ID: 1178750371

View in Genome Browser
Species Human (GRCh38)
Location 21:35297049-35297071
Sequence TACCCAAGACTGGTTAATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 105}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178750371_1178750373 -9 Left 1178750371 21:35297049-35297071 CCTTCATTAACCAGTCTTGGGTA 0: 1
1: 0
2: 1
3: 12
4: 105
Right 1178750373 21:35297063-35297085 TCTTGGGTATATCCTTATAGCGG 0: 1
1: 0
2: 11
3: 44
4: 211
1178750371_1178750378 23 Left 1178750371 21:35297049-35297071 CCTTCATTAACCAGTCTTGGGTA 0: 1
1: 0
2: 1
3: 12
4: 105
Right 1178750378 21:35297095-35297117 GAACTAATACAGGAAGGATAGGG 0: 1
1: 0
2: 2
3: 22
4: 215
1178750371_1178750379 28 Left 1178750371 21:35297049-35297071 CCTTCATTAACCAGTCTTGGGTA 0: 1
1: 0
2: 1
3: 12
4: 105
Right 1178750379 21:35297100-35297122 AATACAGGAAGGATAGGGATAGG 0: 1
1: 0
2: 2
3: 24
4: 348
1178750371_1178750376 17 Left 1178750371 21:35297049-35297071 CCTTCATTAACCAGTCTTGGGTA 0: 1
1: 0
2: 1
3: 12
4: 105
Right 1178750376 21:35297089-35297111 GAGAACGAACTAATACAGGAAGG 0: 2
1: 6
2: 40
3: 184
4: 585
1178750371_1178750377 22 Left 1178750371 21:35297049-35297071 CCTTCATTAACCAGTCTTGGGTA 0: 1
1: 0
2: 1
3: 12
4: 105
Right 1178750377 21:35297094-35297116 CGAACTAATACAGGAAGGATAGG 0: 1
1: 0
2: 0
3: 7
4: 83
1178750371_1178750380 29 Left 1178750371 21:35297049-35297071 CCTTCATTAACCAGTCTTGGGTA 0: 1
1: 0
2: 1
3: 12
4: 105
Right 1178750380 21:35297101-35297123 ATACAGGAAGGATAGGGATAGGG 0: 1
1: 0
2: 0
3: 17
4: 266
1178750371_1178750375 13 Left 1178750371 21:35297049-35297071 CCTTCATTAACCAGTCTTGGGTA 0: 1
1: 0
2: 1
3: 12
4: 105
Right 1178750375 21:35297085-35297107 GCATGAGAACGAACTAATACAGG 0: 3
1: 39
2: 221
3: 469
4: 798

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178750371 Original CRISPR TACCCAAGACTGGTTAATGA AGG (reversed) Intronic
903425718 1:23252805-23252827 TTCCTAAGACTGGTCCATGAAGG + Intergenic
904296388 1:29522147-29522169 AACCCACGCCTGGTGAATGAGGG - Intergenic
904409934 1:30319287-30319309 AACCCACGCCTGGTGAATGAGGG + Intergenic
904418690 1:30377872-30377894 TACCCAAGACAGGGTATTGCTGG + Intergenic
907538794 1:55192929-55192951 TAACCAAGAAGGGTTAATGCAGG - Intronic
911267773 1:95763219-95763241 TACCCAAGACTGGGAAAAAAAGG + Intergenic
918824653 1:189308341-189308363 TACCCAAAACATGTTAATCACGG - Intergenic
921934350 1:220782980-220783002 AACCTAAGACTGGATCATGATGG - Intronic
921971689 1:221155928-221155950 TATCCAGGACTGGTTTATTATGG + Intergenic
924454928 1:244211550-244211572 TTCCCAAGACTGGCTAAGGAAGG - Intergenic
1063331270 10:5161809-5161831 TGCCCAAGACTGTTTCATCATGG - Intergenic
1063721379 10:8585446-8585468 TACCAAAGACTGTATAAGGAGGG + Intergenic
1067274192 10:44819810-44819832 GACCCAAGCCTGGTCAGTGATGG - Intergenic
1071693367 10:87846208-87846230 CACGCAAGACTAGATAATGAGGG + Intergenic
1072859083 10:98983953-98983975 TACTCAAGCCTGGGCAATGAGGG - Intronic
1073067871 10:100774530-100774552 TGCCCCAGACTGGTCAATGCAGG - Intronic
1075897806 10:126013086-126013108 TATCCAATAATGGATAATGATGG - Exonic
1080564928 11:33499327-33499349 TACACAAGTCTAGTTAGTGAAGG - Intergenic
1081040628 11:38206115-38206137 CACCCAATAATGGATAATGAAGG + Intergenic
1081305594 11:41508224-41508246 TACCCAAGACAGGGTAATTAAGG - Intergenic
1081418090 11:42839869-42839891 TCCCCAAGGAGGGTTAATGATGG + Intergenic
1081769202 11:45636948-45636970 TATCCAAGACTGTGTAATAAAGG - Intergenic
1092436727 12:8453449-8453471 TCCCCAAGACTGCTTCAGGATGG - Intergenic
1093539012 12:20258312-20258334 TATCCAAGACTGCTTAAGAAAGG - Intergenic
1094783404 12:33818679-33818701 TACCCAAGACCGGGTAATGTTGG + Intergenic
1098715553 12:73825182-73825204 TACCCCAGACTGGAGAAAGAGGG - Intergenic
1102584235 12:113912067-113912089 AACCCAAGGCTGGTTAGTTAAGG + Intronic
1104279891 12:127366877-127366899 TGCCCAAGGCGAGTTAATGATGG - Intergenic
1104618610 12:130292370-130292392 TACTTAAGACTGGGTAATGAGGG + Intergenic
1105298800 13:19115139-19115161 TACCCCAGACTGGAGTATGATGG - Intergenic
1109700097 13:66013136-66013158 TTCCCAACACTGTTTAATAAAGG - Intergenic
1111194491 13:84855783-84855805 TGCTCAATACTGTTTAATGAAGG + Intergenic
1116436966 14:44906820-44906842 TACCCAAGAATGGATAAATATGG + Exonic
1120463332 14:84825166-84825188 TGCACATGACTGCTTAATGATGG + Intergenic
1127095555 15:55508940-55508962 TACCCAAGACTGGGTTATAAAGG + Intergenic
1130870391 15:87966838-87966860 TACCCAAGACTAGTGAATACTGG + Intronic
1131729843 15:95268031-95268053 GACCCAAGACTGGGGAATGATGG - Intergenic
1140628334 16:76821755-76821777 TACCCAAGACTGGGTAATTTAGG + Intergenic
1146212112 17:30950786-30950808 CACCCAGAACTGGTTAATGCTGG + Intronic
1146717007 17:35094867-35094889 TACCAAAGACGAGTTAATCAAGG - Intronic
1151875553 17:76866232-76866254 TACCCAAGACTGCATGATGTGGG + Intergenic
1152026619 17:77813720-77813742 TACCCAAGACTAATTTATAAAGG - Intergenic
1159307982 18:66670316-66670338 TACCTGAGACTCCTTAATGATGG - Intergenic
1159437411 18:68436902-68436924 GACACAATACTGGTTAAAGAAGG - Intergenic
1159508635 18:69367245-69367267 TCTCCAAGGCTAGTTAATGATGG - Intergenic
1167825124 19:51965790-51965812 TAGCCAAGACTTCTTGATGAAGG + Exonic
926072557 2:9910244-9910266 TACTCAAGACTGAATAATGTGGG - Intronic
928852532 2:35766896-35766918 TACTCAAGCCTGGTCAATGGCGG - Intergenic
929883651 2:45859333-45859355 TACCCAGGCATGGTAAATGATGG + Intronic
932162138 2:69470464-69470486 AACCCACGACTGGGAAATGAGGG + Exonic
935518101 2:104068765-104068787 TACCCAAGACTGAGTAATGGAGG + Intergenic
941490771 2:166139639-166139661 TACCTGAGACTGGGTAATCATGG + Intergenic
943106919 2:183556525-183556547 TACCAAAGCCTGGGTAGTGATGG + Intergenic
947264403 2:228261010-228261032 TACCCAGGCCTGGTTAAGCATGG + Intergenic
1168751324 20:283962-283984 TGCCAAAATCTGGTTAATGAAGG - Exonic
1168874916 20:1164765-1164787 TACCCAAGACTGCTGAAGAAAGG - Intronic
1170110260 20:12797290-12797312 TTCCCAAGGCTGGTGAAAGAAGG - Intergenic
1170120577 20:12907263-12907285 TTCCCACTACTGGTTAATGGGGG - Intergenic
1176935492 21:14861727-14861749 TACCCAAGACTGGTAAGAAAAGG + Intergenic
1177114358 21:17067390-17067412 AACCAATGACTGGTTAATCATGG - Intergenic
1178214477 21:30578601-30578623 TAACCCAGACTGGATCATGAAGG + Intergenic
1178750371 21:35297049-35297071 TACCCAAGACTGGTTAATGAAGG - Intronic
1179967652 21:44816784-44816806 CACCCAAGGCTGGATAAGGAGGG + Intronic
1180218193 21:46340021-46340043 TACCCAAGACTGGGTAATTAAGG + Intronic
1181878720 22:25960339-25960361 GTCCCAAGACTGGGTAATCAAGG + Intronic
950315273 3:11996500-11996522 TTCCCAGGACGGGTTCATGATGG + Intergenic
951431743 3:22615952-22615974 GACCCAGAACTGGTTAATGAGGG - Intergenic
951599961 3:24362754-24362776 TACCCAATACTTGTTAAAGCAGG - Intronic
951645240 3:24882840-24882862 AACCCATGATTGGTTGATGAAGG + Intergenic
955943220 3:64166288-64166310 TGCCCAAGACAGGGTAATCAGGG - Intronic
960597748 3:119422040-119422062 TACCCAAGACTGGGGAATCTGGG - Intergenic
965886398 3:173451740-173451762 TACTCAAGCCTGGGTAATGGCGG + Intronic
965935829 3:174110124-174110146 TTCCCAAGACTTGTTAAAGTTGG + Intronic
969302492 4:6305232-6305254 TACCCAAGAATGGACAGTGAAGG - Intergenic
969525634 4:7702574-7702596 TACCCAGGAGTGGATACTGAGGG - Intronic
970329669 4:14966671-14966693 TACCCAAGACTGGGCAATTTGGG + Intergenic
972836464 4:42876558-42876580 TACTCAAGAGTGATAAATGAGGG - Intergenic
976355489 4:84112600-84112622 TACACAAGAGTGGGTAAAGATGG - Intergenic
982641078 4:157962006-157962028 TTCCCAATACTATTTAATGATGG - Intergenic
985513418 5:324815-324837 AACCCAAAACTGGTTATTCAGGG + Intronic
989263634 5:39447407-39447429 TACCCAACAATGGTTAATTTGGG - Intronic
989358748 5:40575063-40575085 TTACCATGGCTGGTTAATGACGG + Intergenic
992948188 5:81830249-81830271 AACCAATGACTGGTTGATGAGGG - Intergenic
993393194 5:87347166-87347188 TACTGAAGACTAGTTAATTATGG - Intronic
996558711 5:124805392-124805414 AACCCAAGACTGGCTAATTCCGG + Intergenic
996607480 5:125341221-125341243 TACCCTATATTGGTCAATGATGG + Intergenic
997752363 5:136358542-136358564 TGTCCAAGACTGGCAAATGATGG - Intronic
1000647934 5:163781071-163781093 TACTCAAGCCTCGTCAATGATGG - Intergenic
1002403793 5:179012477-179012499 TACCCAGGACTGGTTACTCCGGG + Intergenic
1004089775 6:12489167-12489189 TACCCCAGAGAGATTAATGATGG + Intergenic
1009152269 6:59764001-59764023 TACCAAAGAAAGGTTAAAGACGG - Intergenic
1009751611 6:67884155-67884177 TACCAACGGCTGGTTAATGAAGG + Intergenic
1011174106 6:84541146-84541168 TACTCAAGCCTCGGTAATGATGG - Intergenic
1012638896 6:101583280-101583302 TACCTAAGCCACGTTAATGAAGG + Intronic
1013145116 6:107382313-107382335 AACCCAAGAATTGTTAGTGAGGG + Intronic
1013347350 6:109274517-109274539 TAGCAGAGACTGGTTCATGAGGG - Intergenic
1017550955 6:155507054-155507076 CACTCCAGCCTGGTTAATGAAGG - Intergenic
1019361568 7:607516-607538 TACACAAGACTGTGAAATGAGGG - Intronic
1019708739 7:2508788-2508810 TCCCCAAGACTGGCTCCTGATGG - Intergenic
1020608592 7:10367552-10367574 TACTCAAGCCTCGGTAATGATGG + Intergenic
1021007760 7:15421290-15421312 TACCGAAGACTCGCTGATGAAGG - Intronic
1027305685 7:76893938-76893960 TACCCAAGCCTATTTAATAATGG - Intergenic
1028379460 7:90182654-90182676 GACCCAAGTCTGGTTAACTAAGG - Intronic
1031613765 7:123857001-123857023 TACTCAAGCCTGGGTAATGGTGG + Intronic
1034209414 7:149349844-149349866 TATCCAAGACTGGGTAATAAAGG + Intergenic
1037475980 8:19258161-19258183 TACCCAAGACTGGGTAATTTAGG + Intergenic
1037660367 8:20921027-20921049 TACCCAAGACTGAGTAGTAAAGG + Intergenic
1038470890 8:27818759-27818781 TACCCATGGCTTTTTAATGATGG + Intronic
1042721743 8:71833845-71833867 TCCCCATCACTGGTTAGTGATGG + Intronic
1043691072 8:83152650-83152672 TACCCCAGAGAGGTTAATGTTGG - Intergenic
1049964614 9:767070-767092 TACCCAAGCCTCAGTAATGATGG - Intergenic
1051720908 9:20036492-20036514 TACCGAAGACTGGGTAGTGGGGG - Intergenic
1052241086 9:26274561-26274583 TACCCAAGGTTGGATAAGGATGG - Intergenic
1057622976 9:96653423-96653445 TACCAGAGACTGGTTACTCAGGG + Intronic
1058103983 9:100949424-100949446 TACCCAACTCAGGATAATGAAGG + Intergenic
1058510878 9:105714524-105714546 TACTGAAAACTGGTAAATGAAGG - Intronic
1188368448 X:29338958-29338980 GACCCAAGACTGGCCAATCAGGG - Intronic
1192292117 X:69809204-69809226 TACCCAAAACTGGTAATTTATGG + Intronic
1196619133 X:117802251-117802273 TACCCATCACTAGTTATTGAGGG - Intergenic