGGAAAAGGCCCAGAGGTGGG + Intergenic
907034256 1:51202150-51202172 GAGTGCAAAGACCCTGCGGCTGG - Intergenic
907077177 1:51589650-51589672 AAGTGCAAAGGCCCTGAGATGGG + Intronic
907245043 1:53103153-53103175 CAGGGGGAAGCCCCTGGGGTGGG + Intronic
907869702 1:58432123-58432145 CCAGGCAGAGACCCTGAGATAGG - Intronic
907888751 1:58618505-58618527 CAGGGGAAATACCCTAAGGAGGG - Intergenic
907910462 1:58821423-58821445 AAGTGCAAATGCCCTGAGGTGGG + Intergenic
908241699 1:62194233-62194255 CAGTGCAAGGGCCCTGAGGCAGG + Intergenic
908342189 1:63193024-63193046 AAGTGCAAAGGCCCTGAGGCAGG + Intergenic
908545028 1:65153837-65153859 AAGTGCAAAGGCCCTAAGGTGGG + Intronic
908774412 1:67626290-67626312 CTGTGCAAAGGCCCTGAGGCAGG - Intergenic
908794723 1:67819789-67819811 CAGTGCAAAGGCACTGAGCTGGG - Intronic
909107590 1:71431942-71431964 TAGTGCTAAGGCCCTGAGGTAGG + Intronic
909502083 1:76345867-76345889 CAGTGCAAAGGCCCTGAGGAAGG - Intronic
909507518 1:76410272-76410294 CAATGCAAATACCCTGAGGCAGG - Intronic
909566874 1:77062417-77062439 AAGTGCAAAGGCCCTGAAGTAGG + Intronic
909765471 1:79350246-79350268 AAGCTCAAAGACCCTAAGGTCGG - Intergenic
909906660 1:81204319-81204341 TATGGCAAAGACCCGGAGGAGGG - Intergenic
910268778 1:85369934-85369956 CAGTGCAAAGGCCCTAAGGTGGG + Intronic
910433852 1:87185286-87185308 GTGTGCAAAGGCCCTGAGGTGGG - Intergenic
910835528 1:91505192-91505214 AAGTACAAAGACCCTGAGATGGG + Intronic
911097376 1:94065608-94065630 CAGGGCATGGAGGCTGAGGTGGG - Intronic
911230355 1:95354450-95354472 AAGAGCAAAGGCCCTGAGGTAGG - Intergenic
911664619 1:100539193-100539215 GAGGGCGCAGACGCTGAGGTCGG - Exonic
912496095 1:110092685-110092707 CAGGACAAAGTCCCTGAGGTGGG - Intergenic
912564530 1:110577040-110577062 AAGTGCAAAGATCCTGAGGTGGG - Intergenic
912698505 1:111858877-111858899 AAGTGCAAAGGCCCTGAGGCAGG - Intronic
912724582 1:112047307-112047329 AAGTGCAAAGTCCCTGAGGCAGG - Intergenic
912870283 1:113297994-113298016 AAGTGCAAAGGCTCTGAGGTAGG - Intergenic
913225332 1:116693856-116693878 AAGTGCAAAGGCCCTGAGGCAGG + Intergenic
913995786 1:143651339-143651361 GAGGACAGAGACCCTGAGGCAGG - Intergenic
914474723 1:148013736-148013758 GAGGACAGAGACCCTGAGGCAGG - Intergenic
914492348 1:148160321-148160343 TAGGACAGAGATCCTGAGGTAGG - Intergenic
914706217 1:150172034-150172056 AAGGGCAAAGGTCCTGAGGTGGG - Intergenic
915248518 1:154572409-154572431 CAGGGCAAAATGCCTGAGCTGGG + Intronic
915721808 1:157991452-157991474 AAAGGCAAAAACCCTGAGGTAGG - Intergenic
915986624 1:160472316-160472338 AAGTGCAAAGGCCCTGAGGTAGG + Intergenic
916010812 1:160703840-160703862 CAGAGCAAAGGCCCTGGGGCAGG + Intronic
916170613 1:161998972-161998994 CAGAGAAAAGGCCCTGAGGCAGG + Intronic
916362312 1:163984449-163984471 CAGTACAAAGGCCCTGAGGCAGG + Intergenic
916447360 1:164885680-164885702 AAGGGCAAAGACCCTGAGGTAGG - Intronic
916499096 1:165371193-165371215 AAGTGCAAAGGCACTGAGGTGGG - Intergenic
916504418 1:165415232-165415254 AAGTGCAAAGGCCCTGAGGTGGG + Intronic
916577000 1:166076353-166076375 AAGTGCAAAGGCCCTCAGGTGGG - Intronic
916698439 1:167264894-167264916 AAGTGTAAAGGCCCTGAGGTGGG - Intronic
916929842 1:169565076-169565098 ATCTGCAAAGACCCTGAGGTAGG - Intronic
917030284 1:170682925-170682947 AAGTGCAAAGGCCCTGAGGCAGG + Intronic
917277196 1:173343408-173343430 AAGTGCAAAGACTCTGAGGCAGG + Intergenic
917459733 1:175219550-175219572 CAGTGCAAAGACCCTGAAGTGGG - Intergenic
917539590 1:175899845-175899867 CAGTGCGAAGGCCCTGAGGCAGG + Intergenic
917861129 1:179145682-179145704 CAATGCAAAAACTCTGAGGTAGG + Intronic
918255606 1:182743637-182743659 CAATGCAAAGACCCTGAGACAGG - Intergenic
918308593 1:183269221-183269243 TAGTACAAAGACCCTGAGGTGGG + Intronic
918318595 1:183343994-183344016 ATGGGCAAAGACCCTGAGAGAGG - Intronic
918634883 1:186763962-186763984 CAGTGCAAAGGCCCAGAGGCAGG - Intergenic
918987558 1:191652136-191652158 AAGTATAAAGACCCTGAGGTGGG - Intergenic
919122302 1:193356411-193356433 CAGGGATAAGGGCCTGAGGTGGG - Intergenic
919413476 1:197276670-197276692 AAGTGCAAAGACCCTGAAGCAGG + Intronic
919507495 1:198417524-198417546 AAGAACGAAGACCCTGAGGTGGG - Intergenic
919516578 1:198532769-198532791 AAGTGCAGAGGCCCTGAGGTGGG + Intronic
919606370 1:199689393-199689415 CAGGGCGAAGAGCTTAAGGTTGG - Intergenic
919972163 1:202588117-202588139 CAGGGCAAAGACAAGGAGGAAGG - Exonic
920049741 1:203156426-203156448 AAGTGCAAAGCCCCTGAGGTAGG + Intronic
920062486 1:203237138-203237160 CTGTGCCAAGACCCTGAGATTGG - Intronic
920768682 1:208858896-208858918 AAGGGCAAAAATGCTGAGGTGGG + Intergenic
921224614 1:213005842-213005864 CAAGGGAAAGGCCCTGAGGTTGG - Intronic
921427067 1:215015874-215015896 CAGGGCAGAGATCATGAGCTTGG + Intronic
921816861 1:219574178-219574200 TAGTGCAAAGACCCTGAGGCAGG + Intergenic
922014380 1:221630237-221630259 AAGTGCAAATATCCTGAGGTAGG + Intergenic
922204129 1:223431894-223431916 AAGGGCAAAGGCCCTGAGGTAGG + Intergenic
922507476 1:226134899-226134921 CAGTGCAGAGGCCCTGAGGTAGG - Intergenic
922915384 1:229253057-229253079 GAAGACAAAGACCCTGAGATGGG - Intergenic
923150025 1:231224584-231224606 CAGTGCAAGGGCCCTGAGGCAGG - Intronic
923404254 1:233644685-233644707 GAGTGCAAAGGCCCTGAGCTAGG + Intronic
923427042 1:233881438-233881460 CAGGAAAAAGATCCAGAGGTAGG - Intergenic
923610907 1:235492842-235492864 AAATGCAAAGGCCCTGAGGTAGG + Intronic
923676577 1:236085618-236085640 CAGTGCAAAGGCCCTGGGGCAGG + Intergenic
923721807 1:236473364-236473386 TGGGGCAAAGCCCCTGAGGCTGG + Intronic
923850699 1:237790983-237791005 AAGGGCAGAGGCCCTGAGTTAGG - Intronic
924331357 1:242943910-242943932 AAGTGCAAAGGCTCTGAGGTGGG - Intergenic
924606144 1:245537233-245537255 CTGTGCAAAGGCCCTGAGATGGG + Intronic
924650025 1:245917531-245917553 CAGTGCACAGGCCTTGAGGTAGG - Intronic
924706799 1:246508878-246508900 CAGAGCCAAGGCCCTGAGGTGGG + Intergenic
1062787874 10:280336-280358 CAGGTCAGAAACCCTGAGGGAGG - Intronic
1062992377 10:1832593-1832615 CAGTGCAAAGACCCTGGGGCAGG + Intergenic
1063214667 10:3913321-3913343 CAGGGCCTAGACCCAGAGATGGG + Intergenic
1063468114 10:6261628-6261650 AAGGGCAAATCACCTGAGGTTGG + Intergenic
1063805330 10:9632772-9632794 CAGGGCAAATGCCCTAAGGCAGG + Intergenic
1063987958 10:11527264-11527286 CAGTGCAAAGGCCCTGAGGCAGG + Intronic
1064325175 10:14343733-14343755 CAGTGCAAAGGCTCTGAGGCAGG - Intronic
1064773608 10:18751104-18751126 CAGTGTACAGGCCCTGAGGTGGG - Intergenic
1065694860 10:28370342-28370364 GAGTGCAAAGGCCCTGGGGTAGG + Intergenic
1065982441 10:30913377-30913399 ATGGGCAAAGACCCTGTGGTGGG - Intronic
1066482385 10:35809479-35809501 ATGTGCAAAGGCCCTGAGGTGGG - Intergenic
1066654801 10:37687506-37687528 CAGAGCAAAGGCCCTGTGGCAGG + Intergenic
1067039752 10:42942976-42942998 CAGAGCAAAGGCCCTGTGGCAGG + Intergenic
1067051276 10:43022788-43022810 AAGAGCACAGGCCCTGAGGTGGG + Intergenic
1067231878 10:44417857-44417879 TTGTGCAAAGGCCCTGAGGTAGG + Intergenic
1067462297 10:46466670-46466692 CACGGCAAAAGCCCTGAGGCTGG + Intergenic
1067624900 10:47917967-47917989 CACGGCAAAAGCCCTGAGGCTGG - Intergenic
1068150200 10:53121662-53121684 CAGGGTGAGGACACTGAGGTTGG + Intergenic
1068959157 10:62849327-62849349 GAGTGCAAAGACCCTAAGGTGGG - Intronic
1069222185 10:65897954-65897976 CAATGCCAAGACCCTGAGATGGG - Intergenic
1069621392 10:69839702-69839724 CGGTGCAAAATCCCTGAGGTCGG + Intronic
1069621793 10:69841809-69841831 AAGGGCAGAGACCCTGCAGTGGG + Intronic
1069623443 10:69852044-69852066 AAGTGCAAAGGCCCTGGGGTGGG - Intronic
1069717640 10:70531202-70531224 TTGGGCAGAGGCCCTGAGGTGGG + Intronic
1069943758 10:71972484-71972506 CGGGCAAAAGACCCTGAGGCAGG - Intronic
1070546394 10:77456234-77456256 CAGTGCAAAGTCCCTGGGGTGGG - Intronic
1070645306 10:78198043-78198065 ATGTGCAAAGGCCCTGAGGTAGG + Intergenic
1071172146 10:82878929-82878951 CAGGACAAAGGCCCTGGGGTAGG - Intronic
1071203640 10:83249655-83249677 GAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1071416205 10:85444343-85444365 CAGGGCAAAGGCCCTGACCCAGG + Intergenic
1071476710 10:86031865-86031887 CAGTGCAAAGACTCTGAGCAGGG - Intronic
1071730845 10:88247043-88247065 GTGTGCAAAGATCCTGAGGTGGG + Intergenic
1071970310 10:90898830-90898852 CAGGCCAAAGACCCTGACCTTGG - Intronic
1071987516 10:91067337-91067359 CAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1072235265 10:93448149-93448171 AAGTGCAAAGGCCCTGAGGCAGG - Intronic
1072547175 10:96448735-96448757 AAGTGCAAAGGCCCTGGGGTGGG + Intronic
1072658258 10:97345791-97345813 AAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1072728089 10:97827087-97827109 AAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1072740694 10:97907390-97907412 AAGTGCAAAGGCCCTGAGGTGGG + Intronic
1072897835 10:99382082-99382104 CAGGGCGAAGCCCCTGTGGTTGG + Intronic
1074096759 10:110320001-110320023 AAGTGGAAAGACCCTGAGGTGGG + Intergenic
1074571928 10:114632161-114632183 CAGGGCAGAGTCCCCGAGCTGGG - Intronic
1074704470 10:116118844-116118866 CGAGGCAGAGACCCTGAGCTTGG + Intronic
1074828706 10:117233029-117233051 CTGAGCAAAGGCCCTGGGGTAGG + Intergenic
1074859028 10:117496254-117496276 GAGTGCAAAGGCCCTGGGGTAGG - Intergenic
1074998100 10:118774887-118774909 GAGGGCAAATCACCTGAGGTCGG + Intergenic
1075114398 10:119613764-119613786 AAGGGCAAAGGCCCTGGGGTGGG - Intergenic
1075302277 10:121335585-121335607 AAGTGCAAAGGCCCTGGGGTGGG - Intergenic
1075341919 10:121653782-121653804 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1075495634 10:122916396-122916418 AAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1075851885 10:125595651-125595673 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1076378855 10:130011432-130011454 ATGGGCAAAGACCCTGAGGGTGG + Intergenic
1076980166 11:199880-199902 CAGGGCAGAGACCTGCAGGTGGG + Intronic
1077046959 11:551008-551030 CAGGGCAGGGGCCCAGAGGTGGG - Intronic
1077465049 11:2729970-2729992 CACAGCAAAGGCCCTGAAGTGGG + Intronic
1077694228 11:4379016-4379038 CATGGAAATGACTCTGAGGTGGG - Intergenic
1077741350 11:4849032-4849054 CAGGGCAATGATCCAGAGGATGG + Exonic
1078094534 11:8288728-8288750 AAGGAAAAAGACCCTGAGGCAGG + Intergenic
1078103648 11:8344964-8344986 CCTGGCAAAGACCCCAAGGTTGG + Intergenic
1078458802 11:11497072-11497094 AGGTGCAAAGGCCCTGAGGTGGG - Intronic
1078473305 11:11609351-11609373 CAGTGCAAAGCCCCTGTGGCAGG - Intronic
1078885565 11:15496516-15496538 AAGTGCAAAGGCCTTGAGGTAGG - Intergenic
1079079601 11:17405109-17405131 CAAGGTAAACTCCCTGAGGTAGG + Intronic
1079085596 11:17442736-17442758 GATGGCAAAGGCCCTGAGGCTGG + Exonic
1079153141 11:17919728-17919750 CAGTGCAAAGGCCCTAAAGTGGG - Intronic
1079299370 11:19263950-19263972 AAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1079311845 11:19373439-19373461 AGGTGCAAAGACCTTGAGGTGGG - Intronic
1079341820 11:19617880-19617902 AAGTGCAAAGGCCCTGAAGTGGG - Intronic
1079364072 11:19793829-19793851 CAAGGCAAAGGCCCTGAGGTGGG - Intronic
1079689285 11:23402283-23402305 CAAGGCAAAGACCCCGAAGCAGG - Intergenic
1080461022 11:32455144-32455166 CATGTCAAAGGCCCTGAGGCAGG + Intergenic
1080516384 11:33025196-33025218 AAGAGCAAATGCCCTGAGGTGGG - Intronic
1080616479 11:33949111-33949133 CAGTGCAGAGGCCCTGAGATAGG + Intergenic
1080799635 11:35598292-35598314 AAGGGCAAAAGCCCTGAGATGGG - Intergenic
1080851535 11:36074457-36074479 GAGTGCAAAGGCCCTGAGGTGGG + Intronic
1081607134 11:44534397-44534419 AAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1081738593 11:45422466-45422488 CAGGGCCAAAAGCCTGAGGGTGG + Intergenic
1081957945 11:47109936-47109958 AAGGGCAAAGACCGGGAGATGGG - Intronic
1082743223 11:56934473-56934495 AAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1082762477 11:57141271-57141293 CAGTGCATAGGCCCTGGGGTAGG + Intergenic
1082851762 11:57771518-57771540 AAGTGCAAAGGCCCTGAGGCTGG + Intronic
1082913227 11:58400948-58400970 AAGTGCACAGGCCCTGAGGTTGG + Intergenic
1083084144 11:60125110-60125132 CTGCTCAAAGACCCTGAGGAGGG - Intergenic
1083108002 11:60377144-60377166 CAGGTCATAGACCCAGAGGAAGG + Intronic
1083339619 11:61950560-61950582 CTGTGCAAATGCCCTGAGGTGGG + Intronic
1083613029 11:64013436-64013458 CAGGGCAAAGGCCCGGAGGCAGG + Intronic
1083647957 11:64184067-64184089 CAGTGCAAAGGGCCTGGGGTGGG - Intergenic
1083904371 11:65660487-65660509 AAGTGCAAAGGCCTTGAGGTGGG - Intronic
1084062492 11:66685513-66685535 CAGGAGAATGACCCTGAGGCAGG + Exonic
1084107299 11:66988452-66988474 AAGTGCAAAGGTCCTGAGGTGGG - Intergenic
1084294430 11:68202347-68202369 AAGTGCAAAGGCCCTGTGGTGGG - Intronic
1084315176 11:68341677-68341699 CTGGGCAAAGGTCCTGGGGTGGG - Intronic
1084360051 11:68663420-68663442 CAGGGCTGAGGCCCTGAGGAGGG - Intergenic
1084430535 11:69108311-69108333 CTGGACAAAGGCCCTGAGGCTGG - Intergenic
1084493730 11:69491938-69491960 CAGTGCAAAGGCCCCGAGGCAGG + Intergenic
1084512941 11:69617428-69617450 CAGTGCAAGGGCCCTGAGGCAGG + Intergenic
1084559312 11:69893836-69893858 CTGGGCTCAGAACCTGAGGTCGG - Intergenic
1084767889 11:71324313-71324335 CTGTGCAAAGGCCCTGAGGCTGG + Intergenic
1084953402 11:72678928-72678950 CATTGCAAAGACCCAGATGTGGG - Intergenic
1084977520 11:72810755-72810777 CAGGGCAAAGCCTCCAAGGTGGG + Intergenic
1085043703 11:73341663-73341685 ATGGGCCAAGACCCTGAGGCAGG + Intronic
1085206705 11:74737909-74737931 AAGGGCAAAATCCCTGAGGAGGG - Intergenic
1085321004 11:75573925-75573947 TAGTGCAAAGTCCCTGAGGCAGG - Intergenic
1085329208 11:75633729-75633751 GAGTGCAAAGACCCTAAGGCCGG + Intronic
1085376826 11:76071333-76071355 AAGGGCAAAGTCCCTGAGGTAGG + Intronic
1085447009 11:76607647-76607669 CAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1086079858 11:82891660-82891682 AAGTGCAAAAACCCTGAGGTAGG - Intronic
1087208493 11:95421335-95421357 CAGTGCCAAGACCCTAAGCTGGG + Intergenic
1087218466 11:95520101-95520123 CTGTGCAAAGGCCCTGTGGTGGG - Intergenic
1087266457 11:96066880-96066902 AAGAGCAAAGACTCTGAGATGGG + Intronic
1087342018 11:96918007-96918029 AAGTGCAAAGACCCAGAGGTGGG - Intergenic
1088305104 11:108399379-108399401 AAGGGGAAAAAGCCTGAGGTAGG - Intronic
1088493602 11:110410760-110410782 CAGGGTAGAGACCTTGAGATAGG + Intergenic
1088551631 11:111019364-111019386 CAGGTCAAAGACAGTGAGGAAGG - Intergenic
1088559051 11:111094094-111094116 CAGGAGAATGACCCTGGGGTGGG - Intergenic
1088706525 11:112468884-112468906 ATGTGCAAAGACCCTGAGGTGGG - Intergenic
1088706528 11:112468916-112468938 AAGAGCAAAGACGCTGAGGTGGG - Intergenic
1088891050 11:114044464-114044486 AAGTGCCAAGGCCCTGAGGTGGG + Intergenic
1089451927 11:118604858-118604880 CAGGGCAAAAAAACTGCGGTGGG - Intergenic
1089574314 11:119430847-119430869 CAGGGCAAAGAACCACAGGCAGG - Intergenic
1090431237 11:126648352-126648374 AAGTGCAAAGACCCTGAGGCAGG - Intronic
1090496605 11:127218954-127218976 CATGGCAAAGTCCCCAAGGTGGG + Intergenic
1090716099 11:129432879-129432901 CCGGCCAAAGACACTGAGGAGGG - Intronic
1091053640 11:132397986-132398008 AAGTGCAAAGTTCCTGAGGTAGG - Intergenic
1091682054 12:2534135-2534157 CAGGGCAAAGACCCAGACACAGG + Intronic
1091694817 12:2621371-2621393 AAGAGCAAAGACCCCGAGGCAGG + Intronic
1091906045 12:4189835-4189857 AGGGGCAAAGGCCCTGAGATGGG + Intergenic
1091978300 12:4844526-4844548 ATGTGCAAAGGCCCTGAGGTGGG + Intronic
1091979274 12:4852651-4852673 AAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1092056991 12:5515711-5515733 CAGTGCAAAGGCACTAAGGTAGG - Intronic
1092173729 12:6389262-6389284 CAGTGCAAAGACCCTGAGGCAGG + Intronic
1092219282 12:6701578-6701600 AAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1092762228 12:11820586-11820608 AAGTCCAAAGGCCCTGAGGTGGG + Intronic
1092776530 12:11949146-11949168 AAGTGCAAACACCCTGAGGCAGG + Intergenic
1092855919 12:12673659-12673681 GAGTGCAAAGACCCTGGTGTAGG + Intronic
1092896039 12:13011283-13011305 ACGTGCAAAGGCCCTGAGGTGGG + Intergenic
1093234588 12:16591249-16591271 CAGTACAAAGGCCCTGAGGTGGG - Intronic
1093441114 12:19197359-19197381 CAGTGTTAAGACCCTGAGGCAGG - Intronic
1093778049 12:23100167-23100189 CAGGGCAAAGGCCCTGCCTTGGG + Intergenic
1093862794 12:24188210-24188232 CAAGGCAAAGAGCCAGAGTTAGG + Intergenic
1093959893 12:25260672-25260694 AGGTGCAAAGGCCCTGAGGTAGG - Intergenic
1094213984 12:27921373-27921395 CAGAGCAAAGATGCTGAGGTGGG - Intergenic
1094360424 12:29624574-29624596 CAGTGCCAAGTCCCTGAGGCAGG - Intronic
1094449295 12:30567291-30567313 AAGGGCAAAGTCCCTGAGGCTGG - Intergenic
1094493346 12:30975040-30975062 CAGGGCAAAGGCCCAAAGGCTGG + Intronic
1094756247 12:33472118-33472140 TTAGGCAAAGACTCTGAGGTTGG + Intergenic
1095206780 12:39447249-39447271 TAGTGCAAAGACCCTCAGGCAGG - Intergenic
1095861056 12:46918439-46918461 TAGGGCAAAGACCCCAAGGAGGG + Intergenic
1095926380 12:47583718-47583740 AAGTGCAAAGGCCCTGAGGTAGG + Intergenic
1096494890 12:52034093-52034115 CAGGGCTGAGATCCTGAGGGTGG - Intronic
1096551065 12:52371935-52371957 CAGGGCACAGGCCCTGAGTCAGG - Intergenic
1097341327 12:58441677-58441699 AAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1097626211 12:62003406-62003428 CAGTGCAAAGGCTCTGAGGTGGG - Intronic
1097790104 12:63806510-63806532 AAGAGCAAAGGCCCTGAGGCAGG + Intronic
1097825858 12:64173876-64173898 CAGGTCACAGAGCCTGAGTTCGG + Intergenic
1098249973 12:68559444-68559466 AAGGACAAAGGCCCTGAGGTAGG + Intergenic
1098307939 12:69119985-69120007 AAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1098543688 12:71687348-71687370 GCGGGCAAATAACCTGAGGTCGG + Intronic
1098573931 12:72019404-72019426 AAGTGCAAAGACCCTGAGGCAGG - Intronic
1098818257 12:75195875-75195897 CAGGAGACAGTCCCTGAGGTTGG - Intronic
1098855632 12:75650289-75650311 CAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1099085029 12:78235287-78235309 AAGGGCAAAGGCCCTAAGTTTGG + Intergenic
1099277852 12:80600968-80600990 CAGCGTGAAGACCCTGAGGCAGG - Intronic
1099928721 12:89049515-89049537 AAATGCAAAGGCCCTGAGGTAGG - Intergenic
1099993931 12:89756197-89756219 CAGTGCAAAAATCCTTAGGTAGG + Intergenic
1100364151 12:93903983-93904005 GAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1100364261 12:93904684-93904706 GAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1100722513 12:97373860-97373882 CCGGGCAAAGAGACTGAGGAGGG + Intergenic
1101008598 12:100426942-100426964 AAGGGCAAAGGCCCTGAAGGGGG + Intergenic
1101139722 12:101782844-101782866 CATTGCAAAGGCCCTGAGGCAGG - Intronic
1101210563 12:102531500-102531522 AAGTGCAAAGACCCTGAAATGGG + Intergenic
1101372577 12:104142758-104142780 CAGTGCAGAGCCCCTGAGGCAGG - Intergenic
1101404607 12:104416935-104416957 AAGTGCAAAGACCCCAAGGTGGG + Intergenic
1101451146 12:104780342-104780364 CTGAGCACAGATCCTGAGGTGGG - Intergenic
1101565616 12:105902186-105902208 CAGGGAAAAGCCCATGAGGTTGG - Intergenic
1101680984 12:106965173-106965195 AAGAGCAAAGGCCCTGATGTGGG - Intronic
1101725655 12:107386104-107386126 CAGGGCAAAGGCCCTGAGGCAGG - Intronic
1101733200 12:107443506-107443528 AAGTGCAAAGGCCCTGAGGTAGG + Intronic
1101772660 12:107765940-107765962 AAGAGCAAAGGCCCTGAGGCAGG + Intergenic
1101804506 12:108051663-108051685 CAGTGCAAATGCCCTGAGGCAGG - Intergenic
1101876961 12:108602510-108602532 GCGTGCAAAGGCCCTGAGGTGGG + Intergenic
1101877992 12:108608084-108608106 CAGTGCTAAGATCCTCAGGTGGG + Intergenic
1101920140 12:108925739-108925761 CAGTGCAAAGATCCTGAGGCAGG - Intronic
1102029817 12:109733768-109733790 AAGTGCAAAGGCCCTGGGGTGGG + Intronic
1102158129 12:110746727-110746749 AAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1102166305 12:110809564-110809586 CATGTCAAAGACCCCGAGGCGGG - Intergenic
1102199553 12:111047978-111048000 CTGTGCAAAGGCCCTGAGGTGGG + Intronic
1102278684 12:111601145-111601167 GAGGGCAAAGGCTCTGAGGGGGG + Intergenic
1102380927 12:112466311-112466333 AAGTGCAAAGGCCCTGAAGTGGG + Intronic
1102396365 12:112589460-112589482 CAGTGCAAAGGTCCTGAGGCAGG - Intronic
1102400831 12:112628267-112628289 AAGTGCAAAGGCCCTGAGGTTGG + Intronic
1102454023 12:113060513-113060535 CAGTGCAAAGGCCCTGGGGTAGG + Intronic
1102459072 12:113089144-113089166 AAGTGCAAAGGCCCTGGGGTGGG + Intronic
1102477456 12:113197880-113197902 AGGTGCAAAGGCCCTGAGGTAGG + Intronic
1102523837 12:113496788-113496810 CAGTGCAAAGGCCCAGAGGTAGG - Intergenic
1102527682 12:113523684-113523706 AAGGGCAAAGGCCCTGAGGTAGG - Intergenic
1102528307 12:113527748-113527770 ATGTGCAAAGGCCCTGAGGTAGG - Intergenic
1102531510 12:113549912-113549934 AAGAGCAAAGACCTTGAGGCAGG - Intergenic
1102544343 12:113643779-113643801 AAGTGCAAAGGCCCTGGGGTAGG - Intergenic
1102553924 12:113713333-113713355 CAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1102555440 12:113723793-113723815 CAGTGCAAAGGCCCTGCGGTGGG + Intergenic
1102570844 12:113826060-113826082 CAGGTGCAAGGCCCTGAGGTGGG - Intronic
1102633798 12:114304816-114304838 AAGTGCAAAGTCCCTGAGGTGGG - Intergenic
1102636787 12:114331567-114331589 ATGTGCAAAGGCCCTGAGGTGGG - Intergenic
1102807456 12:115794470-115794492 CAGTGCAAAGGTCCTGAGGTAGG + Intergenic
1102829764 12:115987092-115987114 CAGGACAAAGACCCTACCGTAGG + Exonic
1102914045 12:116739643-116739665 AAGTGCAAAGGCCCTGAGGCAGG + Intronic
1102987623 12:117291319-117291341 AAGTGCAAAGGCCCTGAGGCAGG - Intronic
1103015986 12:117494904-117494926 CAGTGCAAAGGCCCTGAGGTAGG + Intronic
1103064227 12:117883606-117883628 GTGTGCAAAGACCCTGAGGTGGG + Intronic
1103147840 12:118610895-118610917 ACAGGCAAAGACCCTGGGGTGGG - Intergenic
1103197394 12:119056638-119056660 ATGTGCAAAGGCCCTGAGGTGGG - Intronic
1103201667 12:119092970-119092992 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1103219179 12:119229316-119229338 CAGTGCAAAAGCCCTGAGGTAGG + Intergenic
1103361034 12:120353777-120353799 ATGTGCAAAGGCCCTGAGGTGGG - Intronic
1103499210 12:121387964-121387986 CTGTGCAAAGGCCCAGAGGTAGG + Intronic
1103799599 12:123529080-123529102 TAGTGCAAAGGTCCTGAGGTAGG - Intronic
1103943745 12:124514848-124514870 CAGTGCAAAGGTCCTGAGGCAGG + Intronic
1103955731 12:124575807-124575829 CAGTGCAAAGGCCCTGGGGTGGG + Intergenic
1103956119 12:124577844-124577866 AAGTGCAAAGGCCCTCAGGTAGG + Intergenic
1103994309 12:124819273-124819295 CTGTGCAAAGGCCCTGTGGTAGG + Intronic
1104002864 12:124871505-124871527 CAGGGCAACGACTCTGAGGCAGG + Intronic
1104030122 12:125058943-125058965 CAGGGCTCAGACCTTGAGGCAGG - Intergenic
1104047022 12:125170676-125170698 GAGTGCAAAGGCCCTGATGTGGG + Intergenic
1104085803 12:125473173-125473195 AAGTGCAAAGGCCCTGAGGTGGG - Intronic
1104247457 12:127057240-127057262 CAGTGCAGAGGCCCTGGGGTTGG + Intergenic
1104272309 12:127293375-127293397 CAGCACAAATACCCTGAGGCTGG - Intergenic
1104386508 12:128355741-128355763 ATGTGCAAAGGCCCTGAGGTGGG - Intronic
1104475333 12:129066419-129066441 ATGGGCAAAGGCCTTGAGGTGGG + Intergenic
1105039386 12:132949788-132949810 CAGAGCAAGGACACTGAGGTAGG + Intronic
1105210746 13:18255434-18255456 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1105450698 13:20496731-20496753 CATGGCAAAAAGGCTGAGGTAGG + Intronic
1106424120 13:29609647-29609669 CAGGGCAAATATCCTGCTGTAGG - Intergenic
1106517331 13:30466102-30466124 CCGGGCAAAGAGGCTGAGGCGGG + Intronic
1106608998 13:31260162-31260184 TAATGCAAAGTCCCTGAGGTGGG - Intronic
1106756929 13:32830888-32830910 GAGGGCAGAGGCCTTGAGGTGGG + Intergenic
1106898966 13:34334858-34334880 CAGGGCAAAGGCCATGTGGTAGG + Intergenic
1107254858 13:38412464-38412486 CTGGGAAAAGAGCCAGAGGTTGG + Intergenic
1107409180 13:40142538-40142560 AAGTGCAAAGGTCCTGAGGTAGG - Intergenic
1107452429 13:40521988-40522010 AAGGGCAAAAACACTGAGGCAGG - Intergenic
1107495308 13:40920496-40920518 CAGTGCAGAGATCCTGAAGTAGG - Intergenic
1107696155 13:43002198-43002220 GAAGTCAAAGACCCTGGGGTGGG + Intergenic
1108841721 13:54626094-54626116 GAGGGCAAAGACCCTGAGACAGG + Intergenic
1109020686 13:57087997-57088019 CAGAGCACAGAGGCTGAGGTTGG + Intergenic
1110223917 13:73099785-73099807 CAGGGCAGATCACCTGAGGTTGG + Intergenic
1110270494 13:73584194-73584216 CAGCATAAAGGCCCTGAGGTAGG + Intergenic
1111845915 13:93508369-93508391 GAGTGCAAAATCCCTGAGGTGGG + Intronic
1111854531 13:93621117-93621139 CAGGGGAAAGAGGGTGAGGTTGG + Intronic
1111856058 13:93639264-93639286 AAGTACAAAGACCCTGAGGAAGG + Intronic
1113434806 13:110282672-110282694 CAGGGTACAGACCCTGTGCTTGG - Intronic
1113788836 13:113016693-113016715 CTGTGCAAAGGCCCCGAGGTTGG - Intronic
1114297134 14:21340120-21340142 AAGTGTAAAGGCCCTGAGGTAGG + Intronic
1114441445 14:22751540-22751562 CAAGGCAGATAACCTGAGGTTGG + Intergenic
1114734830 14:25033572-25033594 ATGTGCAAAGGCCCTGAGGTAGG - Intronic
1115546247 14:34467044-34467066 CTGGGCAGAGCGCCTGAGGTTGG - Intergenic
1116638504 14:47429983-47430005 ATGTGCAAAGTCCCTGAGGTGGG + Intronic
1116841872 14:49826971-49826993 AAGGGCAAAGACCCTGAGAGGGG + Intronic
1117012328 14:51483507-51483529 CAGGGCAAAGTCTCTAAGATTGG + Intergenic
1117099649 14:52333412-52333434 CAGGGCAATGACCCTGAGATGGG - Intergenic
1117336228 14:54759364-54759386 AAGGGCAAAGGCTCTGAGGGGGG - Intronic
1117339920 14:54784119-54784141 CGGTGCAAAGGCCGTGAGGTAGG + Intronic
1117555606 14:56880046-56880068 GAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1117573966 14:57079007-57079029 AAGTGCAAAGACCCTGAGGTGGG - Intergenic
1117830051 14:59741219-59741241 CAGTGCAAAGGCCCTGAGCTGGG - Intronic
1117830868 14:59748365-59748387 TAGTGCAAAGCCGCTGAGGTAGG - Intronic
1118163462 14:63313679-63313701 AAGTGCAAAGGCCCTGAGCTGGG - Intronic
1118438497 14:65792241-65792263 CTGGGCAAAGCCCCTGAGGTGGG + Intergenic
1118816012 14:69314506-69314528 CAGGGCCAGGAACCTCAGGTTGG - Intronic
1118970840 14:70636234-70636256 TAGGGGAAAGACACAGAGGTAGG - Intergenic
1118978017 14:70694017-70694039 CAGTGCAAAGGCCCTGAGGTGGG - Intergenic
1119119581 14:72062224-72062246 CATTTCAAAGACCCTGAGGCAGG + Intronic
1119390012 14:74284896-74284918 AAATGCAAAGACCCTGAGATAGG + Intergenic
1119433077 14:74581001-74581023 AAGTGCCAAGGCCCTGAGGTGGG + Intronic
1119617167 14:76106531-76106553 TAGTGCAAAGGCCCTGGGGTGGG - Intergenic
1119644241 14:76337053-76337075 AAGTGCAAAGGCCCTGAGGTAGG + Intronic
1119656910 14:76423805-76423827 GGGAGCAAAGACCCTGAGGTGGG + Intronic
1119693647 14:76695785-76695807 CAGGGAAGAAACCCTGAGGAGGG - Intergenic
1119817225 14:77580509-77580531 AAGGGAAAAGAACCTAAGGTGGG - Intronic
1119897245 14:78230654-78230676 AATTGCAAAGACTCTGAGGTTGG + Intergenic
1119935112 14:78585268-78585290 CAGTGCAAAGGACCTGAGGTGGG + Intronic
1120109775 14:80540416-80540438 CAGGGCCAAGGCCCTAAGGAGGG + Intronic
1120383357 14:83811258-83811280 CACAGCAAAGACCTTGAGATGGG + Intergenic
1120823635 14:88935542-88935564 AAGTGCAAAGGCCTTGAGGTAGG - Intergenic
1121241941 14:92437264-92437286 CAGTGCAAAGGCCCTGAGGTAGG - Intronic
1121307874 14:92918170-92918192 CAGTGCAAAGGCCCTGGGGCGGG - Intergenic
1121307886 14:92918203-92918225 CAGTGCAAAGGCCCTGGGGTGGG - Intergenic
1121490619 14:94356546-94356568 AAGTGCAAAGGCCCTGGGGTAGG - Intergenic
1121554278 14:94824534-94824556 AAGTGCAAAGGCCCTGAGGGAGG + Intergenic
1121598086 14:95181121-95181143 CAGTGCAAAGGCACTGAGGCAGG - Intergenic
1121613325 14:95295774-95295796 AAGTGCAAAGGTCCTGAGGTAGG - Intronic
1121740970 14:96252194-96252216 CAGTGCAAAGGCCCTGAGGTGGG + Intronic
1121805950 14:96822956-96822978 TTGTGCAAAGACCCTAAGGTGGG - Intronic
1121824218 14:96997492-96997514 CAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1121827002 14:97018614-97018636 GAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1122020073 14:98830466-98830488 TGGTGCAAAGACCTTGAGGTGGG - Intergenic
1122283298 14:100636814-100636836 CAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1122289408 14:100672118-100672140 GCGTGCAAAGGCCCTGAGGTGGG + Intergenic
1122731975 14:103807125-103807147 AAGTGCAAAGCCCCTGAGGCAGG - Intronic
1123450488 15:20356806-20356828 CAGGGCGAAGGCCCGGAGGAGGG - Intergenic
1123695106 15:22873450-22873472 CAGGACAAAGCCCCAGAGGAGGG - Intronic
1124221233 15:27851435-27851457 CTGAGCCACGACCCTGAGGTTGG - Exonic
1124720089 15:32104275-32104297 CAGTGCAAAGGCCCTGAGGGGGG - Intronic
1124893411 15:33754442-33754464 CAGTGCAAAGGTCCTGAGGCAGG - Intronic
1125076735 15:35628155-35628177 CAATGCAAAGGCCCTGATGTGGG + Intergenic
1125212466 15:37233235-37233257 CAGGTCAAAGACAGTGAGGCAGG + Intergenic
1125285421 15:38087754-38087776 CAGGGCACAGACACGGAGTTCGG - Intergenic
1125325207 15:38529414-38529436 AAATGCAAAGGCCCTGAGGTAGG - Intronic
1125335598 15:38623186-38623208 AAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1126074652 15:44897678-44897700 CAGGGCAGATCACCTGAGGTCGG - Intergenic
1126758246 15:51945400-51945422 AAGTGCATAGGCCCTGAGGTGGG - Intronic
1127146290 15:56027504-56027526 AAGTGCAAAGGCCCTGAGGTGGG - Intergenic
1127248996 15:57209892-57209914 AAATGCAAAGGCCCTGAGGTAGG - Intronic
1127381023 15:58430597-58430619 CTGTGCAAAGGCCCTGAGGTAGG - Intronic
1127969615 15:63948037-63948059 GTGGGCAAAGCACCTGAGGTCGG + Intronic
1128135433 15:65259847-65259869 CTGGGCAGACACCCTGAGCTAGG - Intronic
1128317574 15:66670952-66670974 AAGGGCAAAGGCCCTGAGGTGGG + Intronic
1128368580 15:67022778-67022800 CAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1128369862 15:67032766-67032788 AAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1128425437 15:67537942-67537964 AAATGCAAAGGCCCTGAGGTGGG + Intergenic
1128705185 15:69832932-69832954 CAGTGCAAAGGCCCTGAGCTGGG - Intergenic
1128727626 15:69999550-69999572 AAAGGCCAAGGCCCTGAGGTGGG - Intergenic
1128865319 15:71110726-71110748 CTTTGCAAAGACCCTGAGGAAGG - Exonic
1129052391 15:72793310-72793332 CAGAGCAAAGACTCTTAGGAAGG - Intergenic
1129102840 15:73282105-73282127 AAGGGAAAGGACCCTGAGGCAGG - Intronic
1129168491 15:73793375-73793397 CAGTGCAAAGGCCGAGAGGTGGG - Intergenic
1129266035 15:74393627-74393649 CAGGGCAAAGGCCCGGGGCTGGG - Intergenic
1129666063 15:77579992-77580014 AAGTGCAAAGGCCCTGAGGCGGG - Intergenic
1129695456 15:77738414-77738436 GAGGGCAAAAACCCTGAGACTGG - Intronic
1129756052 15:78099829-78099851 CAGTGCAGAGGCCCTGAGGTGGG - Intronic
1129938816 15:79476151-79476173 CAGTGAAAAGGTCCTGAGGTGGG + Intergenic
1130059285 15:80558054-80558076 ATGTGCAAAGGCCCTGAGGTTGG - Intronic
1131078334 15:89513280-89513302 CAGAGCAAAGGCCCTGAGAGGGG + Intergenic
1131111200 15:89766326-89766348 GAAGGCAAAGATCCTGAGGCAGG - Intronic
1131246213 15:90795976-90795998 TAGAGCAAAGGCCCTAAGGTGGG + Intronic
1131255313 15:90858245-90858267 CAGTGCAAAGGCCCTGTGGCAGG + Intergenic
1131305863 15:91242612-91242634 CAGTGTGAAGACTCTGAGGTGGG + Intronic
1131380697 15:91961599-91961621 AAGTGCAAAGGCCCTGAGGTAGG - Intronic
1131439275 15:92446802-92446824 AAGTGCAAAGGCCTTGAGGTAGG + Intronic
1131451007 15:92539906-92539928 CAGTGCCAAGGCCCTGAGGCAGG + Intergenic
1131676697 15:94677251-94677273 CAGTGGAAATACCCAGAGGTGGG + Intergenic
1132464350 16:70963-70985 CCTGGCACAGACACTGAGGTGGG + Intronic
1132884340 16:2176006-2176028 CAGGTCAAAGACACTGAGCAAGG - Intronic
1133420385 16:5641676-5641698 CAGGGCAAAGGCCTGGAGGCGGG + Intergenic
1133467928 16:6045897-6045919 CAGGGCAAAGGCCCTGAAGTAGG + Intronic
1133568982 16:7023087-7023109 CAGTGCAAAGGCACTGAGGTAGG + Intronic
1133802307 16:9093044-9093066 CAGGGCAGACACCCTGACGCAGG - Intronic
1133901482 16:9979388-9979410 CAGTGCGAAGACACTGAGGAGGG - Intronic
1133906957 16:10031261-10031283 AATGGCAAAGACCCTGAGGTGGG - Intronic
1134030885 16:10991455-10991477 CAGTGCAAAGGCCCTGCGGTGGG + Intronic
1134041329 16:11070768-11070790 CAGAGCAAAGACTCTGAGGTGGG - Intronic
1134071041 16:11259965-11259987 CAGTGCAAAGGCCCTGTGGTGGG + Intronic
1134092770 16:11400263-11400285 CCGTGCAAAGGCCCTGTGGTGGG - Intronic
1134103765 16:11470915-11470937 CAGTGCAAAGGCCCTGGGGCAGG + Intronic
1134369984 16:13614375-13614397 CATGCAAAAGGCCCTGAGGTAGG + Intergenic
1134402826 16:13926183-13926205 GAGGGCACAGGCCCTGGGGTGGG - Intronic
1134552950 16:15146516-15146538 ATGGGCAAACACCCAGAGGTAGG + Intergenic
1134559141 16:15192720-15192742 AAGTGCAAAGGCCCTGGGGTAGG - Intergenic
1134657150 16:15955601-15955623 AAGTGCAAAGGCCCTGAGGCAGG - Intronic
1134678886 16:16110037-16110059 ATGTGCAAAGGCCCTGAGGTAGG - Intronic
1134739364 16:16529122-16529144 CAGTGCAAAGGTCCTGAGGTGGG + Intergenic
1134772325 16:16820487-16820509 AAGGACAGACACCCTGAGGTGGG - Intergenic
1134862724 16:17575020-17575042 AAGTTCAGAGACCCTGAGGTGGG - Intergenic
1134919677 16:18104333-18104355 AAGTGCAAAGGCCCTGGGGTAGG - Intergenic
1134928136 16:18183029-18183051 CAGTGCAAAGGTCCTGAGGTGGG - Intergenic
1135052701 16:19205322-19205344 TAGTGCAAAGGCCCTGAGGTAGG - Intronic
1135121396 16:19769501-19769523 CAGGCCAAAGACCCAAAGATGGG + Intronic
1135123321 16:19785343-19785365 CTTAGCAAAGGCCCTGAGGTGGG + Intronic
1135159241 16:20078864-20078886 CAGTGCAAAGGCCCTGGGGTGGG + Intergenic
1135180468 16:20269343-20269365 AAGAGCAAAGGCCCTGAGATGGG + Intergenic
1135535941 16:23294569-23294591 AAGGGCAAAGGCCCTGCAGTGGG - Intronic
1135830835 16:25771449-25771471 CTGTGCAAAGGCCCTGGGGTAGG - Intronic
1135962890 16:27012476-27012498 GACTGCAAAGGCCCTGAGGTGGG - Intergenic
1135981864 16:27154031-27154053 AAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1136015738 16:27399633-27399655 AAGTGCAAAGGCACTGAGGTAGG - Intergenic
1136026599 16:27472691-27472713 CAGGGCAAAGGCCCCAAGGCAGG - Intronic
1136097268 16:27966053-27966075 CAGTGCGAAGGCCCTGAGGCAGG - Intronic
1136412989 16:30087694-30087716 ACGTGCAAAGGCCCTGAGGTGGG - Intronic
1136633267 16:31502176-31502198 GAGGGCACTGACCCTGAGGTGGG + Intronic
1137386003 16:48043131-48043153 GAGGGCAGTGACCCTGAGCTGGG + Intergenic
1137789206 16:51160598-51160620 AAGTGCAAAGATCCTGAGGTGGG + Intergenic
1137919715 16:52474957-52474979 CAGTGCAAAGGCCCTGGGGTGGG - Intronic
1138075720 16:54040690-54040712 AAGTGCAAAGTCCCTGAGGCTGG + Intronic
1138107502 16:54296710-54296732 AAGTGCAAAGGCCCTGTGGTAGG + Intergenic
1138245464 16:55463809-55463831 AAGTGCAAAGGCCCTGGGGTGGG - Intronic
1138272651 16:55707094-55707116 CATGCCAAGGACCCTGGGGTAGG + Intergenic
1138299266 16:55912630-55912652 CAGGGAAAAGACCAGGAGGAGGG + Intronic
1138335347 16:56248723-56248745 AAGTGCAAAGGCCCTGAGGTGGG + Intronic
1138457885 16:57131797-57131819 ATGTGCAAAGGCCCTGAGGTGGG - Intronic
1138488786 16:57364001-57364023 CCAGGCAAAGACCCAGAAGTGGG - Exonic
1138536390 16:57662616-57662638 AAGAACAAAGATCCTGAGGTTGG + Intronic
1138549331 16:57739007-57739029 AAGTGCAAAGGCCCTGAGGCAGG + Intronic
1138679154 16:58672483-58672505 CAGTGCCAAGGCACTGAGGTGGG - Intronic
1140094790 16:71865654-71865676 CACTGCAAAGTGCCTGAGGTTGG - Intronic
1140128132 16:72134682-72134704 AAGTGCAAAGGCACTGAGGTGGG - Intronic
1140140539 16:72252464-72252486 CAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1140250499 16:73290426-73290448 CTGTGCAAAGGCCCTGGGGTGGG + Intergenic
1140342160 16:74174988-74175010 CTGTGCAAAAACCCTGAGGTGGG + Intergenic
1140483344 16:75274866-75274888 CAGTGCAAAGGCCCTGGGGCAGG - Intergenic
1140529357 16:75650361-75650383 CAGGGCAATCGCCCTTAGGTGGG + Intronic
1140551410 16:75870173-75870195 AATTGCAAAGGCCCTGAGGTGGG + Intergenic
1141112157 16:81278702-81278724 CAGTGCAAAGGCCCTGAGGCTGG - Intronic
1141115864 16:81308837-81308859 CAGTGCAAAAGCCCTGAGGTGGG + Intergenic
1141157226 16:81605650-81605672 CAGTGCAAAGGCTCAGAGGTGGG - Intronic
1141478319 16:84288766-84288788 CTGTGCAAAGGCCCTGGGGTGGG + Intergenic
1141481033 16:84307065-84307087 CAGTGCAAAGGCCCAGAGGTGGG + Intronic
1141641430 16:85343953-85343975 CAGTGCAAAGGCCCTGAGACGGG - Intergenic
1141687515 16:85578745-85578767 CTGTGCAAAGGCCCTGAGGTGGG - Intergenic
1141926082 16:87170528-87170550 CAGTGCAAAGGCCCTGGGGTAGG - Intronic
1142006696 16:87692651-87692673 CAGGGTAAAGTCCCTTAGGATGG + Intronic
1142138287 16:88461331-88461353 CGGGGCAAAGCCCCTGCGGTGGG - Intronic
1142308152 16:89297081-89297103 CAAGGCAGAGACCCTGAGGTTGG + Intronic
1142476930 17:194209-194231 CAGTGGAAAGGCCCCGAGGTAGG - Intergenic
1142489209 17:267000-267022 CGGGGCACAGACCCCGAGGCTGG - Intronic
1142642181 17:1290651-1290673 CAGAGCACAGACCATGATGTGGG - Intronic
1143014770 17:3885810-3885832 CAGGGCAAAGGCATGGAGGTGGG - Intronic
1143297775 17:5883969-5883991 AAGGGCAAAAGCCCTGAGGCAGG - Intronic
1143327161 17:6106887-6106909 AAGTGCAAAGGCCCTGAGGTGGG + Intronic
1143332768 17:6149571-6149593 CTGTGAAAAGGCCCTGAGGTTGG - Intergenic
1143458498 17:7083686-7083708 AAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1143660278 17:8320451-8320473 CAGTGCAAAGGCCCTGCGGCTGG + Intronic
1143777708 17:9210188-9210210 CTGTGCAAAGGCCCTGAGGCAGG - Intronic
1144379974 17:14685096-14685118 CAGTACAAAGGCCCTGGGGTGGG - Intergenic
1144460113 17:15451638-15451660 CTGGGGAAGGACCCTGAGGTGGG - Intronic
1144628686 17:16858581-16858603 AAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1144652716 17:17017519-17017541 AAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1144707826 17:17381004-17381026 CTTGGCAAAGGCCCTGAGGAAGG - Intergenic
1144761028 17:17707492-17707514 CAGTGCAAAGGTCCTGAGGCAGG + Intronic
1144762008 17:17712375-17712397 TAGTGCAAAGGCCCTGAGGTGGG + Intronic
1144823201 17:18089780-18089802 TAGTGCAAAGGCCCTGAGGCAGG + Intronic
1144959101 17:19034818-19034840 ATTTGCAAAGACCCTGAGGTGGG - Intronic
1144961120 17:19044749-19044771 CAGTGCCAAGGCTCTGAGGTGGG + Intronic
1144974041 17:19129775-19129797 CAGTGCCAAGGCTCTGAGGTGGG - Intronic
1144976058 17:19139706-19139728 ATTTGCAAAGACCCTGAGGTGGG + Intronic
1144998685 17:19288554-19288576 CTGTGCAAAGGCCCTGAGGTGGG + Intronic
1145110011 17:20154445-20154467 AAGTGCAAAGGCCCTGAGATGGG + Intronic
1145160271 17:20569152-20569174 AAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1145240283 17:21236944-21236966 GAGGGCATAGCCTCTGAGGTGGG + Intergenic
1145241921 17:21245178-21245200 CAGTGCAAAGGCTCTGAGGCAGG + Intronic
1145253161 17:21307485-21307507 AAGTGCAAAGGCCCTGAGGTGGG + Intronic
1145259803 17:21347912-21347934 CAGTGCAAATGCCCTGTGGTTGG + Intergenic
1145262710 17:21364401-21364423 AAGTGCAAAGGCCCTGGGGTAGG + Intergenic
1145266399 17:21381533-21381555 ATGTGCAAAGGCCCTGAGGTAGG - Intronic
1145316812 17:21740026-21740048 CAGTGCAAATGCCCTGTGGTCGG - Intergenic
1145323410 17:21780433-21780455 AAGTGCAAAGGCCCTGAGGTGGG - Intergenic
1145764936 17:27452089-27452111 ATGTGCAAAGGCCCTGAGGTAGG - Intergenic
1146173801 17:30652001-30652023 CTGTGCAAAGGCCCTGAGGCAGG - Intergenic
1146347257 17:32068022-32068044 CTGTGCAAAGGCCCTGAGGCAGG - Intergenic
1146423801 17:32716153-32716175 ATGTGCAAAGACCCTGAAGTAGG - Intronic
1146442338 17:32908018-32908040 CTGAGCAAAGGCCCTGAGGCAGG + Intergenic
1146486607 17:33248222-33248244 AAATGCAAAGGCCCTGAGGTAGG + Intronic
1146511835 17:33456240-33456262 GAAGCCAAAGACCCTGGGGTGGG - Intronic
1146842550 17:36166038-36166060 CAGAGGCAAGGCCCTGAGGTGGG + Exonic
1146854862 17:36253997-36254019 CAGAGGCAAGGCCCTGAGGTGGG + Exonic
1146865758 17:36334379-36334401 CAGAGGCAAGGCCCTGAGGTGGG - Exonic
1146870762 17:36377889-36377911 CAGAGGCAAGGCCCTGAGGTGGG + Exonic
1146878120 17:36428970-36428992 CAGAGGCAAGGCCCTGAGGTGGG + Exonic
1146882061 17:36450074-36450096 CAGAGGCAAGGCCCTGAGGTGGG + Intergenic
1146927341 17:36754178-36754200 CAGCACAAAGGCCCTGAGGAAGG + Intergenic
1147068628 17:37934991-37935013 CAGAGGCAAGGCCCTGAGGTGGG - Exonic
1147073645 17:37978513-37978535 CAGAGGCAAGGCCCTGAGGTGGG + Intronic
1147080150 17:38014528-38014550 CAGAGGCAAGGCCCTGAGGTGGG - Intronic
1147085167 17:38058051-38058073 CAGAGGCAAGGCCCTGAGGTGGG + Exonic
1147096099 17:38138488-38138510 CAGAGGCAAGGCCCTGAGGTGGG - Intergenic
1147101113 17:38182017-38182039 CAGAGGCAAGGCCCTGAGGTGGG + Intergenic
1147406726 17:40217772-40217794 CAGTACACAGTCCCTGAGGTGGG + Intergenic
1147444185 17:40464752-40464774 ACGTGCAAAGGCCCTGAGGTTGG - Intergenic
1147662625 17:42125139-42125161 CAGGGCTCAGAGCCAGAGGTTGG + Intronic
1147776709 17:42907055-42907077 CAATGCAAAAGCCCTGAGGTGGG + Intronic
1147997359 17:44367931-44367953 CAGTGAAAAGGCCCTGAGGTAGG - Intergenic
1148126186 17:45238334-45238356 AAGTGCAAAGGCCCTGGGGTGGG + Intronic
1148972104 17:51492569-51492591 CAGTGCAAAGGCCCTTAGGTGGG + Intergenic
1148990099 17:51658567-51658589 CAATGCAAAGAGCCTGAGATAGG + Intronic
1149455612 17:56785776-56785798 AAGTGCAAAGACCCTGAGGTGGG - Intergenic
1149595614 17:57862893-57862915 CAGGCCAAAGAGCCTCTGGTGGG + Exonic
1149681454 17:58510352-58510374 AAGTGCAAAGGCCTTGAGGTGGG - Intronic
1149776098 17:59358418-59358440 CAGGGCTCAGAGCCAGAGGTGGG - Intronic
1150072800 17:62166831-62166853 GCGGGCAAATAACCTGAGGTCGG - Intergenic
1150149816 17:62799880-62799902 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1150201886 17:63365691-63365713 AAGTGCAAAGGCCCAGAGGTGGG - Intronic
1150634853 17:66905706-66905728 CATGGGAAAGGCTCTGAGGTGGG + Intergenic
1150805566 17:68316127-68316149 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1150908206 17:69361254-69361276 AAGTGCAAAGGCCCTGAGGAGGG + Intergenic
1151252267 17:72845389-72845411 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1151284553 17:73100567-73100589 AAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1151716422 17:75833276-75833298 AAGGGCAGAGACCCTGAGGCAGG - Intronic
1151893145 17:76963037-76963059 CTGTGCAAAGGCCCTGAGGCAGG + Intergenic
1152315635 17:79578835-79578857 CTGGGCAAAGACCCTGTGCCAGG - Intergenic
1152460342 17:80439061-80439083 CAGGACACAGGCCCTGGGGTGGG - Intergenic
1152496968 17:80680046-80680068 CAGGGCCAAGACCCCCAAGTGGG + Intronic
1152555699 17:81052166-81052188 CAGGGCAAAGGCCCCGAGGCAGG - Intronic
1152655106 17:81515630-81515652 CAGGGCAAGGAGCTGGAGGTGGG - Intronic
1153273152 18:3342863-3342885 GAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1155222937 18:23701847-23701869 ATGTGCAAAGACCCTGAGGCAGG + Intronic
1155557373 18:27034655-27034677 GAGTGCAAAGGCCCTGAGGCAGG - Intronic
1156126679 18:33914282-33914304 AAGTGCAAAGACCCTGAGACAGG + Intronic
1156218889 18:35030899-35030921 AAGTGCAAAGGCCCTGAGGTAGG - Intronic
1156516208 18:37682823-37682845 CAGAACAAAGGCCCTAAGGTAGG + Intergenic
1156707249 18:39898322-39898344 AGGGGAAAAGACCTTGAGGTTGG - Intergenic
1156877461 18:42032187-42032209 CAGTGCACAGCCCCGGAGGTGGG + Intronic
1157156805 18:45276072-45276094 AAGTGCAAAGGCCCTGAGGCTGG + Intronic
1157508371 18:48248381-48248403 AAGTGCAAAGGCCCTGAGATGGG - Intronic
1157976112 18:52328828-52328850 TTGTGCAAAGACCCTGAGATGGG + Intergenic
1158193361 18:54856279-54856301 CAGTGCAAAGGCCCTGGGGCAGG + Intronic
1158261378 18:55609744-55609766 AAGTGCAAAGGCCCTGAGGAAGG - Intronic
1158555667 18:58472695-58472717 AAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1158626359 18:59075131-59075153 CAGGGGAAAGACCCAGTGGGAGG + Intergenic
1158852511 18:61509448-61509470 CAGTGCAAAGGCTTTGAGGTGGG + Intronic
1158925459 18:62253217-62253239 AAGAACAAAGGCCCTGAGGTGGG + Intronic
1160036982 18:75310515-75310537 CAGGGCAGAGGCCATGAGGCTGG - Intergenic
1160428388 18:78794026-78794048 CAGGACTCAGACCCTGAGATGGG + Intergenic
1160688169 19:446952-446974 CATGGCAAAGCCTATGAGGTGGG - Intronic
1160720809 19:596168-596190 CAGGGGAAGAACCCTGAGCTCGG + Intronic
1160729613 19:635165-635187 AAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1160752040 19:738917-738939 CTGTGCAAAGGCCCTGAGGCTGG + Intronic
1160752539 19:741324-741346 CCCTGCAAAGGCCCTGAGGTAGG + Intronic
1160875438 19:1294432-1294454 CAGGGCAAAGGCCTGGAGGCAGG + Intronic
1160978581 19:1806272-1806294 GGGGGCAAAGGCCCGGAGGTGGG - Intronic
1161001597 19:1913682-1913704 CAGGGCACCGACCCTAAGGAAGG + Intronic
1161196967 19:2992242-2992264 GAGGGCAAATCACCTGAGGTCGG + Intronic
1161213312 19:3079706-3079728 CTGTGCAAAGGCCCTGGGGTAGG + Intergenic
1161235596 19:3196560-3196582 CGGTGCAAAGGCCCTGGGGTGGG - Intronic
1161240837 19:3222881-3222903 CCGTGCAAAGGCCCTGAGGCAGG + Intergenic
1161246794 19:3257226-3257248 CAGTGCAAAGGCCCTGAGGCTGG + Intronic
1161274277 19:3406912-3406934 CCGTGCAAAGGCCCTGAGGCAGG + Intronic
1161274888 19:3410445-3410467 CCGTGCAAAGGCCCTGAGGCAGG + Intronic
1161302111 19:3547784-3547806 CAGAGCAAAGGCCCTGTGGGTGG + Intronic
1161307654 19:3576825-3576847 CCGGGCAAAAGCCCGGAGGTAGG + Intronic
1161331757 19:3691959-3691981 CAGGGAAAAGAGCCTGGGGTGGG - Intronic
1161496751 19:4590783-4590805 CCGTGCAAAGGCCCTGAGGCAGG - Intergenic
1161497732 19:4596791-4596813 CAGTGCAAAGGCCCTGAGTCAGG - Intergenic
1161533842 19:4806587-4806609 CTGTGCAAAGGCCCTGAGGCAGG + Intergenic
1161536360 19:4821477-4821499 CAGTGCAAAGGTCCTGAGGCAGG - Intronic
1161544225 19:4870208-4870230 CCGTGCAAAGGCCCTGAGGCAGG + Intergenic
1161621443 19:5299347-5299369 CTGTGCAAAGGCCCTGAGGCAGG - Intronic
1161623220 19:5310128-5310150 CCGTGCAAAGGCCCTGAGGCAGG - Intronic
1161634203 19:5377106-5377128 CTGTGCAAAGGCCCTGAGGCAGG + Intergenic
1161635306 19:5384966-5384988 CAGAGCAAAGGCCCTGCGGCAGG - Intergenic
1161640329 19:5418728-5418750 CAGGGCAAGGACCCTGAGGCTGG + Intergenic
1161650345 19:5480482-5480504 CTGTGCAAAGGCCCTGAGGCAGG + Intergenic
1161658830 19:5533446-5533468 CTGTGCAAAGGCCCTGAGGCAGG + Intergenic
1161664234 19:5565216-5565238 CTGTGCAAAGGCCCTGAGGCAGG - Intergenic
1161700691 19:5793392-5793414 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1161734098 19:5979746-5979768 AAGTGCAAAGACCCTTAGGTTGG - Intergenic
1161741082 19:6021618-6021640 CAGTGCAAAGGCCCTGGGGCAGG + Intronic
1161747261 19:6068648-6068670 CAGTACAAAGGCCCCGAGGTGGG + Intronic
1161761409 19:6175604-6175626 CAGTCCAAAGGCCCTGAGGCTGG + Intronic
1161772259 19:6237181-6237203 CAAGGCAAAGGCCCTGTGGCCGG + Intronic
1161858151 19:6777601-6777623 CAGTGCAAAGGCCCTGAGGTAGG + Intronic
1161859212 19:6785065-6785087 CAGTGCAAAGGCCCTGAGGCTGG - Intronic
1161869124 19:6856952-6856974 AGGTGCAAAGGCCCTGAGGTGGG + Intronic
1161963029 19:7533404-7533426 AAGTGCAAAGGCCCGGAGGTGGG + Intronic
1162080701 19:8215971-8215993 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1162110337 19:8396626-8396648 CCGTGCAAAGGCCCTGAGGCAGG + Intronic
1162126200 19:8500635-8500657 CAGGGCAGAGGCCCCGAGGTCGG - Intronic
1162153636 19:8662454-8662476 CTGTGCAAAGACCCTGAGGCAGG + Intergenic
1162156370 19:8680860-8680882 CTGTGCAAAGGCCCTGAGGTGGG + Intergenic
1162217640 19:9149600-9149622 AGGTGCACAGACCCTGAGGTGGG + Intronic
1162400657 19:10444635-10444657 CTGTGCAAAGGCCCTGAGGCAGG + Intronic
1162418115 19:10550440-10550462 CAAGACAGAGACCCTGAGGCTGG + Intronic
1162418154 19:10550639-10550661 AAGCGCAAAGGCCCTGAGGTGGG - Intronic
1162442175 19:10699725-10699747 AGGTGCAAAGGCCCTGAGGTTGG + Intergenic
1162446233 19:10724570-10724592 CAGTGCAAAGGTCCTGATGTGGG + Intronic
1162449807 19:10747953-10747975 CTGGGCAAAGGCCCTGGGGCAGG + Intronic
1162456517 19:10788323-10788345 CAGTGCAAAGGCCCTGGGGCAGG + Intronic
1162466783 19:10846968-10846990 GTGTGCAAAGGCCCTGAGGTTGG + Intronic
1162518980 19:11167858-11167880 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1162528970 19:11224618-11224640 CAGTGCAAAGGCCCTGAGGCAGG + Intronic
1162554782 19:11380048-11380070 AAGTGCAAAGGCCCTGAGGTGGG - Intronic
1162581566 19:11534349-11534371 TATTGTAAAGACCCTGAGGTGGG + Intergenic
1162747901 19:12809391-12809413 CAGTACAAAGGCCCTGAGCTGGG - Intronic
1162766518 19:12923093-12923115 CAGTTCAAAGGCCCAGAGGTGGG - Intronic
1162819375 19:13213239-13213261 CAGTGCAAAGGCTCTGAGGCTGG - Intronic
1162837887 19:13333282-13333304 AAGTGCAAAGGCCCTGAGCTAGG - Intronic
1162839584 19:13346311-13346333 CAGTGCAAAGGTCCTGAGGCAGG - Intronic
1162850983 19:13430954-13430976 CTGTGCAAAGGCCCTGAGGCTGG + Intronic
1162853507 19:13450290-13450312 CAGTGCAAAGGCTCTGAGGCTGG - Intronic
1162857111 19:13477142-13477164 TGGTGCAAAGGCCCTGAGGTAGG - Intronic
1162857399 19:13479415-13479437 CAGTGCAAAGGCCCTGAGGTAGG + Intronic
1162869705 19:13576208-13576230 AAGTGCAAAGGCCCTGAGGCAGG - Intronic
1162871645 19:13591031-13591053 CAGTGCAAAGGCCCTGAGGCTGG + Intronic
1162950106 19:14066358-14066380 CAGTGCAAAGACCCTGAGGTGGG + Intergenic
1162988615 19:14288039-14288061 CTGTGCAAAGGCCCTGAGGCAGG + Intergenic
1163000106 19:14361950-14361972 CCGTGCAAAGCCCCTAAGGTAGG + Intergenic
1163157453 19:15447255-15447277 CAGTGCAAAGGCCCTGTGGTGGG - Intronic
1163183183 19:15618302-15618324 GAGAGAAAAGACACTGAGGTTGG - Intronic
1163253099 19:16138432-16138454 ACGGGCAAAGGCCCTGTGGTAGG - Intronic
1163272975 19:16265401-16265423 CAGTGCCAAGACCCTGAGGCAGG + Intergenic
1163414784 19:17179653-17179675 CAGGGCAGATCACCTGAGGTAGG - Intronic
1163447188 19:17353563-17353585 CAGGGCAAAGGCCCCAAGGTGGG - Intronic
1163468553 19:17483813-17483835 CAGTGCAAAGGCCCTGGGGTGGG - Intronic
1163484105 19:17576406-17576428 ATGTGCAAAGGCCCTGAGGTAGG + Intronic
1163561216 19:18020667-18020689 TGGTGCAAAGGCCCTGAGGTGGG - Intergenic
1163576506 19:18113986-18114008 AAGTGCAAAGGCCCTGAGGCTGG - Intronic
1163581037 19:18138892-18138914 CAGGGCAAAGGCTCTGAGGTGGG - Intronic
1163610137 19:18296354-18296376 ATGTGCAAAGACCCCGAGGTGGG - Intergenic
1163626079 19:18390544-18390566 AAGTGCAAAGGCCCTGAGATGGG + Intergenic
1163626687 19:18394203-18394225 AGGGGCAGAGACCCAGAGGTGGG - Intronic
1163629683 19:18411660-18411682 CAATGCAAAGGCCCTGGGGTGGG + Intergenic
1163630675 19:18416695-18416717 AAGGGCCAAGGCCCTGAGGTGGG - Intergenic
1163703512 19:18798999-18799021 AGGGGCAAAGGCCCAGAGGTGGG + Intergenic
1163707636 19:18824821-18824843 GAGGGCGAATCCCCTGAGGTCGG - Intergenic
1163720872 19:18897632-18897654 TAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1163730805 19:18948219-18948241 ATGGGCAAAGGCCCTGAGGTGGG + Intergenic
1163766347 19:19165485-19165507 AGGTGCAAAGGCCCTGAGGTGGG + Intronic
1163844508 19:19630641-19630663 CAGTGCAAAGGCCCTGAGGTAGG + Intronic
1163844867 19:19632855-19632877 CAGTGCAAAGGCCCTGAGGTAGG - Intronic
1164426774 19:28148570-28148592 GAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1164514329 19:28921369-28921391 AAGGGCAAAGGCCCTGGGGTGGG + Intergenic
1164700117 19:30279042-30279064 AAGTGCAAAGGCCCTGAGGTTGG - Intronic
1164713626 19:30376288-30376310 CAGGGCAAAGACACAGATGGAGG - Intronic
1165162612 19:33826638-33826660 CAAGGCAAAGGCCTCGAGGTAGG + Intergenic
1165323888 19:35102868-35102890 CTGTGCAAAGGCCCTGAGGTGGG - Intergenic
1165391963 19:35543949-35543971 AAGTGCAAAGGCCCTGAGGCAGG - Intronic
1165463920 19:35960786-35960808 CAGTGCAAAGGCCCTGGGGTAGG - Intergenic
1165476612 19:36034304-36034326 CAGTGCAAAGGTCCTGGGGTAGG - Intergenic
1165700445 19:37933235-37933257 CAGGGCAAAGTCTCCGAGGGAGG - Intronic
1165729361 19:38134860-38134882 GAGGGCAAAGGCCCTTAGCTTGG + Intronic
1165761740 19:38325749-38325771 CAGTGCAATGGCCCTGGGGTGGG + Intronic
1165791972 19:38498091-38498113 CAGTGCAAAGGCCCTGAGGCAGG + Intronic
1165844596 19:38810024-38810046 CAGTGCAAAGGCCCTGAGACAGG - Intronic
1165853879 19:38868758-38868780 CAGTGCAAAGGCCCAGAGGTAGG - Intronic
1165866596 19:38943098-38943120 CCGCGCAAAGGCCCTGAGGTGGG + Intronic
1165950587 19:39472222-39472244 AAGTGCAAAGGCCCTGAGGTGGG + Intronic
1165958737 19:39517633-39517655 CAGTGCAAAGGTCCTGAGGCAGG + Intronic
1166007338 19:39916544-39916566 CAATGCAAAGGCCCTGAGGTGGG - Intronic
1166066376 19:40361625-40361647 CAGTACAAAGGCCCTGAGGGAGG - Intronic
1166109999 19:40616077-40616099 CAGTGCAAAGGCTCTGAGGCAGG + Intronic
1166197111 19:41214325-41214347 CAGTGCAAAGGCCCAGAGGCAGG - Intergenic
1166220292 19:41359954-41359976 CAGTGCAAAGGCCCTGAGGTGGG - Intronic
1166500390 19:43336708-43336730 AAGTGCAAAGGCCCTGAGGTAGG + Intergenic
1166509788 19:43397303-43397325 AAGTGCAAAGGCCCTGAGGTAGG - Intergenic
1166541714 19:43610070-43610092 GGTGGCAAAGACCCTGAGGCAGG - Intronic
1166545518 19:43632604-43632626 AAGGGAAAAGGCCCTGTGGTGGG - Intronic
1166658425 19:44628969-44628991 AAGTGCAAAGGCCCTGAGGCAGG + Intronic
1166672537 19:44719507-44719529 CAGTGCAAAGGCCCCGAGGAAGG - Intergenic
1166690087 19:44817300-44817322 AAGTGCAAAGGCCCTGAGGCAGG + Intronic
1166760899 19:45224074-45224096 AAGTGCAAAGGCCCTGAGGCAGG + Intronic
1166807405 19:45495714-45495736 CAGTGCAAAGGCCCTGAGCCAGG + Intronic
1166865009 19:45830490-45830512 CCAGGCAAAGGCCCTTAGGTGGG + Intronic
1166879891 19:45922334-45922356 CAGTGCAAAGGCCCTGAGGTTGG + Intergenic
1166886089 19:45961864-45961886 GAGTGCAAAGGCCCTGAAGTGGG + Intronic
1166929187 19:46291098-46291120 AAGTGCAAAGGCCCTGAGGTGGG - Intergenic
1166936592 19:46337213-46337235 AAGTGCAAAGGCCCTTAGGTGGG + Intronic
1166946904 19:46402952-46402974 CAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1166952482 19:46438803-46438825 CAGTGCAAAGGCCCTGAGGCTGG + Intergenic
1166952677 19:46440217-46440239 CAGTGCAAAGGCCCTGAGGCTGG + Intergenic
1166959874 19:46490943-46490965 CAGTGCAAAGGCCATGAGGCAGG + Intronic
1167090337 19:47339715-47339737 CAGTGCAAAGGCCCTGAGGTGGG - Intronic
1167111627 19:47465996-47466018 CAGGGCCATGAGCGTGAGGTTGG + Exonic
1167150612 19:47707249-47707271 CAGTGCAAAGGCCCTGTGGCAGG + Intergenic
1167209179 19:48122452-48122474 CGGTGCAGAGACCCTGAGGGAGG - Intronic
1167257018 19:48436778-48436800 CAGTGCAAAGGCCCTGGGGCAGG + Intronic
1167277855 19:48549842-48549864 AAGGGCAAAGGCCCTGCAGTAGG + Intergenic
1167284029 19:48588825-48588847 AGGTGCAAAGGCCCTGAGGTGGG + Intronic
1167347790 19:48957098-48957120 AAGTGCAAAGGCCCTGAGGTAGG + Intronic
1167348962 19:48963253-48963275 GAGGGCAGAGACCCAGAGGGAGG - Intergenic
1167408106 19:49327498-49327520 CTGTGCAAAGGCCCTGAGGCAGG + Intergenic
1167417287 19:49381629-49381651 AAGTGCAAAGGTCCTGAGGTTGG + Intergenic
1167444738 19:49530910-49530932 AAGTGCAAAGGCCCTGAGGCAGG + Intronic
1167485183 19:49758604-49758626 CAGGGCAAAGAGTCTGGGCTGGG - Intronic
1167487891 19:49773836-49773858 CTGTGCAAAGGCCCTGAGGCAGG + Intronic
1167555547 19:50192989-50193011 CCGTGCAAAGGCCCTGAGGTGGG + Intronic
1167562228 19:50232788-50232810 CTGTGCAAAGGCCCTGAGGCAGG + Intronic
1167565292 19:50252316-50252338 CAGGGGTAAAACCCCGAGGTGGG + Intronic
1167569484 19:50277997-50278019 CAGTGCAAAGGCCCTGAGATGGG + Intronic
1167637498 19:50663381-50663403 CAGTTCAAAGGCCCTGAGGTGGG - Intronic
1167687269 19:50964159-50964181 CAGTGCAAAGGCCCTGAGGTGGG - Intronic
1167702070 19:51054712-51054734 TAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1167793374 19:51693918-51693940 CAGGGCAAAGACTCAGAGAGGGG + Intergenic
1168237764 19:55074353-55074375 AAGTGCAAAGGCCCTGAGGCAGG + Intronic
1168335717 19:55596502-55596524 AAGTGCAAAGGCCCTGAGGAAGG - Intronic
1168678700 19:58297930-58297952 CAGGGCAGTAGCCCTGAGGTTGG + Exonic
926316492 2:11714267-11714289 CAAGGCAAAGAGGCTGCGGTGGG - Intronic
926783174 2:16494403-16494425 AAGTGCAAAGGCCTTGAGGTGGG - Intergenic
927241895 2:20926515-20926537 AAATGCAAAGGCCCTGAGGTAGG - Intergenic
927865774 2:26586297-26586319 CCGTGCAAAGGCCCTGAGGCAGG - Intronic
928151438 2:28833376-28833398 AAGTGCAAAGACCATGAGATGGG - Intronic
928256018 2:29723259-29723281 CAGTGCAAAGGCCCTGGGGTGGG - Intronic
928499581 2:31876232-31876254 CAGTGCAAAGACCTTAAGATTGG - Intronic
929005923 2:37392647-37392669 CTGTGCAAAGGTCCTGAGGTAGG - Intergenic
929059123 2:37905252-37905274 CAGGGCAAAGGTGCTGTGGTGGG - Intergenic
929336511 2:40754016-40754038 CAGTGCAAATATTCTGAGGTAGG - Intergenic
929611221 2:43272142-43272164 TACTGCAAAGGCCCTGAGGTTGG + Intronic
929758431 2:44786971-44786993 AAGTGCAAAGGCCCTGAGGCAGG + Intergenic
929852442 2:45604604-45604626 AAGTGCAAAGACCCTGAGGCAGG - Intronic
929870891 2:45758467-45758489 AAGTGCAAAGACTCTGAGGTAGG - Intronic
929988934 2:46767903-46767925 ATGTGCAAAGGCCCTGAGGTGGG - Intergenic
930043277 2:47146027-47146049 CAGTGAAAATACCTTGAGGTAGG + Intronic
930066219 2:47329666-47329688 AAGTGCAAAGACCCTGGAGTGGG + Intergenic
931131421 2:59340834-59340856 GAGTGCAAAGGCCCTGAGGCAGG + Intergenic
931183987 2:59931799-59931821 ACGTGCAAAGACCCTGAGGTAGG + Intergenic
931622903 2:64229046-64229068 CAGGAAAAAAACCATGAGGTAGG - Intergenic
931625087 2:64250216-64250238 TAGTGCAAAGGCCCTGTGGTAGG + Intergenic
931756592 2:65380055-65380077 CAAGGGAAGGACCCTCAGGTTGG - Intronic
931807868 2:65825504-65825526 AAGTGCAAAAGCCCTGAGGTTGG - Intergenic
932017276 2:68043951-68043973 CAGGGCAAAGACCCCAAGGCAGG - Intronic
932310778 2:70738507-70738529 GAGGGTACAGACCCTGAGCTAGG - Intronic
932471559 2:71962694-71962716 GAGGCAAAAGACCCTGAGGGTGG - Intergenic
932704999 2:74017369-74017391 CAGGGGAAATACCCAAAGGTTGG - Intronic
932744460 2:74321322-74321344 CAGGAGAAAGAACCTGAGGAAGG + Intronic
932746054 2:74334384-74334406 AAGTGCAAAGGTCCTGAGGTGGG - Intronic
932759553 2:74430414-74430436 CAGGGGAATGACCCTGAAGTAGG - Intronic
933284418 2:80369646-80369668 AAGGTTAAAGACCCTGAGATGGG + Intronic
933771588 2:85748083-85748105 CAATGCAAAGGCCCTGAGGTGGG + Intergenic
934657002 2:96121630-96121652 CAGTGCAAAGGCCCTGAGGCAGG - Intergenic
934747083 2:96766407-96766429 CAGGGCAAAGGCCCCATGGTGGG - Intronic
935121283 2:100185667-100185689 AAGTGCAAAGGCCCTGGGGTGGG + Intergenic
935553975 2:104486622-104486644 GAGTGCAAAAGCCCTGAGGTGGG - Intergenic
935618982 2:105112489-105112511 TAATGCAAAGACCCTGTGGTGGG + Intergenic
935743678 2:106172869-106172891 AAGTGCAAAGGCCCTGAGGCAGG - Intronic
935975760 2:108576892-108576914 CAGGGAGAACTCCCTGAGGTAGG + Intronic
936376975 2:111949033-111949055 CAGTGCAAAGGTCCTGAGGCAGG - Intronic
936400922 2:112163913-112163935 CTGGTCAAACATCCTGAGGTGGG - Intronic
936637241 2:114272782-114272804 AAGTGCAAAGGCCCTGAGGAAGG + Intergenic
936904496 2:117521473-117521495 AAGTGGAAAGACACTGAGGTAGG - Intergenic
936951880 2:117985825-117985847 CAGAGAAAAGTCCCTGATGTTGG + Intronic
937152685 2:119696763-119696785 AAGGGCAGAGGCCCTGAGGCAGG + Intergenic
937164001 2:119795076-119795098 CAGAGAGGAGACCCTGAGGTGGG + Intronic
937466155 2:122134908-122134930 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
937478152 2:122233518-122233540 AAGTGCAAAGGCCCTGAGGTAGG + Intergenic
937985284 2:127635558-127635580 CAGGGGAATGACCCTGAGTCAGG - Intronic
939279392 2:140042705-140042727 CAGCGCAAATACCTTGAGGCAGG - Intergenic
939413872 2:141866935-141866957 CATGGCAAAAACTCTGAGTTTGG - Intronic
939571480 2:143845615-143845637 AAGTGCAAAGACCCTCAAGTGGG - Intergenic
939716337 2:145588853-145588875 CCAGGCAAAGGTCCTGAGGTCGG - Intergenic
939734008 2:145820851-145820873 AAGTGCAAAGGCCCTGAGGCAGG - Intergenic
939753664 2:146082171-146082193 CAGTGCAGAGGCCCTAAGGTGGG - Intergenic
939892886 2:147758179-147758201 CAGTGCAAAGGCCTTGAGGTGGG - Intergenic
940340581 2:152576797-152576819 AAGTGCAGAGACCCTGAGGCAGG + Intronic
940689899 2:156903136-156903158 CAGTGCAAAGGCCCTAAGTTGGG + Intergenic
940748293 2:157595787-157595809 AAGAGCAAAGGCCATGAGGTGGG - Intronic
940781980 2:157942571-157942593 CAGGCCAAAGACCCAAAGTTAGG - Intronic
941005765 2:160245356-160245378 CAGTGCAAAGGCCCTGAGATGGG - Intronic
941047708 2:160695349-160695371 CAATGCAAAGGCCCTGAAGTAGG + Intergenic
941070954 2:160954044-160954066 AAGTGCAAAGCCCCTGAGGCTGG - Intergenic
941721954 2:168821766-168821788 AAGTGCAAAGGCCCTGAGGCAGG + Intronic
941858319 2:170252831-170252853 AAGTGCAAAGGTCCTGAGGTGGG + Intronic
941920969 2:170850440-170850462 AAGTGCAAAGGCCCTGAGGCAGG + Intronic
942619093 2:177828671-177828693 CAGTGCAAAGCCCCTGAGGTGGG + Intronic
942649191 2:178149268-178149290 CAGTGCAAACACCCTGGGGCAGG + Intergenic
942665330 2:178311221-178311243 AAGTGCAAAGGCCCTGAGGTGGG - Intronic
942741169 2:179179902-179179924 AAGTGCAAAGGCCCTGAGGCAGG - Intronic
943290497 2:186065115-186065137 CAGTGCAAAGGTCCTGAGGGAGG + Intergenic
943745642 2:191460204-191460226 CAGGACTAACACTCTGAGGTAGG - Intergenic
944668545 2:201976381-201976403 CAGTGCAAAGGCCCTGAGGCTGG + Intergenic
944968240 2:204960993-204961015 AAGTGCAAAGACCCTGAGGCAGG + Intronic
945181242 2:207093414-207093436 CAGTGCAAAGGCCTCGAGGTGGG - Intronic
945324133 2:208463265-208463287 ACAGGCAAAGGCCCTGAGGTGGG - Intronic
945660891 2:212683960-212683982 CAAGGCAAACACCCTGAGGCAGG + Intergenic
945809196 2:214527562-214527584 AAGTGCAAAGGCCCTGAGGCAGG - Intronic
946018723 2:216624757-216624779 AAGGCCACACACCCTGAGGTTGG + Intergenic
946106689 2:217376565-217376587 CAGAGCAAAGGCCCTGAGACGGG + Intronic
946146583 2:217735581-217735603 AGGAGCAAAGGCCCTGAGGTGGG - Intronic
946235159 2:218319973-218319995 ATAGGCAAAGGCCCTGAGGTGGG + Intronic
946669567 2:222088499-222088521 GAGTGCAGAGACCCTGAGGCAGG + Intergenic
946788773 2:223277007-223277029 TGGGGCAAAGACACTGAGGCAGG + Intergenic
946861410 2:224003178-224003200 CAGGGCCGAGGCCCTGACGTGGG + Intronic
946872895 2:224100844-224100866 ATGTGCAAAGACTCTGAGGTGGG - Intergenic
947288292 2:228542895-228542917 GAGTGCAAAGACTCTGAGCTGGG - Intergenic
947421977 2:229949293-229949315 TAGGGTAAATTCCCTGAGGTGGG - Intronic
947422993 2:229957346-229957368 GCGGGCAAATAGCCTGAGGTCGG + Intronic
947491878 2:230602587-230602609 CGGGGCAAGAACCCTGAGCTGGG - Intergenic
947523798 2:230866446-230866468 CTGGGCAGAGACCCTGAGTGAGG + Intronic
947666452 2:231908984-231909006 AAGTGCAAAGGCCCTGCGGTAGG + Intergenic
948060324 2:235038745-235038767 CAGGTCATAGACCCTCAAGTGGG - Intronic
948121068 2:235530860-235530882 CAGAGGAAGGACACTGAGGTGGG - Intronic
948333888 2:237193046-237193068 CCGTGCAAGGGCCCTGAGGTAGG + Intergenic
948446778 2:238039362-238039384 CAGTGCAAAGGCCCTGAGGCAGG + Intronic
948567175 2:238894518-238894540 CAGGGGACAGACCCCGAGGTGGG - Intronic
948763862 2:240209589-240209611 CAGTGCAGACACCCTGAGGCAGG - Intergenic
948795993 2:240402323-240402345 CAGGGCAGGGTCCCTGAGCTGGG - Intergenic
949014359 2:241701483-241701505 CAGGGCCCAGGCCCTGAGGGAGG + Intergenic
1168742294 20:202078-202100 AAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1168763358 20:365002-365024 AAGGGCAAAGGCCCTGGGGCAGG + Intronic
1168787268 20:550783-550805 ATGGGCAAAGACCGTGAAGTAGG + Intergenic
1168832405 20:853791-853813 AAGTGCAAAGGCCCTGAGGTGGG - Intronic
1168844684 20:935822-935844 AAATACAAAGACCCTGAGGTTGG - Intergenic
1168951440 20:1804679-1804701 AAGGGCAAAGGCCTTGAGGTGGG + Intergenic
1168952771 20:1813849-1813871 AAGGGCAAAGGCCCTGAGGTAGG + Intergenic
1168957491 20:1844613-1844635 AAGTGCAAAGTCCCTGAGGTGGG + Intergenic
1168964000 20:1887940-1887962 CCGTGCAAAGGCCCTGAGGTAGG + Intergenic
1168966802 20:1903673-1903695 CAGTGCAAAGGCCCTCGGGTGGG - Intronic
1168968517 20:1914742-1914764 CTGGGCAAAGACTCAGAGGTAGG - Intronic
1168971250 20:1932424-1932446 CAGTGCCAAGACCCTGAGACGGG + Intronic
1168978289 20:1984198-1984220 AAGTGCAAAGGCCCTGAGGTAGG - Intronic
1168981171 20:2005052-2005074 AAGAGCAAACACCCTGAGGTGGG - Intergenic
1169539326 20:6582104-6582126 CAGTGCAAAGGCCCTGTGGTAGG + Intergenic
1169763046 20:9117739-9117761 CAATGCAAAGGCCCTGGGGTAGG - Intronic
1169827640 20:9787334-9787356 CAGTGCAAAGACCTGGAGGTGGG - Intronic
1170184385 20:13571870-13571892 CAGGGTGAAGACCCTGAGGCTGG - Intronic
1170301188 20:14886254-14886276 AAGTGCAAAGGCCCTGAGATAGG + Intronic
1170403521 20:16012244-16012266 AAGGCCAAAGACCCAGAGGAAGG - Intronic
1170426741 20:16242702-16242724 CAGTGCAAAGGTCCTGGGGTAGG + Intergenic
1170541011 20:17388050-17388072 TTGTGCAAAGACCCTGAGGCAGG + Intronic
1170588577 20:17753927-17753949 ATGTGCAAAGACCCTGAGGCAGG - Intergenic
1170724068 20:18910341-18910363 AAAGGCAAGGACACTGAGGTGGG + Intergenic
1170813186 20:19691328-19691350 GAGGGCAAAGTCCTTGAGGCAGG + Intronic
1171063806 20:21993628-21993650 AAGTACAAAGTCCCTGAGGTAGG - Intergenic
1171250012 20:23639677-23639699 CAGTGCAAAGGCCCTGAGGCGGG + Intergenic
1171256112 20:23690192-23690214 CAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1171262331 20:23745865-23745887 CAGGGCCCAGACCCTCAGCTTGG + Intergenic
1171263462 20:23752102-23752124 CAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1171266755 20:23777401-23777423 CAGTGCAAAGGCCCTGAGGCGGG + Intergenic
1171272515 20:23827874-23827896 CAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1171276301 20:23859045-23859067 CAGTGCAAAGGCCCTGAGGCGGG + Intergenic
1171284058 20:23923422-23923444 CAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1171291888 20:23987123-23987145 CAGTGCAAAGGCCCTGAGGCAGG + Intronic
1171956551 20:31468243-31468265 AAGGGCCAAGGCCCTGAGGCAGG - Intronic
1171976135 20:31595946-31595968 AAGGGCAAGGGCCCTGAGGCAGG + Intergenic
1171982205 20:31636127-31636149 CTGTGCAAAGACCCAGAGGCAGG - Intergenic
1171987764 20:31672500-31672522 AAGTGCAAAGGCCCTGAGGTGGG + Intronic
1172014119 20:31862879-31862901 CATGGCAAAGGCCTGGAGGTGGG - Intronic
1172027047 20:31955614-31955636 CAGTGGAAAGACCCTGAGGCAGG - Intergenic
1172065789 20:32219355-32219377 AGGAGCAAAGACCCTGAGGCAGG + Intronic
1172107509 20:32525394-32525416 CAGGGCACAGGCTCTGGGGTGGG + Intronic
1172127887 20:32636047-32636069 CAGTGGAAGGACCCTGAGGGGGG - Intergenic
1172212924 20:33213651-33213673 GAGGGCAAAGGCCCTCAGGTGGG - Intergenic
1172226476 20:33308322-33308344 AAGTGCAAAGGCCCTGAGGCAGG + Intronic
1172281838 20:33713290-33713312 CAGTGCAAAGACCTTGAGATAGG - Intronic
1172291473 20:33780206-33780228 CAGTGCCAAGGCCCTGAGGTGGG + Intronic
1172313894 20:33938772-33938794 AAGTGCAAAAGCCCTGAGGTAGG - Intergenic
1172440343 20:34960988-34961010 CAGGGCACAGACCCTAGAGTTGG - Intergenic
1172626330 20:36349563-36349585 AAGTGCAAAGGCCCTGAGGCAGG + Intronic
1172757246 20:37294568-37294590 AAGGGCCAAGTCCCTGAGGCAGG - Intronic
1172781229 20:37437956-37437978 CAGTGCCAAGACCCTGAGAGAGG - Intergenic
1173041173 20:39464372-39464394 AAGAGCAAAGACCTTGAGGCAGG + Intergenic
1173179795 20:40797178-40797200 CAGGGCTAAGAGCATGAGGGAGG + Intergenic
1173194551 20:40903562-40903584 AAAGGCAAAGACCCAGAGGCAGG + Intergenic
1173373232 20:42459178-42459200 AAGTGCAAAGGCCCTGAGGCAGG + Intronic
1173385209 20:42581106-42581128 CATTGCAAAGGCCCTGAGGCAGG - Intronic
1173598676 20:44277394-44277416 GAGGGCAAAGGCCCTGTGGTAGG + Intronic
1173693281 20:44983067-44983089 CAGTGCAAAGACCTTGAGGCTGG + Intronic
1173802907 20:45905983-45906005 ATGAGCAAAGGCCCTGAGGTGGG + Intronic
1173850369 20:46214125-46214147 AGGTGCAAAGGCCCTGAGGTGGG + Intronic
1173916289 20:46710665-46710687 CAGTGCAAAGGCCCTCAGGCAGG + Intronic
1173919084 20:46730561-46730583 AAGTGCAAAGGCCCTGAGGTGGG + Intronic
1174043253 20:47714818-47714840 AAGGGCAAAGGCCCTGGGGCAGG - Intronic
1174052005 20:47773434-47773456 AAGTGCAAAGGCCCTGGGGTGGG + Intronic
1174054846 20:47791402-47791424 AAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1174110712 20:48195993-48196015 AAATGCAAAGGCCCTGAGGTGGG - Intergenic
1174114049 20:48214748-48214770 CAGTGCAAAGGCCCTGGGGCAGG - Intergenic
1174117614 20:48237992-48238014 AAGTGCAAAGACCCTGAGGCAGG - Intergenic
1174121482 20:48268924-48268946 CAGGGCAAAGGCCCTGAGGCAGG - Intergenic
1174122236 20:48274710-48274732 CAGGGAAAAGACCTTGAAGCAGG - Intergenic
1174126316 20:48309494-48309516 AAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1174163898 20:48571155-48571177 AAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1174167803 20:48597782-48597804 CAGTGCAAAGTCCCTGGGGCAGG + Intergenic
1174170652 20:48616220-48616242 AAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1174177880 20:48656529-48656551 TAGGGCAGAGGCCCTGAAGTGGG - Intronic
1174187912 20:48720066-48720088 CAGTGCAAAGGCCCTGGGGCAGG - Intronic
1174189645 20:48731165-48731187 GTGTGCAAAGGCCCTGAGGTAGG - Intronic
1174201371 20:48808812-48808834 AAGTGCAAAGGCCCTGAGGCAGG - Intronic
1174225315 20:48994117-48994139 GAGTGCCAAGGCCCTGAGGTGGG + Intronic
1174264966 20:49324712-49324734 CAGTGCAAAGTCGCTGAGGCAGG - Intergenic
1174268478 20:49349267-49349289 AAGCGCAAAGGCCCTGAGGCAGG + Intergenic
1174268846 20:49351985-49352007 AAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1174277396 20:49413868-49413890 AAGTGCAAAGGCCCTGAGGCTGG - Intronic
1174280713 20:49437240-49437262 AAGTGCAAAGGCCCTGGGGTGGG + Intronic
1174285632 20:49471090-49471112 AAGTGCAAAAGCCCTGAGGTGGG + Intronic
1174292712 20:49520160-49520182 AAGTGCAAAGGCCCTGAGGCAGG - Intronic
1174293010 20:49522185-49522207 AAGTGCAAAGGCCCTGGGGTTGG - Intronic
1174302920 20:49595160-49595182 GTGTGCAAAGGCCCTGAGGTGGG - Intergenic
1174360899 20:50028376-50028398 CAGTGCAAAGGCCCTGAGGCTGG - Intergenic
1174373556 20:50110843-50110865 TAGTGCAAAGGCCCTGTGGTGGG - Intronic
1174380033 20:50150398-50150420 AAATGCAGAGACCCTGAGGTGGG - Intronic
1174385370 20:50185653-50185675 AAGTGCAAAGGCCCTGAGGTAGG - Intergenic
1174397687 20:50258056-50258078 CAGTGCAAAGGCCCTGAGGCGGG + Intergenic
1174428284 20:50448844-50448866 AAGTGCAAAGGCCCTGAGGTTGG - Intergenic
1174447968 20:50602911-50602933 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1174503025 20:50999541-50999563 AAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1174566110 20:51465573-51465595 CAGTACAAAGGCCCTGAGGCAGG - Intronic
1174586031 20:51609075-51609097 CAGTGCAAAGGCACTGAGGCGGG + Intronic
1174670730 20:52305458-52305480 CTGTGCAAAGGCCCTGAGGCAGG - Intergenic
1174774874 20:53334410-53334432 AAGTGCACAGGCCCTGAGGTGGG + Intronic
1174786825 20:53440871-53440893 AAGTGCAAAGGCCCTGAGGCAGG + Intronic
1174872831 20:54199495-54199517 AAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1174887186 20:54348785-54348807 AAGGTCAAAGACCCTGAGGTAGG + Intergenic
1175004429 20:55667136-55667158 AAGAGCAAAGACCCAGAGGTGGG + Intergenic
1175040040 20:56040349-56040371 AAGTGCAAAGGCCCTGAGGTAGG - Intergenic
1175110829 20:56646776-56646798 ATGTGCAAAGGCCCTGAGGTGGG + Intergenic
1175136650 20:56829277-56829299 AAGGGTAAACGCCCTGAGGTGGG - Intergenic
1175170546 20:57077277-57077299 AAGTGCAAAGACCCTGCAGTGGG + Intergenic
1175192485 20:57220892-57220914 CAGGGCAAAGATACTGTGGCCGG + Intronic
1175227378 20:57452496-57452518 CAGTGCAAAGGCCTTGAGGCAGG + Intergenic
1175261780 20:57679236-57679258 AAGTGCAAATGCCCTGAGGTAGG + Intronic
1175298555 20:57926797-57926819 ATGTGCAAAGATCCTGAGGTTGG + Intergenic
1175327101 20:58137502-58137524 AAGTGCAAAGGCGCTGAGGTGGG + Intergenic
1175384445 20:58585192-58585214 CAGTGCCAAGGCCCTGAGGCAGG + Intergenic
1175419291 20:58821242-58821264 CAGTGGAAGGGCCCTGAGGTGGG - Intergenic
1175464005 20:59177420-59177442 CAGTGCAAAGGCCCTGAGGTGGG - Intergenic
1175502452 20:59460156-59460178 CAGGGAGAAGAGACTGAGGTTGG + Intergenic
1175520576 20:59600109-59600131 CTGAGCGAAGACCATGAGGTGGG - Intronic
1175532818 20:59685648-59685670 AGAGGCAAAGACCTTGAGGTGGG - Intronic
1175550050 20:59811640-59811662 CAGGGCAAAGACAGGGGGGTTGG + Intronic
1175669506 20:60889979-60890001 AAGTGCAAAGGCCCTGAGATGGG + Intergenic
1175799232 20:61791810-61791832 AAGTGCAAAGGCCCTGGGGTAGG + Intronic
1176316211 21:5246874-5246896 CAGGGCAAGGAGCCTGGTGTGGG - Intergenic
1176425136 21:6544073-6544095 CCATGCAAAGGCCCTGAGGTAGG + Intergenic
1176717525 21:10365753-10365775 CACTGCAAAGGCCCTGAGGCAGG + Intergenic
1177381249 21:20347247-20347269 CAGAGCAAAGACACTGACTTTGG - Intergenic
1177904399 21:26958169-26958191 CAGTGCAAATACGCTGAGGGAGG + Intronic
1178081587 21:29072036-29072058 TAGTACAAAGACCCTGAGGAAGG - Intronic
1178096767 21:29223390-29223412 CATGGCAAACACCCTGAAGTGGG + Intronic
1178462086 21:32811581-32811603 TAGGCCCAAGACCCTGGGGTAGG - Intronic
1178749219 21:35284498-35284520 CAGGGCAAAGACCCTGAGGTGGG - Intronic
1179700627 21:43152390-43152412 CCATGCAAAGGCCCTGAGGTAGG + Intergenic
1180298752 22:11018673-11018695 CACTGCAAAGGCCCTGAGGCAGG + Intergenic
1180765509 22:18343983-18344005 CAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1180780808 22:18518409-18518431 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1180813521 22:18775716-18775738 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1180929410 22:19578840-19578862 CAGTGCAAAGGCCCTGTGGCAGG - Intergenic
1181015956 22:20068901-20068923 GAGCACAAAGACCCTGGGGTGGG - Intergenic
1181199705 22:21210046-21210068 CAGTGCAAAGGCCCTGAGGCAGG + Intronic
1181274162 22:21677962-21677984 CAGTGCAAAGACCCTGAGGTGGG + Intronic
1181323349 22:22025637-22025659 CAGCACAAAGAGCCTGGGGTGGG + Intergenic
1181400057 22:22645812-22645834 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1181649307 22:24249978-24250000 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1181673446 22:24436855-24436877 CTGGGACAAGACCCTGAGGAAGG + Intronic
1181702031 22:24626910-24626932 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1181731173 22:24847933-24847955 ACGTGCAAAGACCCTGGGGTGGG - Intronic
1181770214 22:25119780-25119802 CAGTGCAAAGGCCCTGAGGCAGG + Intronic
1181774113 22:25147518-25147540 CAGGGCAAAGGACTGGAGGTGGG - Intronic
1181796120 22:25312326-25312348 CAGGGCAAAGACCCTGAGCCTGG + Intergenic
1181811710 22:25407084-25407106 AAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1181836665 22:25615936-25615958 CAGGGCAAAGACCCTAAGGCTGG + Intronic
1181888498 22:26040720-26040742 CAATGCAAAGGCCCTGAGGTAGG + Intergenic
1181971724 22:26695670-26695692 AGGAGCAAAGGCCCTGAGGTGGG + Intergenic
1182048466 22:27295467-27295489 AAGGGCAAGAACCCTGAGATGGG - Intergenic
1182078643 22:27512774-27512796 CAGGGCTCAGATCCTGAAGTGGG - Intergenic
1182738475 22:32548203-32548225 AAGTGCAAAGGCCCTGAGGCAGG - Intronic
1182791075 22:32953564-32953586 AGGTGCAAAGACCCTGAGGCTGG + Intronic
1182880898 22:33732429-33732451 CAGTGCAAAGGCCCTGGGGCAGG + Intronic
1182924161 22:34107110-34107132 AAATGCAAAGGCCCTGAGGTGGG + Intergenic
1183022005 22:35034868-35034890 CAGTGCAAAGATCCGGAGGCAGG + Intergenic
1183030281 22:35098789-35098811 CAGTGCCAAGACCCTGAGGCAGG - Intergenic
1183086035 22:35487812-35487834 CTGTGCAAAGGCCCTGAGGCAGG + Intergenic
1183154405 22:36063959-36063981 CAGTGCAATGGCCCTGAGGTAGG - Intergenic
1183252880 22:36742851-36742873 CTGGGCAAGGGCCCTGAGGAGGG + Intergenic
1183253082 22:36744032-36744054 CAGGCCAGAGACCCTGAGGTGGG - Intergenic
1183354847 22:37352654-37352676 AAGTGCAAAGGCCCTGAGGCTGG + Intergenic
1183560759 22:38570561-38570583 CCGGGAGAAGACCCTGAGGCGGG + Intergenic
1183691895 22:39394888-39394910 AAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1183900269 22:41000382-41000404 AAGGGCAAAGTCCCTGTGGTAGG - Intergenic
1184059488 22:42073638-42073660 AAGGGCAAAGGCTCTGAGGCGGG + Intergenic
1184088049 22:42277542-42277564 ATGGGCAAAGGCCCTGCGGTAGG + Intronic
1184098185 22:42327892-42327914 CTGTGCAAAGCCCCTGCGGTAGG - Intronic
1184099085 22:42332277-42332299 AAGTGCAAAGGCCCTGAGGTAGG + Intronic
1184104589 22:42360079-42360101 GTGGGCAAAGGCCCCGAGGTGGG - Intergenic
1184272759 22:43394021-43394043 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1184406248 22:44302617-44302639 AGGGGCAAAGGCCCTGGGGTGGG + Intronic
1184406262 22:44302657-44302679 AGGGGCAAAGGCCCTGGGGTGGG + Intronic
1184406276 22:44302697-44302719 AGGGGCAAAGGCCCTGGGGTGGG + Intronic
1184406290 22:44302737-44302759 AGGGGCAAAGGCCCTGGGGTGGG + Intronic
1184406304 22:44302777-44302799 AGGGGCAAAGGCCCTGGGGTGGG + Intronic
1184406318 22:44302817-44302839 AGGGGCAAAGGCCCTGGGGTGGG + Intronic
1184406332 22:44302857-44302879 AGGGGCAAAGGCCCTGGGGTGGG + Intronic
1184406346 22:44302897-44302919 AGGGGCAAAGGCCCTGGGGTGGG + Intronic
1184406357 22:44302937-44302959 AGGGGCAAAGACCCTGGGGTTGG + Intronic
1184416601 22:44355464-44355486 CAGTGCAAAGACCCCGAAGCAGG - Intergenic
1184482938 22:44758702-44758724 CAGGGCAAAGGCAGTGGGGTGGG + Intronic
1184582408 22:45426484-45426506 AAGGGCAAAGGCCTTGAGGCAGG + Intronic
1184656332 22:45943901-45943923 CAGGACACAGACCCCGGGGTGGG - Intronic
1185085209 22:48737240-48737262 CAGGACAAAGACCATGAGACAGG + Intronic
1185195978 22:49469854-49469876 CATGGTAAAGACCCTGGGGGAGG + Intronic
1185330907 22:50251634-50251656 CAGGGCAAAGGCCACGAGGCGGG + Intronic
1203227130 22_KI270731v1_random:84873-84895 CAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1203263621 22_KI270734v1_random:1398-1420 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
949303617 3:2614234-2614256 TGGTGCAAAGACCCTCAGGTGGG + Intronic
949337134 3:2987132-2987154 AAGTGCAAAGGCCCTGAAGTGGG + Intronic
949478749 3:4473127-4473149 AAGTACAAAGACCCTGAGGTAGG - Intergenic
949489373 3:4573670-4573692 GAGGACAAAGGCCCTGAGGCAGG - Intronic
949841862 3:8328592-8328614 CAGACCTAGGACCCTGAGGTCGG - Intergenic
949879467 3:8650031-8650053 AAGTGCAAAGGCCCTGAGGTGGG - Intronic
949949030 3:9213863-9213885 AAGTGCAAAGTCCCTGGGGTGGG - Intronic
950016925 3:9760963-9760985 AAGTGCAAAGGCCCTGAGGAGGG - Intronic
950100909 3:10356193-10356215 CCAGGCAAAGGCCCTGAGGCAGG + Intronic
950122167 3:10489074-10489096 CAGTGCAAAGGCCCTGACATGGG - Intronic
950196324 3:11011522-11011544 AAGTGCAAAGGCCCTGAGGCAGG - Intronic
950399702 3:12760457-12760479 CAGGGCAAAGGCCCTGAGGAGGG - Intronic
950420275 3:12894664-12894686 CAGGGCCCAGAACATGAGGTGGG - Intergenic
950475441 3:13211722-13211744 CAGGGCAAAGGCCTGGAGGCTGG - Intergenic
950525891 3:13523031-13523053 AAGTGCAAAGGCCCTGAGGCGGG - Intergenic
950548736 3:13654086-13654108 AAGTGCAAAGGCCCCGAGGTGGG - Intergenic
950566194 3:13771074-13771096 AGGGGCAAAGGCCCTGAGGCAGG - Intergenic
950632258 3:14290257-14290279 GAGTGCAAAGTCCCTGGGGTAGG - Intergenic
950640863 3:14347173-14347195 CAGTGTAAAGGCCCTGAGGTGGG + Intergenic
950665147 3:14490732-14490754 TAGTGCAAAGGCCCTGAGATAGG - Exonic
950670170 3:14521197-14521219 AAGTGCAAAGGCCCTGAGGCAGG - Intronic
950723738 3:14902389-14902411 CTGGGCAAAGACATGGAGGTTGG + Intronic
951054633 3:18133443-18133465 GAGGGGAAAGACCATGAGTTTGG + Intronic
951217288 3:20037409-20037431 AAATGCAAAGGCCCTGAGGTAGG + Intergenic
951349552 3:21589276-21589298 AAGTGCAAAGACCCTGCAGTCGG + Intronic
951414541 3:22407996-22408018 CAGGGAGAAGACTTTGAGGTGGG + Intergenic
951433361 3:22633901-22633923 AAGTGCAGAGACCCTGAGATGGG - Intergenic
951467081 3:23013288-23013310 CAGTGCAAAGACTCCGAGGCTGG - Intergenic
951655735 3:25006008-25006030 GAGTGCAAAAGCCCTGAGGTGGG - Intergenic
952495608 3:33913507-33913529 AAGTGCAAAGACCCGGAGGGAGG + Intergenic
952834097 3:37589691-37589713 CGGTGCAAAGGCCCTGAGGCAGG + Intronic
952970020 3:38644883-38644905 AAGTGCAAAGGCCCTGAGGCAGG - Intronic
953335344 3:42089582-42089604 CAATCCAAAGACCCTGAGGCTGG - Intronic
953447047 3:42977268-42977290 AAGTGCAAAGGTCCTGAGGTGGG + Intronic
953691145 3:45120763-45120785 ATGTGCAAAGGCCCTGAGGTGGG - Intronic
953718435 3:45335340-45335362 AGGAGCAAAGGCCCTGAGGTGGG + Intergenic
953927634 3:46990476-46990498 ATGGGCTAAGACCCTGAGGTGGG - Intronic
954008643 3:47614992-47615014 CAGTGCAGAGGCCCTGAGGCAGG - Intronic
954091661 3:48289290-48289312 CAGGGCAGATCACCTGAGGTCGG - Intronic
954576504 3:51679227-51679249 CAAAACAAAAACCCTGAGGTAGG - Intronic
954652680 3:52174988-52175010 CTGTGCAAAGGCCCTGAGGAGGG - Intergenic
954687263 3:52377663-52377685 AAGGGCAAAGGCCTGGAGGTGGG - Intronic
955017813 3:55088941-55088963 CAGTGCCAAGGCCCTGGGGTAGG - Intergenic
955093326 3:55773251-55773273 CAGTGCAAAGGCCCTAAGGTGGG - Intronic
955195464 3:56801698-56801720 CCGGCCAAGGACGCTGAGGTAGG - Intronic
955231048 3:57098897-57098919 CAGGACAGAGAAACTGAGGTTGG + Intronic
955507935 3:59650694-59650716 CAGTGCAAAGACCCTGAAGCAGG + Intergenic
955969641 3:64425471-64425493 AAGGGCAAATGCCCTGAGGTAGG + Intronic
956000423 3:64724210-64724232 AAGTGCAAAGGCCCTGAGTTTGG + Intergenic
956021258 3:64935529-64935551 ATGTGCAAAGACCATGAGGTGGG + Intergenic
956030313 3:65030202-65030224 CTGTGCAAAGGCCCTGTGGTAGG + Intergenic
956444114 3:69308786-69308808 CAGTGCAAAAGTCCTGAGGTGGG - Intronic
956791418 3:72683099-72683121 CAGGACAAGGGCCCTGGGGTGGG - Intergenic
956823314 3:72973311-72973333 CAGGGGAAAGTCCCGGAGGCAGG + Intronic
956878584 3:73488435-73488457 CTGTGCAGAGACCCTGTGGTAGG - Intronic
957764403 3:84603345-84603367 CAGGGCATAGTCACTGATGTTGG + Intergenic
957957142 3:87202049-87202071 CAGGGAAAAGCCACTGAGGAGGG + Intergenic
958428809 3:94013113-94013135 TAGTACAAAGACCCTGAGGAGGG - Intronic
959105288 3:102058526-102058548 CAGTGCCAAAATCCTGAGGTGGG + Intergenic
959423422 3:106155718-106155740 CATAAGAAAGACCCTGAGGTGGG + Intergenic
959521224 3:107324982-107325004 CAGTGCAATATCCCTGAGGTTGG - Intergenic
959661932 3:108878834-108878856 TAATGCAAAGATCCTGAGGTGGG + Intergenic
960300497 3:115997604-115997626 AAGTGCAAAGGCCCTGAGGTTGG + Intronic
960616770 3:119602953-119602975 CCGGGCAAAGACCCTCAGGCAGG + Intronic
960622579 3:119651187-119651209 CAGTGCAAAGGCCCTGAGGTGGG - Intronic
960659858 3:120045569-120045591 CAGGGGAGTGACACTGAGGTAGG + Intronic
960735907 3:120780440-120780462 TAATGCAAAGGCCCTGAGGTAGG + Intronic
961002290 3:123382105-123382127 CAGATCAAAGGCCCTGGGGTGGG - Intronic
961391973 3:126557711-126557733 CAGGGCAAAGGCCCTCTGGATGG - Intronic
961426421 3:126851933-126851955 CAGGGCAAGCAACCTGAGGCTGG - Intronic
961744755 3:129057406-129057428 AAGTGCAAAGGCCCTGAGGCAGG + Intergenic
961788021 3:129359131-129359153 CAGGGCAAAGGCCCGGAGGCTGG + Intergenic
961796508 3:129412682-129412704 GAAGGCAAAGGCCCTGGGGTAGG - Intronic
961809592 3:129514252-129514274 CAGAGGAAAGACCGTGAGGAAGG - Intronic
962079689 3:132124633-132124655 ATAGGCAAAGTCCCTGAGGTGGG + Intronic
962120423 3:132555011-132555033 AAGTGCAAAGACCCTGAAGTAGG + Intergenic
962159679 3:132985754-132985776 AAATGCAAAGGCCCTGAGGTGGG - Intergenic
962302372 3:134253658-134253680 CAGTGCAAAGGCCCTGAGGTAGG - Intergenic
962396020 3:135015897-135015919 CAGGACAAAGGCCCTGAGGTGGG + Intronic
962408900 3:135124158-135124180 ATGTGCAAAGGCCCTGAGGTGGG - Intronic
962924636 3:139980315-139980337 AAGTGCAAAGGCCCTGAGGCAGG - Intronic
963043200 3:141083933-141083955 GAGGGGAAAGACTCTGAAGTTGG + Intronic
963225169 3:142855023-142855045 CTGTGCAAAGGCCCTTAGGTGGG - Intronic
964011818 3:151900648-151900670 CAGGCTAAACATCCTGAGGTTGG - Intergenic
964419688 3:156488453-156488475 CAGTGCAAAGGCCCTGAGATGGG + Intronic
964424027 3:156533378-156533400 CAGTGGAAAGGCCCTGAGATGGG + Intronic
964655394 3:159061369-159061391 TATGGCAAAGACCACGAGGTTGG + Intronic
964721078 3:159767648-159767670 AAGGGCAAAAGCCCTGAAGTAGG - Intronic
964746847 3:160020499-160020521 AAGTGCAAAGGCCCTGAGGCAGG - Intronic
964841157 3:160994948-160994970 CAATGCAAGGACCCTGAGGTGGG + Intronic
964842289 3:161007393-161007415 AAGGGCAAAGGCCCAGAGGCAGG + Intronic
965141720 3:164845913-164845935 TAGGGCAAAGACATTGTGGTTGG + Intergenic
965412284 3:168347012-168347034 GTGTGCAAAGACACTGAGGTAGG + Intergenic
965688354 3:171328943-171328965 AAGTACAAAGGCCCTGAGGTGGG - Intronic
965696452 3:171413471-171413493 CAGTGCAAAGATGCAGAGGTGGG - Intronic
966863116 3:184241613-184241635 CAGGGCAATGAGGCCGAGGTGGG - Exonic
966883070 3:184360760-184360782 CAGGGGACACACCCTGGGGTGGG + Intronic
967300177 3:188004865-188004887 CAGGGCAATGTCTCTGATGTTGG + Intergenic
967385307 3:188905280-188905302 AAGTGCAAAGGCCCTGAGGCAGG - Intergenic
967427873 3:189348243-189348265 TGGTGCAAAGACCCTGAGGCGGG + Intergenic
967741570 3:193008850-193008872 AAGTGCAAAGACCCTGAGGCTGG - Intergenic
967907033 3:194509963-194509985 AAGTGCAAAGGCCCTGAGGTGGG - Intergenic
968016385 3:195337974-195337996 CAGTGCAAAGGCATTGAGGTGGG - Intronic
968624297 4:1619562-1619584 CAGGGTATAGACCCAGAGATAGG - Intronic
968808469 4:2789530-2789552 AAGTGCAAAGGCCCTGAGGTGGG + Intergenic
969083260 4:4636582-4636604 AAGTGCGAAGACCCTGAGGTGGG + Intergenic
969213220 4:5703964-5703986 CCGTGCAAGGGCCCTGAGGTGGG + Intronic
969317795 4:6392558-6392580 ACGAGCAAAGGCCCTGAGGTAGG + Intronic
969503854 4:7571361-7571383 AAGGGCAAAGACTCAGAGGTGGG + Intronic
969527766 4:7712723-7712745 GTGGCCAAAGACCCTGGGGTGGG - Exonic
970140561 4:12977500-12977522 CAGAGGAAAGACCATGTGGTTGG - Intergenic
970400130 4:15709288-15709310 AATTGCAAAGGCCCTGAGGTGGG + Intronic
971423094 4:26491638-26491660 AAGTGCAAAGGCCCTGAGGTGGG + Intergenic
971861447 4:32110954-32110976 AAGAGCAAAGACCCTGAGAAAGG + Intergenic
972557557 4:40195992-40196014 ATGTGCAAAGGCCCTGAGGTGGG - Intronic
972633243 4:40859845-40859867 CAGTGCAAAGGCTCTGAGGTGGG - Intronic
973333164 4:48930521-48930543 AAGTGCAAAGACCCTGAGGTTGG + Intergenic
973794049 4:54405875-54405897 AAGGGCAAAGGCCCTGAGGTAGG - Intergenic
973816420 4:54623482-54623504 AAGGGGAAAGGCCCTGAGCTTGG - Intergenic
973855399 4:55006071-55006093 CTGAGCAAAGGCCCTGAGGCAGG + Intergenic
974166634 4:58212958-58212980 CAGGTCAAAGACCCTGACAGAGG - Intergenic
974839985 4:67288387-67288409 AAGGGCAAAGGCCTTGAGATAGG - Intergenic
974910094 4:68107520-68107542 CATTACAAGGACCCTGAGGTAGG + Intronic
975201202 4:71592016-71592038 CAGGGTAAGGAACCTGAGATTGG + Intergenic
975270677 4:72428990-72429012 CATGGAAAAGTCTCTGAGGTTGG - Intronic
975455161 4:74581940-74581962 GAGTGCAAAGATCCTAAGGTAGG + Intergenic
975547148 4:75571406-75571428 AAGGGCACAGACCCTGAGGAGGG - Intergenic
975811195 4:78171645-78171667 CTAGGCAAAGAACCTGAGGATGG - Intronic
975855982 4:78624842-78624864 AAGTGCAAAGACCCTGAGGTGGG - Intergenic
976106617 4:81625796-81625818 AAGGGCAAAGGCTCTGAGGCAGG - Intronic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
976913505 4:90339594-90339616 AAGTGCAAAGACACTGGGGTGGG - Intronic
977312005 4:95399615-95399637 AAGAGCAAAGGCCCTGAGGCAGG - Intronic
977407710 4:96620977-96620999 CAGGGCAAATACCATGTGTTTGG - Intergenic
977916675 4:102601863-102601885 TAGGGGAAAGACAGTGAGGTGGG - Intronic
978219701 4:106256002-106256024 CAGAGAGAAGACCCTGGGGTGGG + Intronic
978788959 4:112640923-112640945 AAGGGCAAAGGCCCTGAAGTGGG + Intronic
980501833 4:133666060-133666082 CAGTGGAAAGGCCCTGAGGTAGG - Intergenic
980671171 4:136008838-136008860 CAGAGACAAGACCCTGGGGTGGG - Intergenic
980754707 4:137143032-137143054 GAGGGCAAATCACCTGAGGTCGG + Intergenic
980971015 4:139567293-139567315 AAATGCAAAGGCCCTGAGGTAGG - Intronic
981562159 4:146059687-146059709 CAGTGCAAAGAGCCTGGGGTGGG - Intergenic
982025822 4:151253253-151253275 CAGTACAAAGTCCCTGAGGCAGG - Intronic
982090346 4:151875106-151875128 CAGGGCAAAGGCTCAAAGGTGGG + Intergenic
982091225 4:151881594-151881616 CAGTGCAAAGGCCCTGAGGTAGG + Intergenic
982445786 4:155489405-155489427 CAGTGCAAAGGCCCTGAAGTGGG + Intergenic
982705466 4:158704432-158704454 GTGAGCAAAGACCATGAGGTGGG - Intronic
982761412 4:159288822-159288844 CAGAGTAAAGACCTTCAGGTGGG - Intronic
982861025 4:160449293-160449315 AAGGGCAGAGACCCTTAGTTTGG + Intergenic
983653979 4:170062457-170062479 CAGAGTAAAGGCCCTGAGATGGG + Intronic
984999238 4:185468585-185468607 AACTGCAAAGACCCTGTGGTGGG - Intronic
985430639 4:189876478-189876500 CAGGGCAAGGAGCCTGGTGTGGG + Intergenic
985631866 5:1018048-1018070 CACTGCAAAGGCCCTGAGGCAGG + Intronic
985731277 5:1550417-1550439 CCGGGCAAAGGCCCTGGGGCAGG - Intergenic
985937612 5:3108770-3108792 CAGTGCAAAGGTCCTGGGGTGGG - Intergenic
986082492 5:4409340-4409362 CAGCACAAAGGCCCTGAGGCAGG + Intergenic
986330001 5:6711088-6711110 AAGTGCAAAGGCCCTGAGGCAGG + Intergenic
986764823 5:10915855-10915877 CTGGGCAAAGCCCCTGAGCTGGG + Intergenic
986840217 5:11687947-11687969 TAAGGCAAGGACCCTGAGGTGGG + Intronic
987039892 5:14052574-14052596 AAGGGCAAAGGCCCTGAGGCGGG + Intergenic
987342241 5:16949300-16949322 AAGTGCAAAGGCCCTGAGATAGG - Intergenic
987492957 5:18604349-18604371 CAGAGCAAAATCCCTGAGGTGGG + Intergenic
987858288 5:23450074-23450096 TAGGGCAAAGACTTTGAAGTTGG + Intergenic
988865947 5:35335241-35335263 AAGGGCAAAGACCCTGAGGTGGG - Intergenic
989110610 5:37903533-37903555 CAGTGGAAAGGCCCTGAGGTGGG + Intergenic
989210687 5:38856020-38856042 CTCTGCAAAGACCCTGAGGTTGG - Intronic
989744654 5:44814046-44814068 CAAGTAAAAGTCCCTGAGGTGGG + Intronic
989990934 5:50765031-50765053 GAGGGCAGATCCCCTGAGGTTGG + Intronic
990718380 5:58664938-58664960 CAGCGCCAAGATCCTAAGGTGGG - Intronic
991248593 5:64534196-64534218 GAATGCAAAGACCCTGAGGCAGG + Intronic
991267551 5:64739637-64739659 AAGGGCAAAGAAACTGAGTTAGG - Intronic
991359253 5:65802850-65802872 CAGAGAAGAGACCCTGGGGTGGG + Intronic
991446192 5:66702631-66702653 AAATGCAAAGACCCTGAGGCAGG + Intronic
991915016 5:71597180-71597202 CAGTGCAAAGGCCCTGAGGTGGG + Intronic
991960358 5:72038159-72038181 ATGGGCAGAGACTCTGAGGTTGG - Intergenic
992066852 5:73117286-73117308 AGGTGCAAAGGCCCTGAGGTAGG - Intergenic
992210014 5:74469539-74469561 AAGTTCAAAGACCCTAAGGTGGG - Intergenic
992679612 5:79141009-79141031 CAGTGCCAAGGCTCTGAGGTAGG - Intronic
992940947 5:81760725-81760747 CAAGGCAAAGGCCCTGAGGCTGG - Intergenic
993693493 5:91032161-91032183 CAGTGCAAAGGCCCTAAGGCGGG + Intronic
994128440 5:96196614-96196636 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
994151942 5:96457579-96457601 AAGGGCGAAGGCACTGAGGTAGG - Intergenic
995069941 5:107908697-107908719 CGGGGCAAAGGCCCTTGGGTGGG + Intronic
995112689 5:108445295-108445317 ATGGGCAAAGGCCCTGAAGTAGG + Intergenic
996060903 5:119032198-119032220 CAGTGCAAAGGCCCTGAGTGTGG - Intergenic
996339718 5:122423082-122423104 CAGGGCCAAGCTCCTGAGGCTGG - Exonic
996570149 5:124924891-124924913 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
996628066 5:125594295-125594317 CAAGGCAAAGGCCCTGAGGCAGG + Intergenic
997214571 5:132100139-132100161 CAGCGCAAAGGCTCTGAGGCTGG - Intergenic
997660098 5:135582745-135582767 GAGCACAAAGACCCTGAGGTGGG - Intergenic
997677680 5:135725428-135725450 ACGTGCAAAGGCCCTGAGGTGGG + Intergenic
997715319 5:136038233-136038255 CTGGGGTAAGACCCTGTGGTAGG + Intronic
997728225 5:136140526-136140548 CAATGCAAAGATCCTAAGGTAGG - Intronic
997762968 5:136468081-136468103 AAGTGCAAAGACCCTGAAGCAGG - Intergenic
997791719 5:136767986-136768008 AGGTGCAAAGGCCCTGAGGTAGG + Intergenic
998078182 5:139253320-139253342 CAGTGCAAAGGACCTGAGGCAGG - Intronic
998141542 5:139702328-139702350 AAGTGCAAAGATCCTGAGGCAGG - Intergenic
998155533 5:139784682-139784704 CAGTGCAAAGGCCCTGGGGTGGG - Intergenic
998159546 5:139805725-139805747 TGGTGCAAAGGCCCTGAGGTGGG + Intronic
998174223 5:139891645-139891667 CTGGATAAAGACCCTAAGGTGGG + Intronic
998224467 5:140315795-140315817 CTGGGCACAGAGGCTGAGGTGGG + Intergenic
998375315 5:141686833-141686855 GAGTGCAAAGGCCCTGAGGTAGG + Intergenic
998391792 5:141791809-141791831 CAGTGCAAAGGCTCTGAGGTGGG + Intergenic
998586659 5:143433999-143434021 CAGTAGAAAGGCCCTGAGGTAGG - Intronic
998835236 5:146196857-146196879 AAGTGCAAAGACCCTGAGGCAGG - Intergenic
998879593 5:146632810-146632832 ATGTGCAAAGGCCCTGAGGTGGG + Intronic
999111428 5:149124912-149124934 CAGTGCAAAGACACAGAGGCGGG + Intergenic
999250807 5:150181195-150181217 AAGTGCAAAGGCCCCGAGGTGGG - Intronic
999305373 5:150515971-150515993 AAGGCCAAATACCCTGGGGTGGG - Intronic
999307021 5:150526082-150526104 AAGTGCAAAGGCCCTGAGGTAGG - Intronic
999410683 5:151347222-151347244 ATTGGCAAAAACCCTGAGGTGGG - Intronic
999437799 5:151577690-151577712 CAACGCAAAGGCCCTGAGATGGG + Intergenic
999546726 5:152637358-152637380 CAGGGCAGATCACCTGAGGTCGG - Intergenic
999591903 5:153157495-153157517 AAGGTCAAAGGCCCTGAGCTCGG + Intergenic
999922439 5:156336186-156336208 AAGTGCAAAGGCCCTGAGGCAGG - Intronic
999988948 5:157031963-157031985 GAGTGCAAAGGCACTGAGGTAGG - Intronic
999992696 5:157063886-157063908 AAGGGCAAAGGCCCTAAGGCAGG + Intergenic
1000006591 5:157190765-157190787 AAGTACAAAGACCCTGAGGAAGG + Intronic
1000007498 5:157200603-157200625 CTTTCCAAAGACCCTGAGGTTGG - Intronic
1000036062 5:157448894-157448916 TAGGCCAAAGGCCCTGAGGTGGG - Intronic
1000183109 5:158831870-158831892 AAGTGCAAAGATCCTGAGGCAGG + Intronic
1000299743 5:159945493-159945515 AAATGCAAAGACCCTGAGATAGG + Intronic
1000303816 5:159977855-159977877 AAGTGCAAAGTCCCTGAGCTGGG - Intergenic
1000998454 5:167982120-167982142 CTGTGCAAAGTCCCTGGGGTGGG - Intronic
1001197005 5:169682369-169682391 AGGTGCAAAGGCCCTGAGGTAGG + Intronic
1001288020 5:170437819-170437841 CTGTGCAAAGGCCCAGAGGTAGG - Intronic
1001483064 5:172101848-172101870 CAGTGCCAAGGCCCTGAGGCAGG + Intronic
1001542081 5:172546652-172546674 AAGGTCAAAGTCCCTGAGATGGG + Intergenic
1001544556 5:172563008-172563030 CAATGCAAAGGCCCTGGGGTAGG + Intergenic
1001568477 5:172715282-172715304 CTGGGGAAGGACCCTGAGCTTGG - Intergenic
1001589917 5:172858200-172858222 ATGGGCAAAGGCCCTGAGGTGGG + Intronic
1001590484 5:172861188-172861210 CTTGGCCAAGACTCTGAGGTGGG - Intronic
1001637639 5:173223483-173223505 CAGTGCAAAGACTCTGAGGCAGG + Intergenic
1001753762 5:174150725-174150747 CAGGGCAAAGGCATTGAGTTGGG - Intronic
1002063173 5:176638628-176638650 AAGTGCAAAGGCCCTGAGGCAGG + Intronic
1002068714 5:176665696-176665718 CAGTGCAAAGGTCCTGAGGTAGG + Intergenic
1002207049 5:177570091-177570113 ATGTGCAAAGGCCCTGAGGTGGG - Intergenic
1002367203 5:178722974-178722996 CAGGGCAGAGGCCCTGAGTGGGG + Intronic
1002386543 5:178871302-178871324 CAGGGCAGAGGCCCTGAGTGGGG - Intronic
1002592890 5:180303422-180303444 CAGCGCAAAGGCCCGGAGGCGGG + Intronic
1002691657 5:181054185-181054207 AAGGGGAAAGACTCTCAGGTTGG - Intronic
1003250986 6:4429049-4429071 CAGGGCCAAGACCCTGAAGGGGG - Intergenic
1003276515 6:4658604-4658626 AAGTGCGAAGGCCCTGAGGTGGG + Intergenic
1003455527 6:6278433-6278455 CAGTGCAAAGACCCTGTGGGAGG + Intronic
1003553437 6:7119555-7119577 TTGTACAAAGACCCTGAGGTTGG + Intronic
1003853590 6:10250248-10250270 AAGTGCAAAGGCCCTGATGTTGG - Intergenic
1004078469 6:12367533-12367555 AAGTGCAAATGCCCTGAGGTAGG + Intergenic
1004467403 6:15898651-15898673 CAGGGCAATGACCTTGAGAGTGG - Intergenic
1004548422 6:16622258-16622280 TAATGCAAAGACCCTGAGGGAGG + Intronic
1004700959 6:18079066-18079088 AAGGGCAAAGGCCCTGAGCTGGG + Intergenic
1004761488 6:18671539-18671561 AAGGGCAAGGACTCTGAGGCAGG - Intergenic
1004827272 6:19436654-19436676 AAGTGCAAAGGTCCTGAGGTAGG + Intergenic
1004887582 6:20066529-20066551 TTGGGCAAATACCCAGAGGTGGG - Intergenic
1004927876 6:20432855-20432877 AAGTGCAAAGGCCCTGAGGCAGG - Intronic
1005214702 6:23511624-23511646 CAGGGCGAAGACCCTGAAATGGG - Intergenic
1006179509 6:32146144-32146166 CTGGGCAAATACCTGGAGGTGGG + Intergenic
1006333075 6:33405936-33405958 CCAGGCAAAGGCCCTGAGATGGG - Intronic
1006362898 6:33597057-33597079 AAGGGCAAAGGCCCTGAGACAGG - Intergenic
1006407032 6:33851455-33851477 CAGGACAAAGACCTTGTGGCCGG - Intergenic
1006427342 6:33974720-33974742 ATAGGCAAAGACCCAGAGGTGGG - Intergenic
1006427794 6:33976964-33976986 CAGTGCAGAGGCCCTGAGGCAGG - Intergenic
1006430847 6:33994870-33994892 AAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1006440393 6:34050166-34050188 AAGTGCAAAGGCCCTGGGGTGGG - Intronic
1006451186 6:34106615-34106637 CAGTGCAAAGGCCCTGAGGTGGG - Intronic
1006452631 6:34113974-34113996 CAGTGCAAAGACCCTGAAGCAGG - Intronic
1006457479 6:34140234-34140256 AAGTGCAAAGGCCCTGAGGTGGG + Intronic
1006511515 6:34524041-34524063 CAGAGCAGGGACCCTGAGGTTGG + Intronic
1006589764 6:35145937-35145959 ATATGCAAAGACCCTGAGGTCGG - Intronic
1006805651 6:36787385-36787407 CAGTGCAAAGGCCCTGGGGCAGG - Intronic
1006809974 6:36813727-36813749 AAGTGCAAAGGCCCTGAGGTGGG - Intronic
1006835521 6:36996734-36996756 AAGAGCAAAGGCCCTGAGGTGGG + Intergenic
1006844790 6:37054743-37054765 AAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1006845288 6:37057277-37057299 GAGTGCAAAGGCCCTGGGGTGGG + Intergenic
1006883291 6:37358136-37358158 AAGTGAAAAGACCCTCAGGTAGG + Intronic
1006913305 6:37578308-37578330 CGGAGCAAAGGCCCTGGGGTAGG + Intergenic
1006922621 6:37636635-37636657 CAGGCCCAAGACCCTGTGCTGGG + Exonic
1006929405 6:37678651-37678673 AAGTGCAAAGGCCCTGAGGTGGG - Intronic
1007110005 6:39307911-39307933 AAGTGCAAAGGCCCTGAGATGGG - Intronic
1007116111 6:39344529-39344551 CAGAGCAAAGGCCCTGAGGCTGG - Intronic
1007276466 6:40677922-40677944 GAATGCAAAGACCCTGAGGCTGG - Intergenic
1007375308 6:41452234-41452256 CAGGGCAGCAACCCTGGGGTAGG + Intergenic
1007416068 6:41691940-41691962 AAGTGCAAAGGTCCTGAGGTGGG - Intronic
1007511847 6:42380130-42380152 AAGTGCAAAGGCCCCGAGGTGGG + Intronic
1007561074 6:42808901-42808923 CAGGGCAAGGACACTGAATTTGG - Intronic
1007658044 6:43464539-43464561 TAGTGCAAAGATCCTGAGGCAGG - Intergenic
1007705543 6:43788553-43788575 CAGTGCAAAGGCCCTGTGGCAGG - Intergenic
1007726786 6:43921587-43921609 GAGGGCAAAGACCCTAAGGGAGG - Intergenic
1007768174 6:44173403-44173425 AGGTGCAAAGGCCCTGAGGTGGG - Intronic
1008348019 6:50453473-50453495 CTTGGCAAAGGCCCTGAGGTAGG - Intergenic
1008473038 6:51905488-51905510 TTGTGCAAAGACCCTGAGGAAGG + Intronic
1008493713 6:52111873-52111895 AAGTGCAAAGACCCTGAGAAAGG + Intergenic
1008632978 6:53381703-53381725 CAGGAGAAAGACCTGGAGGTGGG - Intergenic
1008931339 6:56943659-56943681 GAGGGCAAATCACCTGAGGTTGG - Intronic
1009423226 6:63486540-63486562 CAGGGCAAAGATGCAGAGGTAGG + Intergenic
1010700942 6:79046195-79046217 CAGTGCAAAGACCCTAAGTTTGG - Intronic
1010903034 6:81451242-81451264 AAGTGCAAAGTCCCTGAAGTAGG - Intergenic
1011062394 6:83285679-83285701 AAAAGCAAAGACCCTGAGGTGGG + Intronic
1011497447 6:87950499-87950521 CAGGGCAATGGCACTGAGATGGG - Intergenic
1011554915 6:88564143-88564165 CGGAGCAAAGGCCCTGAGGTGGG - Intergenic
1011662772 6:89608606-89608628 GAGGGCAAAGCCACTGAGGTGGG - Intronic
1012412205 6:98971364-98971386 CAGGGCAAAGACTCTACTGTGGG + Intergenic
1012840835 6:104326985-104327007 AAGAGCAAAGGCCCTGAGGCCGG - Intergenic
1013070387 6:106723882-106723904 AAGTGCAGAGCCCCTGAGGTGGG + Intergenic
1013292706 6:108732709-108732731 CAGGGCAAGGCCTCTGAGATGGG - Intergenic
1014749292 6:125237021-125237043 TAGAGCAGAGACCCTAAGGTAGG + Intronic
1014811263 6:125888942-125888964 GAGGACAAAGATCCTGAGGTAGG - Exonic
1014897652 6:126922878-126922900 CATGGGAAAGGCCCAGAGGTAGG - Intergenic
1015069094 6:129067760-129067782 AAGTGCAAAGGCCCTGAGGCAGG - Intronic
1015143330 6:129959035-129959057 CAGAGAGGAGACCCTGAGGTGGG - Intergenic
1015823081 6:137283446-137283468 AAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1015932584 6:138376164-138376186 CAGTGCAAAGGCCCTGAAGCAGG - Intergenic
1016662808 6:146600435-146600457 AAGTGCAAAGGCCCTGCGGTGGG - Intronic
1016678954 6:146805647-146805669 GAGGTCAAAGGCCCAGAGGTGGG - Intronic
1016762314 6:147751111-147751133 CAGTGCAAAGGCCCTGAGATGGG - Intergenic
1016792212 6:148077882-148077904 CAGGGGAAACACCCTGAAGTAGG + Intergenic
1016813134 6:148280246-148280268 CAGGGCAACCACCCAGAGGCAGG - Intronic
1016838394 6:148502536-148502558 CAGTGCAGTGCCCCTGAGGTAGG + Intronic
1017043411 6:150325578-150325600 AAGTGCAAAGGCCCTGAGGTAGG + Intergenic
1017208267 6:151826956-151826978 CAGGGAAGAGGCCCTGATGTGGG + Intronic
1017512216 6:155124556-155124578 CAGGGCAGATCACCTGAGGTCGG - Intronic
1017704212 6:157106049-157106071 CAGGGAAAATTCCCTGAAGTGGG - Intronic
1017752396 6:157500211-157500233 TAGTGCAAAGGCCCTGAGGTGGG + Intronic
1018128408 6:160704741-160704763 AAGGACAAAGTCCCAGAGGTGGG + Intronic
1018152816 6:160956164-160956186 AAGGGCAAGGGCCCTGAGGCAGG + Intergenic
1018385376 6:163298803-163298825 AAAGGCAAAGACCTTGAGGTTGG - Intronic
1018777523 6:167031254-167031276 CATGTGAAAGGCCCTGAGGTGGG - Intronic
1019093223 6:169557397-169557419 CGTGGGGAAGACCCTGAGGTGGG + Intronic
1019113964 6:169741669-169741691 AAGTGCAAAGATCCTGAGGCAGG - Intronic
1019551386 7:1604374-1604396 CAGAGCCGAGGCCCTGAGGTGGG + Intergenic
1019639279 7:2094630-2094652 CAGTGCAAAGGCCCTGGGGCAGG + Intronic
1019949907 7:4362960-4362982 CTGTGCAAAGGCCCTGAGGTGGG - Intergenic
1020131700 7:5562571-5562593 TACTGCAAAGACCCTGACGTGGG + Intronic
1020256713 7:6506492-6506514 CAGGGCAGGGACACTGAGGATGG + Intronic
1020862963 7:13517790-13517812 AAGTGCAAAGGCCCTAAGGTGGG - Intergenic
1021543395 7:21785998-21786020 CAGGGCAAACACTTTGAGGCAGG - Intronic
1021729600 7:23583916-23583938 CAGGGCAGATCACCTGAGGTCGG + Intergenic
1022315148 7:29238810-29238832 CAGGACAAAGACCCTGAGGTGGG + Intronic
1022542609 7:31152785-31152807 CATTGCAAAGGCCCTGATGTGGG - Intergenic
1022560642 7:31345725-31345747 CAGTGCCACGACCCTAAGGTGGG - Intergenic
1022687671 7:32611829-32611851 CAGAGAAAACACACTGAGGTTGG - Intergenic
1022806769 7:33830505-33830527 ACGTGCAAAGGCCCTGAGGTCGG + Intergenic
1022845861 7:34209245-34209267 CTGAGAAAGGACCCTGAGGTGGG - Intergenic
1023119047 7:36890949-36890971 CAGGGCAAAGGCCCTGAGGTTGG - Intronic
1023566292 7:41526736-41526758 CAGGACACAGTCCCTGGGGTTGG + Intergenic
1023924631 7:44657598-44657620 TAGGGCATAGAAGCTGAGGTAGG - Intronic
1024005494 7:45222437-45222459 CTGTGCAAAGGCCCTGGGGTTGG - Intergenic
1024167431 7:46748779-46748801 GAGGGCAAAGACCCTGAAGCAGG - Intronic
1024343812 7:48292637-48292659 AAGTGCAAAGGCCCTGAGGTGGG - Intronic
1024991328 7:55236620-55236642 CAGGGGAAATACCCTGATGTCGG - Intronic
1025238142 7:57248737-57248759 AAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1025247893 7:57331201-57331223 CAGCGCAAAGGCCCTGAGGCAGG - Intergenic
1025256292 7:57385772-57385794 AAGTGCAAAGGCCCTGAGGTGGG - Intergenic
1025924522 7:65946250-65946272 CAAGTCAAAGGCCTTGAGGTAGG - Intronic
1025931843 7:66001479-66001501 CAAGTCAAAGGCCTTGAGGTAGG - Intergenic
1026444124 7:70469430-70469452 AAGAGCAAAGGCCCTGAGGCTGG + Intronic
1028074266 7:86492368-86492390 GAGTGCAAAGACCCTAAGTTGGG - Intergenic
1028159823 7:87473418-87473440 CAATGCAAAGACCCTGAGTCAGG - Intronic
1028233765 7:88335980-88336002 AAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1028872851 7:95787952-95787974 AGGTGCAAAGACCCTGAGGTGGG + Intronic
1029170785 7:98627809-98627831 CAGGGTTAAGACCCTGAGCAGGG - Intronic
1029419144 7:100463393-100463415 CAGGGCAGAGACCATGAGCGTGG + Exonic
1029572509 7:101379510-101379532 CTGTGCAAAGGCCCTGAGGCAGG - Intronic
1030340377 7:108372837-108372859 CTGGGCAAATACCCAGAAGTAGG - Intronic
1031127721 7:117793482-117793504 AAGGACAAAGACCCCGAGGCAGG - Intronic
1032142885 7:129349804-129349826 CAGAGAAAAGACCTTGAGATGGG - Intronic
1032486845 7:132294251-132294273 CAGGACAAAGATCCTGAAGCAGG + Intronic
1032515715 7:132504641-132504663 CAGGGCAAGGCCCAGGAGGTTGG - Intronic
1032527430 7:132589920-132589942 CAGTGCAAAGGCTGTGAGGTGGG + Intronic
1032653412 7:133903068-133903090 CAGGGCAAAGGCCAGGAGGCAGG + Intronic
1032695131 7:134329240-134329262 CAGGGCAGAGACGCTGGGGCAGG - Intergenic
1032719579 7:134539608-134539630 AGGTGCAAAGTCCCTGAGGTGGG + Intronic
1032724541 7:134578377-134578399 AGGTGCAAAGTCCCTGAGGTGGG + Intronic
1032863605 7:135904503-135904525 AGGTGCAAAGGCCCTGAGGTGGG + Intergenic
1033266984 7:139895193-139895215 CAGAGAAAAGCCCTTGAGGTGGG + Intronic
1033399409 7:141007653-141007675 CACAGCAAAGGCCTTGAGGTGGG - Intronic
1034553046 7:151833292-151833314 CAGTGCAAAGGCCCTGAGGCAGG + Intronic
1036675916 8:10833196-10833218 AAGTGCAAAGACCCGAAGGTGGG + Intronic
1036971734 8:13362787-13362809 CGGGGCAAAGGCCCTGAGACAGG - Intronic
1037476501 8:19262922-19262944 CAGTGCAAAGGCCCTGGGGAAGG - Intergenic
1037520286 8:19674444-19674466 AAGGAAAAAGACCCTGAGGCAGG + Intronic
1037529894 8:19762863-19762885 CAGGGAAAATAGCCTGAGGAAGG + Intergenic
1037638905 8:20724881-20724903 ATGGACAAAGGCCCTGAGGTAGG + Intergenic
1037708552 8:21336235-21336257 TAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1037788480 8:21917265-21917287 AAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1038190476 8:25315247-25315269 CTGTGCAAAGGCCCAGAGGTAGG - Intronic
1038376505 8:27045258-27045280 AAGTGCAAAGTCCCTGAGTTGGG + Intergenic
1038482718 8:27912814-27912836 CTGCCCAAAGACCCTGATGTAGG + Intronic
1038531044 8:28318056-28318078 CTGGGCAAAGACCTTTAGGTGGG - Intronic
1038775712 8:30528783-30528805 CAGGTCACAGACCCCAAGGTGGG + Intronic
1038861513 8:31393426-31393448 CAGGTACAAGACCCTGAGGTAGG + Intergenic
1038898108 8:31810525-31810547 CTGTGCAAAGGCCCTGAGGTGGG - Intronic
1039119109 8:34126048-34126070 AAGTGCAAAGGCACTGAGGTAGG - Intergenic
1039483441 8:37892848-37892870 CTGTGCAAAGGCCCTGAGGCAGG - Intronic
1039706226 8:40010273-40010295 AAGTGCAATAACCCTGAGGTGGG + Intronic
1039719478 8:40147178-40147200 CTGTGCAAAGGCCCTGTGGTAGG - Intergenic
1039800231 8:40948197-40948219 TAGTGCAAAGGCCCAGAGGTGGG - Intergenic
1040033856 8:42850110-42850132 CAGGGCAGAGCTCCTGAGGCTGG + Intronic
1041569150 8:59316938-59316960 AAGTGCAAAGCCCCTGAGGTAGG - Intergenic
1041779034 8:61557400-61557422 GAATGCAAAGACCCTGAGGCAGG - Intronic
1042788569 8:72577805-72577827 CTGTGCAAATATCCTGAGGTTGG - Intronic
1042864250 8:73343781-73343803 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1043082504 8:75784326-75784348 CAGAGGAAAGACCCTGGAGTGGG + Intergenic
1044387889 8:91611693-91611715 TTGTGCAAAGGCCCTGAGGTGGG + Intergenic
1044934487 8:97279587-97279609 CAGTGCAAAGGCTCTGAGGCAGG - Intergenic
1044966101 8:97575425-97575447 TAGGGCAAAGGTTCTGAGGTGGG + Intergenic
1045036579 8:98180881-98180903 CTGTGCAAAGGCCCTGAGGCAGG + Intergenic
1045376847 8:101582712-101582734 CTCTGCAAAGACGCTGAGGTGGG - Intronic
1045820092 8:106326696-106326718 CAGTGCAAGGACCATGAGGTGGG + Intronic
1046344887 8:112910486-112910508 GAGGTGAAAGACCCTGAGGAAGG - Intronic
1046345678 8:112923474-112923496 AAGTGTAAAGACCCTGAGGGAGG - Intronic
1046562469 8:115855329-115855351 AAGTGCAAAGATCTTGAGGTAGG - Intergenic
1046823492 8:118661520-118661542 CATGGCAAAGTTCCTGAAGTAGG + Intergenic
1046960337 8:120105047-120105069 CAGGGCAAATTCCCAGAAGTCGG + Intronic
1047236458 8:123046280-123046302 AATGGCAAAGACCTTGAGGTGGG + Intronic
1047275164 8:123400287-123400309 AAGTGCAAAGGCCCTGAGGTAGG + Intronic
1047372181 8:124265259-124265281 AACTGCAAAGGCCCTGAGGTAGG - Intergenic
1047668471 8:127118627-127118649 CAGGGCAAAGCCTCTGAAGCAGG - Intergenic
1047724514 8:127672240-127672262 CAGTGCATAGGCCCTGAGGTGGG - Intergenic
1048142670 8:131809940-131809962 TGGGGCTAAGAACCTGAGGTGGG - Intergenic
1048221201 8:132543711-132543733 GAGAGCAAAGGCCCTGTGGTGGG - Intergenic
1048808607 8:138264128-138264150 AAGGACAAAGAGCCTGAGGTGGG - Intronic
1049034996 8:140068422-140068444 CAGGGCAAAGACGCTTGGGCAGG + Intronic
1049122858 8:140755465-140755487 CAGTGCAAAGGCCATGAGGCGGG - Intronic
1049138108 8:140924149-140924171 CAGTGCAGAGTCCCTGACGTGGG - Intronic
1049203551 8:141353050-141353072 CAGGGCAAGGACGTGGAGGTGGG - Intergenic
1049406501 8:142453906-142453928 CAGTGCAAAGGCCCTGGGGCAGG + Intronic
1049536901 8:143186609-143186631 CAGGGTAGAGACGCTGAGGTAGG - Intergenic
1049829934 8:144694021-144694043 CAGTACAAAGGCCCTGAGGCAGG + Intergenic
1049938647 9:523652-523674 CAGTGCAAAGGCCCTAAGGGAGG - Intronic
1050085792 9:1964441-1964463 CTGAGCAAAGACCCCGGGGTGGG + Intergenic
1050163021 9:2737540-2737562 CAGGGCGACGATTCTGAGGTTGG - Intronic
1050272350 9:3959638-3959660 CATGTGAAAGGCCCTGAGGTGGG - Intronic
1050643575 9:7694485-7694507 AAGGGCAACAATCCTGAGGTGGG + Intergenic
1050961484 9:11738859-11738881 CAAGTCAAAGAACCTGAGGGTGG + Intergenic
1051145543 9:14023483-14023505 AAGTGCAAAGGCCCTGTGGTAGG - Intergenic
1051345781 9:16149736-16149758 AAATGCAAAGACCCTGAGGCAGG - Intergenic
1051500304 9:17769518-17769540 CTGTGCAAAGACCCCGAGGCAGG - Intronic
1052023096 9:23546825-23546847 AAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1052172645 9:25420411-25420433 CAGTACAAAGACCCTGGAGTTGG + Intergenic
1053355426 9:37441599-37441621 CAGTGTGAAAACCCTGAGGTTGG - Exonic
1053416880 9:37952361-37952383 AAGTGCAAAGGTCCTGAGGTAGG + Intronic
1055270050 9:74547646-74547668 CTGTGCAAAGGCCCTGAGGTAGG + Intronic
1055488589 9:76781426-76781448 CAGTGCAAAGGCTCTGAAGTGGG - Intronic
1055493320 9:76828252-76828274 CTGTGCAAAGGCACTGAGGTGGG + Intronic
1055874379 9:80924561-80924583 CTGGGCAAAGGCCCTGAGGCAGG + Intergenic
1056728197 9:89141161-89141183 CAGGGAATTGACCCTGAAGTTGG + Intronic
1057237189 9:93371081-93371103 AAGTGCAAAGATCCTGGGGTTGG - Intergenic
1057297666 9:93859030-93859052 AAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1057390893 9:94640616-94640638 CAGTGCACAGGCCCTGGGGTAGG + Intergenic
1057686538 9:97239643-97239665 CAGTGCAGAGATCCTGAAGTAGG + Intergenic
1057831258 9:98409059-98409081 CAGGGCCAAGTCCCTCAGGTGGG + Intronic
1057853054 9:98580171-98580193 AAGTGCAAAGGCCCAGAGGTGGG - Intronic
1057989870 9:99757527-99757549 GAGGGCAAATCACCTGAGGTCGG + Intergenic
1058020974 9:100088359-100088381 CAGTGCAAAGCCCCTAATGTGGG - Intronic
1058115045 9:101075930-101075952 CAGTGCAAAGACCCTGAAACTGG + Intronic
1058891506 9:109365181-109365203 GTGAGCAAATACCCTGAGGTGGG + Intergenic
1058903337 9:109460591-109460613 CAGTGCAAAGGCCCTGAGGCTGG - Intronic
1059012588 9:110478106-110478128 AAGTGCAAAGTCCCTGAGGCAGG - Intronic
1059286100 9:113172928-113172950 CTGGGCAAAGGCACTGAGATAGG - Intronic
1059308918 9:113375267-113375289 AAGTGCAAAGGCCCTGAGGCAGG + Intronic
1059405346 9:114095676-114095698 CAGGTCCAATACCCTGGGGTGGG + Intronic
1059521401 9:114945733-114945755 AAGTACAAAGACCCTGTGGTTGG + Intergenic
1060006693 9:120006532-120006554 AAGTGCAAAGACCCTGGGGCAGG - Intergenic
1060053099 9:120391007-120391029 CAGGGCAAAGTTCCTGACATGGG + Intronic
1060219325 9:121756012-121756034 CAGGGCTCAAACCCTGGGGTTGG - Intronic
1060290566 9:122299003-122299025 AAGTGCAAAGGCCCTGAGGTGGG + Intronic
1060602171 9:124885664-124885686 AAGTGCCAAGGCCCTGAGGTTGG + Intronic
1060727602 9:126016592-126016614 CAGGGCCATGACCCTGGGGTTGG - Intergenic
1060758557 9:126229792-126229814 CTGTGCAAAGGCCCTGAGGCAGG + Intergenic
1060765434 9:126292174-126292196 CTGTGCAAAGGCCCTGAGGCTGG - Intergenic
1060798233 9:126526874-126526896 CAGGGCATAGAGAGTGAGGTAGG + Intergenic
1060975864 9:127764610-127764632 AAGTGCAAAGACCCTGAGGTGGG - Intronic
1061242873 9:129384351-129384373 TCGTGCAAAGGCCCTGAGGTAGG - Intergenic
1061750425 9:132773191-132773213 CAGTGCAAAGGCCCTGAGTTAGG - Intronic
1061959790 9:133982174-133982196 CAGGGGAAAGGCCCTGAACTGGG + Intronic
1062272018 9:135714138-135714160 CTCGGCAAAGACCCTGGGGACGG + Intronic
1062548510 9:137074884-137074906 AAGTGCAGAGACCCTGAGGCAGG + Intergenic
1185783238 X:2867229-2867251 CTGGGCAGAGTCCCTGAGATGGG - Intronic
1186515581 X:10164250-10164272 CAGTGCAAAGGCCCTGAGGCAGG + Intronic
1186515753 X:10165172-10165194 CAGTGCAAAGGCCCTGGGGCAGG - Intronic
1186672223 X:11779659-11779681 CAGGGCCAAGACCCTGAGGCAGG + Intergenic
1186701303 X:12093030-12093052 AAGGGCATAGACCTTGAGGTTGG + Intergenic
1186705544 X:12136586-12136608 CATTGCAAAGAGCCTAAGGTGGG + Intergenic
1186730377 X:12403322-12403344 AAGCTCAAAGACCCTGAGGTAGG - Intronic
1186892385 X:13971772-13971794 CAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1187056160 X:15743149-15743171 CTGGGCAAAGATCCTGAAGTGGG - Intronic
1187237049 X:17477323-17477345 AAGTGCAAAGGCCCTGAGGCTGG + Intronic
1187277141 X:17826152-17826174 CAGTACAAAGGCCCTGAGGCAGG - Intronic
1187410811 X:19049092-19049114 AAAGGCAAAGGCCCTGAGGTGGG - Intronic
1187452556 X:19411737-19411759 AAGTGCAAAGGCCCTGAGGAGGG + Intronic
1188107935 X:26165283-26165305 CAGGGCAAGGACAATGAGGAAGG + Intergenic
1188111329 X:26198540-26198562 CAGGGCGAGGACCATGAGGAAGG + Intergenic
1188547295 X:31322230-31322252 GAGGACAAAGACACTGATGTAGG + Intronic
1189095146 X:38130548-38130570 CCTGGCAAAGGCCATGAGGTGGG - Intronic
1189200405 X:39190684-39190706 CAGTGCAAAGGCCATGAAGTAGG - Intergenic
1189227278 X:39423310-39423332 CAGTGCAAAGGCCTTGAGGCAGG - Intergenic
1189278601 X:39805140-39805162 AAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1189301846 X:39957979-39958001 CAGTGCAAGGGCCCTGAGGCAGG + Intergenic
1189305782 X:39985683-39985705 CAGTGCAAAGGCCCTGAGGGAGG + Intergenic
1189327377 X:40121003-40121025 CAGTGCAAAGGCCCTGTGGTAGG + Intronic
1189709415 X:43794222-43794244 CAGTGCCAAGGCACTGAGGTGGG - Intronic
1189926178 X:45957984-45958006 TAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1190060069 X:47205157-47205179 CTGCGCAAAGATCCTGAGGTGGG + Intronic
1190062928 X:47222584-47222606 CAGTGTAAAGGCCCCGAGGTGGG + Intronic
1190119162 X:47646401-47646423 CTGGGCACAGAGGCTGAGGTGGG - Intronic
1190119226 X:47646915-47646937 CAGTTCAGAGGCCCTGAGGTGGG - Intronic
1190119436 X:47648604-47648626 CAATGCAAAGGCCCTGAGGCTGG + Intronic
1190220761 X:48511107-48511129 CAGGGCAAAGGCCTTCAGGCTGG - Intronic
1190221794 X:48516677-48516699 CAGTGGAAAGGCCCTGAGGTAGG + Intronic
1190336805 X:49267519-49267541 CAGGGCAAAGGTCCTGAGGTGGG + Intergenic
1190525678 X:51327375-51327397 TAGAGCAAAGGCCCTGAGGAGGG + Intergenic
1190543808 X:51504297-51504319 TAGAGCAAAGGCCCTGAGGAGGG - Intergenic
1190711544 X:53075180-53075202 CAGAGCAAAGGCCCTGAGGTGGG - Intronic
1190816422 X:53933968-53933990 CAGGGGGCAGACCATGAGGTCGG - Intergenic
1191718604 X:64210313-64210335 CAGTGCAAAGGCCCTGAGGTGGG - Intergenic
1191934640 X:66413368-66413390 AAGTACAAAGACCCTGAGGCAGG - Intergenic
1192157022 X:68754250-68754272 CAGTGCAAAGACCCTGAGGCAGG - Intergenic
1192239930 X:69320871-69320893 CAGGGGAAAGACCTGGAGGCTGG - Intergenic
1192608138 X:72541296-72541318 AAGGGCAAAGCCCTAGAGGTGGG + Intronic
1193078430 X:77380807-77380829 CAGGGTAAAGAGTCAGAGGTGGG + Intergenic
1195304154 X:103562652-103562674 ATGTGCAAAGGCCCTGAGGTGGG - Intergenic
1195402102 X:104472040-104472062 CTGGTCAAAGGCCCAGAGGTGGG + Intergenic
1195767472 X:108311580-108311602 GAGGGCAGAGGCCCTGAGGCAGG - Intronic
1195971809 X:110481390-110481412 AAGTGCAAAGTTCCTGAGGTAGG + Intergenic
1196003773 X:110813800-110813822 AAGTGCAAAGGCCCTAAGGTAGG + Intergenic
1196824625 X:119731467-119731489 AGGTGCAAAGGCCCTGAGGTGGG + Intergenic
1196848802 X:119918073-119918095 AAGTGCAAAGGCCCTGAGGCAGG - Intronic
1196865185 X:120065011-120065033 CAGTGCAAAGGCCCCAAGGTGGG + Intergenic
1196877908 X:120171269-120171291 CAGTGCAAAGGCCCCAAGGTGGG - Intergenic
1197029011 X:121790886-121790908 AAGTGCAAAGTACCTGAGGTAGG - Intergenic
1197495428 X:127173651-127173673 AAGGGCAGATAACCTGAGGTTGG - Intergenic
1197704459 X:129623725-129623747 AAATGCAAAGGCCCTGAGGTAGG + Intergenic
1197809515 X:130428969-130428991 AAGTGCAAAGACCCTGAGGTGGG + Intergenic
1198068363 X:133122626-133122648 AAATGCAAAGACCCTGAGGCAGG - Intergenic
1198453846 X:136795697-136795719 AAGTGCAAAGGCCCTGAGGTTGG - Intergenic
1198618211 X:138480962-138480984 AAAGGCAAGGACCCTTAGGTAGG + Intergenic
1198802322 X:140460405-140460427 CAGGGCAAAGGCCTTGAAATAGG + Intergenic
1199271067 X:145883196-145883218 CAGTGTAAAGACTCTGAGGTGGG - Intergenic
1199607100 X:149586110-149586132 CAGGGCCAGGACCCTGAGGGAGG - Intronic
1199607399 X:149587101-149587123 CAAGGCCAGGACCCTGAGGGAGG - Intronic
1199631724 X:149782266-149782288 CAAGGCCAGGACCCTGAGGGAGG + Intronic
1199632022 X:149783258-149783280 CAGGGCCAGGACCCTGAGGGAGG + Intronic
1200613210 Y:5348569-5348591 AAGGGCAAAGACACAGAGGCAGG - Intronic
1201228698 Y:11843045-11843067 AAGTGCAAAGGCTCTGAGGTGGG - Intergenic
1201504887 Y:14687310-14687332 CAGTGCCAAGGCCCTGGGGTGGG + Intronic
1201943905 Y:19489700-19489722 GCGGGCAAATAACCTGAGGTCGG + Intergenic