ID: 1178751020

View in Genome Browser
Species Human (GRCh38)
Location 21:35303152-35303174
Sequence AACCTTGGACTTTGAGATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 210}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178751018_1178751020 30 Left 1178751018 21:35303099-35303121 CCTAGAAGGGATCTGGGCACATG 0: 1
1: 0
2: 3
3: 21
4: 197
Right 1178751020 21:35303152-35303174 AACCTTGGACTTTGAGATCTTGG 0: 1
1: 0
2: 0
3: 9
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178751020 Original CRISPR AACCTTGGACTTTGAGATCT TGG Intronic
905865741 1:41375662-41375684 GGCCATGGACTTTGAGTTCTAGG - Intronic
906479054 1:46188516-46188538 AACCTTGGAGTTTGAGACTCAGG + Intergenic
909977677 1:82064332-82064354 AACCTGATACTTTGATATCTGGG - Intergenic
910801623 1:91152944-91152966 AGCCTTTGACTTGGAGATGTTGG + Intergenic
911743739 1:101416573-101416595 AACAATGGACTTTGAGGACTTGG + Intergenic
914449545 1:147778521-147778543 GACCTTGGCCTGGGAGATCTTGG + Intergenic
914973431 1:152333092-152333114 CACCATGGATTTTGTGATCTTGG - Intergenic
919233720 1:194809438-194809460 AACCATGCACTTTTAAATCTTGG - Intergenic
919985286 1:202669867-202669889 AGCCCTGGCCTTTCAGATCTGGG + Intronic
922247088 1:223810483-223810505 AAACTTGGATCCTGAGATCTTGG + Exonic
924158998 1:241210669-241210691 ATCCTTGTACTTTGTAATCTGGG - Intronic
1065220139 10:23488256-23488278 AAGCTAGGAGTTTGAGACCTGGG - Intergenic
1066407799 10:35135675-35135697 AAGCTAGGAATTTGAGACCTGGG + Intronic
1067227086 10:44383408-44383430 AACCTCGGTCTTTGAGTTATGGG - Intronic
1070304827 10:75234072-75234094 CACCTTGGCCTTCAAGATCTAGG - Exonic
1070355785 10:75639032-75639054 TACGTTTGCCTTTGAGATCTAGG + Intronic
1071738327 10:88327129-88327151 AACTTTGGACTTGGACATTTGGG + Intronic
1072568060 10:96634457-96634479 AAGCATGGACTTTGATATCTTGG + Intronic
1074231891 10:111545833-111545855 TACCTTGTACTTAGAGACCTGGG - Intergenic
1078110379 11:8387418-8387440 GACCTTGGACATTAAGACCTTGG + Intergenic
1079511590 11:21216815-21216837 TACCTTGGACTTTGGGTTTTGGG + Intronic
1082097541 11:48143734-48143756 AAACTTGGGCTTTTAAATCTAGG - Intronic
1083030978 11:59591921-59591943 AACCTTGGACTGAGAGTACTGGG - Intronic
1083071692 11:59990828-59990850 TACATTGGACTTTGAGGACTCGG - Intergenic
1083415657 11:62523853-62523875 GACCTTCCACATTGAGATCTGGG + Exonic
1090977073 11:131687669-131687691 AACCTTGGACATTCATATTTCGG - Intronic
1092760696 12:11808629-11808651 ATCCTTGGATTTTGGTATCTGGG + Intronic
1093489908 12:19693657-19693679 TACATTGGACTTTGAGGACTTGG + Intronic
1093747128 12:22754851-22754873 GACTTTGGAATTAGAGATCTGGG - Intergenic
1096490632 12:52010914-52010936 GACCTTCGGCTTTGAGATCCAGG + Exonic
1097016341 12:55989984-55990006 AACAGTGAAGTTTGAGATCTGGG + Exonic
1098321781 12:69252333-69252355 ATCCTAGCACTTTGAGAGCTTGG - Intronic
1099076887 12:78120834-78120856 AACCCAGAACTTTGATATCTTGG + Intronic
1099438413 12:82670445-82670467 AACATTTGACTCTGAGATTTTGG + Intergenic
1101349194 12:103912510-103912532 AACTGTGGACTATGAGATTTTGG + Intergenic
1102530873 12:113545833-113545855 AACCTTGGACTTTGACAGTCTGG - Intergenic
1105720615 13:23110204-23110226 TACATTGGACTTTGAGGACTAGG - Intergenic
1105734431 13:23253424-23253446 AACCTTGGATTTGGTGAGCTTGG - Intronic
1106060981 13:26291609-26291631 AAGCAAGGACTTTCAGATCTTGG + Intronic
1106407672 13:29487986-29488008 TACCTTGGACTTTGTGGTCGTGG - Exonic
1106619225 13:31357434-31357456 AAACTTGTACATTGATATCTTGG + Intergenic
1107017226 13:35717199-35717221 AAGGTTGGACCTTGAGATATTGG + Intergenic
1108225664 13:48286429-48286451 CACCTTAGTCTCTGAGATCTTGG - Intergenic
1108492412 13:50994441-50994463 AACCCTAAACTTTGAGATTTTGG - Intergenic
1109717481 13:66235023-66235045 AAACTTGGACTTTGACTTTTGGG + Intergenic
1111383544 13:87493473-87493495 AACCTTGGACTTTAAGTCTTAGG + Intergenic
1111392041 13:87609040-87609062 AACCTTATATTTTCAGATCTTGG + Intergenic
1111737773 13:92164252-92164274 AACCTTGGACTTGAACATTTGGG - Intronic
1111949770 13:94701538-94701560 AGCCTTGGGCCTTGGGATCTGGG + Intergenic
1113913364 13:113855274-113855296 AACCTTGGAGTTTGGGGCCTAGG + Intronic
1114380352 14:22197370-22197392 TACATTGGACTTTGAGGACTCGG - Intergenic
1114925481 14:27392153-27392175 AGCCTTGGACTTTTTCATCTAGG + Intergenic
1115392756 14:32871757-32871779 AACATTGGACTTTGGGCACTCGG - Intergenic
1116538703 14:46069167-46069189 TACCTTGGGGTTTGAGAACTGGG + Intergenic
1116730810 14:48620352-48620374 AGGCTTGGAGTTTGAGATCAAGG + Intergenic
1117303753 14:54453100-54453122 AGCCCAGGAGTTTGAGATCTGGG - Intergenic
1117588442 14:57239261-57239283 TACTTTGGACTTTGAGAACCAGG - Intronic
1118325632 14:64778630-64778652 AACTTTGGACTCTGAGCCCTTGG - Intronic
1118747354 14:68784049-68784071 AGCCCTGTACTTTGAGACCTGGG + Intergenic
1119942525 14:78656569-78656591 ACCCTTGGACTTTGTTCTCTAGG + Intronic
1119947782 14:78713173-78713195 AACCTGGGACCTTGAGAGCAGGG - Intronic
1121714607 14:96064650-96064672 TACAATGGACTTTGAGAACTTGG + Intronic
1124647979 15:31453385-31453407 AGCCTTGGACTGTGAGATGGTGG - Intergenic
1126599506 15:50414757-50414779 AACCTTTGATGTTGATATCTAGG + Intergenic
1129821388 15:78604393-78604415 AACCTTGGCCATTCAGAACTTGG + Intronic
1130740603 15:86595778-86595800 AACCTTAGCCTCTGAGTTCTTGG - Intronic
1132366931 15:101264611-101264633 AGCCTTGTACTTTTCGATCTGGG - Intergenic
1133601291 16:7342710-7342732 CACCATGGAGTTTGACATCTTGG + Intronic
1135550643 16:23395651-23395673 AAACCTGCACTGTGAGATCTAGG - Intronic
1136518245 16:30780710-30780732 ACCCTTGCACTCTGAGAGCTGGG + Exonic
1137596421 16:49727199-49727221 AAGCGTGGACTTTAAGGTCTCGG - Intronic
1138161132 16:54755998-54756020 CTCCCTGGACTGTGAGATCTTGG - Intergenic
1140768622 16:78182997-78183019 AAACTTGGACCATGAGTTCTTGG - Intronic
1140891603 16:79289771-79289793 AACTTTGGACTCTGAGCACTTGG - Intergenic
1144073559 17:11696418-11696440 AACCTTGGACTTTGTATTGTTGG + Intronic
1144141460 17:12352628-12352650 AACTGTTGACTTTGAGATATAGG + Intergenic
1144399591 17:14883514-14883536 GACCTTGGACTTGGAGTTTTAGG - Intergenic
1146091254 17:29880734-29880756 AACCTTTGCCTTTGAGAATTGGG - Intronic
1155784752 18:29882237-29882259 AACTTTGGAGTTTGTGATATTGG - Intergenic
1155840769 18:30639911-30639933 AATCATGGAATTTGAGAGCTGGG + Intergenic
1155846208 18:30710218-30710240 AAACTTGAACTGAGAGATCTTGG + Intergenic
1156609295 18:38707615-38707637 ACCCTTAGACCTGGAGATCTGGG - Intergenic
1156643394 18:39129576-39129598 TACATTGGACTTTGGGAACTCGG + Intergenic
1157176030 18:45453179-45453201 GACCTTGGAATTTGAGGGCTGGG - Intronic
1158477010 18:57789289-57789311 AACCTTCGGCTGTGAGGTCTCGG + Intronic
1159904596 18:74078194-74078216 AATGCTGGACTTTGAGAACTAGG - Intronic
1161143751 19:2664771-2664793 AACCGTGGACATTCAGAGCTGGG + Intronic
1163285651 19:16345694-16345716 AAACAAGGACTTTGAGATCCTGG - Intergenic
925666706 2:6264530-6264552 AAGCTTTGACTTAGATATCTAGG + Intergenic
926959411 2:18337695-18337717 AACCTAGTCCCTTGAGATCTGGG + Intronic
926979921 2:18558407-18558429 AACCTTTGACTTAGTGATTTTGG - Intronic
927242058 2:20928008-20928030 AACTTTGGACTTTGACTTTTGGG - Intergenic
927382511 2:22495442-22495464 AGGCTGGGAGTTTGAGATCTAGG - Intergenic
932378139 2:71256385-71256407 ATCCTTGCTCTTTGAGATATGGG - Intergenic
932902788 2:75718398-75718420 ATCCCTTGCCTTTGAGATCTAGG + Intergenic
934042389 2:88138559-88138581 AATCTTCCACTCTGAGATCTTGG - Intergenic
936476779 2:112846429-112846451 AACCCAGGACTCTGAAATCTCGG + Intergenic
939206968 2:139119192-139119214 AACCTTGGATTTAGAAATATTGG + Intergenic
939407784 2:141781125-141781147 AGCATTGGAATTTGAGTTCTAGG - Intronic
939929687 2:148217464-148217486 CACCTTGGGCTTTGAGCGCTGGG + Intronic
940358920 2:152776381-152776403 AATCCTGGAATTTTAGATCTTGG - Intergenic
943234713 2:185302302-185302324 AACCTTGGATTTTAAAATTTTGG + Intergenic
943295967 2:186139517-186139539 ACCCTTGGAGTTTTAAATCTTGG + Intergenic
945495184 2:210500364-210500386 AACTTTGGACTTTGACTTTTGGG - Intronic
945607034 2:211947447-211947469 AACTTTGGACTTCAAGAACTTGG - Exonic
946009952 2:216556753-216556775 AACCTGGAACTTTGACTTCTAGG - Intronic
947936338 2:234007764-234007786 ATCCCTAGACTCTGAGATCTAGG + Intronic
948308155 2:236965302-236965324 AACCTTTTACTTTGAGATAATGG - Intergenic
1172128418 20:32639228-32639250 ATCCTTGCTCTTTGAGATATGGG + Intergenic
1172205170 20:33158230-33158252 AATCTTGGCCTTAGAGATCCTGG + Intergenic
1174373117 20:50107253-50107275 AACCTTGGAGTTTCAGATTCAGG - Intronic
1177702655 21:24658308-24658330 AACCCTAGACTCTGAGTTCTTGG + Intergenic
1177819681 21:26017218-26017240 ATTCTTGGCCTTAGAGATCTTGG + Intronic
1178741941 21:35209339-35209361 AACCTTGGAATTGGAGGTCCAGG - Intronic
1178751020 21:35303152-35303174 AACCTTGGACTTTGAGATCTTGG + Intronic
1183145588 22:35988551-35988573 AACCCTTACCTTTGAGATCTCGG - Intronic
1184115407 22:42419035-42419057 GAACTTGGAGTTTGAGAGCTGGG + Intronic
1184640899 22:45869446-45869468 AGCCTTGGACTCGGAGCTCTGGG + Intergenic
951933350 3:27994630-27994652 AATCATGGAATTTGAGAACTAGG - Intergenic
953923508 3:46968156-46968178 AACCTTGGAGTCTGAGAGCTTGG + Intronic
955766985 3:62355185-62355207 GATCTTGCCCTTTGAGATCTTGG - Intergenic
956373792 3:68592353-68592375 AATTATGGACTTTGAGAGCTGGG - Intergenic
958123250 3:89321249-89321271 ATCCATTGGCTTTGAGATCTGGG + Intronic
959521409 3:107326681-107326703 AACATTGTACTGTGAGCTCTCGG + Intergenic
959932725 3:112000824-112000846 CATCTTTGACTCTGAGATCTTGG - Exonic
960677842 3:120214359-120214381 GACCTTGGCCTTAGATATCTTGG - Intronic
960714477 3:120561543-120561565 AATCTTGGACTATGATCTCTGGG - Intergenic
963614383 3:147517322-147517344 ATCTTTGGACTTGGAGAACTGGG + Intergenic
963762348 3:149296444-149296466 AACCTTGGAAGCTGAGTTCTGGG + Intergenic
965296179 3:166949617-166949639 TACATTGGACTTTCAGAACTTGG - Intergenic
965395891 3:168160212-168160234 ATCCTTGGCTTTTCAGATCTGGG - Intergenic
965663773 3:171069752-171069774 ACCTTTGGGCCTTGAGATCTGGG + Intronic
966336856 3:178877771-178877793 TACATTGGACTTTGGGAACTTGG - Intergenic
966346593 3:178987833-178987855 AACCCTAGGCTTTGAGCTCTTGG + Intergenic
968222668 3:196949815-196949837 GTCCTTGGCTTTTGAGATCTTGG - Intronic
969402393 4:6964162-6964184 AACCTTGGTTTTTCAGGTCTCGG - Intronic
971546381 4:27891739-27891761 AACCTTGGACTTGGACGTTTTGG + Intergenic
974525220 4:63042603-63042625 AACCTTGGACTTGGACTTTTGGG - Intergenic
975030740 4:69612103-69612125 AACCTTGGAATTTGATCTGTGGG - Intronic
976767143 4:88609498-88609520 AAGCTGGGAGTTTGAGAACTGGG + Intronic
977491408 4:97716861-97716883 AAAATTGTACTTTAAGATCTGGG - Intronic
978347335 4:107785622-107785644 AACCTTGGACTTTTAGGTTTTGG - Intergenic
979955524 4:126949296-126949318 AACCTTGCATTTTAAGAACTGGG + Intergenic
979984957 4:127302372-127302394 CACAATGGACTTTGAGAACTCGG + Intergenic
980019517 4:127691759-127691781 TACATTGGACTTTGGGAACTTGG - Intronic
981407103 4:144384901-144384923 AACCTTGGACTTTGGCTTTTGGG - Intergenic
982632327 4:157846427-157846449 TACATTGGACTTTGGGGTCTCGG + Intergenic
983825246 4:172250356-172250378 AACCTTGGACTTGGACTTTTGGG + Intronic
984126922 4:175822672-175822694 AACATTGTACTTTAAGTTCTGGG + Intronic
986854240 5:11850356-11850378 TACCTTGGAATTTCATATCTAGG - Intronic
986873923 5:12082691-12082713 AACATTAGACTTTGAGATACAGG + Intergenic
987298247 5:16573587-16573609 TGCCTTGGACTTTGTGAGCTTGG - Intronic
988164069 5:27560804-27560826 AACTATGGACTTTGAGGACTGGG + Intergenic
988985148 5:36611243-36611265 AACCTAGGAATTTGAAAACTAGG - Intronic
989431287 5:41358470-41358492 TACATTGGACTTTGAGGACTTGG - Intronic
989689773 5:44127310-44127332 TACCATGGACTTTGGGAACTTGG + Intergenic
991236559 5:64406122-64406144 CAGCTTGGACCTTGAGTTCTTGG - Intergenic
992583776 5:78210868-78210890 AACTTTAGTCTTAGAGATCTAGG + Intronic
996502479 5:124232018-124232040 AAACTTGGACTTTGAGATTCTGG - Intergenic
997240940 5:132307730-132307752 AACTTTGGACTGTGTGATGTTGG - Intronic
999001121 5:147923696-147923718 AATCTTTGACTGTGATATCTTGG + Intergenic
999646469 5:153722447-153722469 TACCTTTTACTTTTAGATCTAGG + Intronic
999929560 5:156416341-156416363 TACATTGGACTTTGAGAACTTGG + Intronic
1003487263 6:6590485-6590507 AACCTTGGAAAGTGAAATCTTGG + Intronic
1004026283 6:11822567-11822589 AGCCTTGGGCTTTGGGATGTGGG - Intergenic
1008263587 6:49396679-49396701 AACATCGGACTTTGAGGACTAGG + Intergenic
1011073420 6:83411024-83411046 AACCTAGGGCTTAGAAATCTAGG + Intronic
1011497400 6:87950134-87950156 AGGCTTTGACCTTGAGATCTTGG - Intergenic
1011541888 6:88439653-88439675 CACCTTGGATTTTGAAAACTTGG - Intergenic
1014404038 6:121026175-121026197 AATGTTGTACTGTGAGATCTTGG - Intergenic
1014462482 6:121713422-121713444 TACATTGGACTTTGAGGACTCGG - Intergenic
1016059583 6:139615878-139615900 TACATTGGACTTTAAGGTCTCGG - Intergenic
1016909586 6:149184483-149184505 TACAATGGACTTTGGGATCTTGG - Intergenic
1017654329 6:156613393-156613415 AACTTTGGACTTTGACTTTTGGG - Intergenic
1018360913 6:163067083-163067105 GACCTTTGACTTTAAGATCTAGG + Intronic
1019066194 6:169300689-169300711 AACCTTGAACATTGAGTTCTTGG - Intergenic
1026510316 7:71021880-71021902 AGCCTAGGAATTTGAGACCTAGG + Intergenic
1027562714 7:79752205-79752227 TACATTGGACTTTGGGAACTGGG - Intergenic
1033576132 7:142686643-142686665 AACCTTGAATGTTGAGTTCTTGG + Intergenic
1033970054 7:147027991-147028013 TAAGTTGGATTTTGAGATCTAGG - Intronic
1034229659 7:149512148-149512170 AACATTGGACTTTGGGGACTTGG - Intergenic
1034815825 7:154171122-154171144 GACCTTGGATTTGGTGATCTTGG + Intronic
1035492747 7:159294561-159294583 AACCTTGGGCTCTGAGCCCTGGG - Intergenic
1036086793 8:5621344-5621366 AAGCCTAGACTTTGAGATGTTGG + Intergenic
1036456905 8:8917511-8917533 AACTTTGACCTCTGAGATCTAGG + Intergenic
1037170939 8:15890987-15891009 AACATTGGACTTTGGGGACTTGG - Intergenic
1037401384 8:18498400-18498422 GACTTTGGACTTTTAGATTTTGG - Intergenic
1042769922 8:72368437-72368459 AACATTGGACTTTGGGGACTTGG + Intergenic
1043979986 8:86626857-86626879 AACCTTGTATTTTAAGTTCTGGG + Intronic
1046086876 8:109448177-109448199 CAACTTTGGCTTTGAGATCTTGG + Exonic
1046260421 8:111759839-111759861 AAACTTCCACTTTGAAATCTTGG + Intergenic
1047397400 8:124514157-124514179 AACTTTGGAGCTTGAGGTCTAGG + Intronic
1047546543 8:125823059-125823081 CAACTTGGAATTTGAGAACTCGG - Intergenic
1048533154 8:135269129-135269151 AACCTTGGAATGTGATACCTAGG + Intergenic
1049039974 8:140105127-140105149 AACCTAGGACTTTATGAGCTGGG - Intronic
1050160206 9:2711027-2711049 AACCTGAGACTTAGAGATGTGGG - Intergenic
1050774200 9:9239641-9239663 AGCCCTGGATTTTGGGATCTGGG + Intronic
1051826618 9:21228213-21228235 AACCTTGAACTTTGGCCTCTAGG + Exonic
1052889748 9:33687429-33687451 AACCTTGAACATTGAGTTCTTGG + Intergenic
1055010065 9:71555320-71555342 AAACCTGAAATTTGAGATCTGGG + Intergenic
1055091640 9:72369332-72369354 TACCTTGATCTTTGAAATCTGGG - Intergenic
1059525454 9:114987281-114987303 CAACTTGGACTTTGAAGTCTGGG + Intergenic
1059884444 9:118729753-118729775 AACCTTGTACTGTGCGACCTTGG + Intergenic
1061402613 9:130376595-130376617 GACCTTGGAGTGTGAGAGCTGGG + Intronic
1061850553 9:133412455-133412477 AGCCTTGGACTGTGAGATGGTGG - Exonic
1062453239 9:136624215-136624237 AAACTTGGACCTAGAGACCTGGG + Intergenic
1186573535 X:10741150-10741172 AACCTTGGACTATTAAAGCTAGG + Intronic
1187123158 X:16428751-16428773 TACATTGGACTTTGAGGACTCGG - Intergenic
1189133559 X:38525736-38525758 TACATTGGACTTTGAGGACTTGG - Intronic
1192899315 X:75478589-75478611 AAGCTAGGAGTTTGAGACCTAGG - Intronic
1193834772 X:86328614-86328636 GACCTTTGATTTTGAGACCTGGG + Intronic
1194398684 X:93417241-93417263 AGCCTAGGAGTTTGAGAGCTAGG + Intergenic
1195066883 X:101245245-101245267 ACCCTTGGGCTTTGGCATCTTGG + Intronic
1195073243 X:101301714-101301736 AAGCTTTTACTTTCAGATCTAGG - Intergenic
1196231772 X:113232467-113232489 TACATTGGACTTTGAGGACTTGG - Intergenic
1197569599 X:128132376-128132398 AACTTTGGACTTGGACATTTGGG + Intergenic
1197589371 X:128389884-128389906 TACCATGGACTTTGGGGTCTTGG + Intergenic
1197774146 X:130109322-130109344 AACCTTGGACTTCTCGATTTTGG - Intronic
1200760727 Y:7036550-7036572 ACCCTTGCACTTTGAAATCTGGG + Intronic
1201271291 Y:12257906-12257928 AACCTGGGTATTGGAGATCTGGG - Intergenic