ID: 1178751257

View in Genome Browser
Species Human (GRCh38)
Location 21:35305641-35305663
Sequence AGCTTTAGCCACAGGGACGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 131}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178751252_1178751257 -6 Left 1178751252 21:35305624-35305646 CCACCTCTTTTCCACGTAGCTTT 0: 1
1: 0
2: 1
3: 14
4: 175
Right 1178751257 21:35305641-35305663 AGCTTTAGCCACAGGGACGCTGG 0: 1
1: 0
2: 0
3: 11
4: 131
1178751253_1178751257 -9 Left 1178751253 21:35305627-35305649 CCTCTTTTCCACGTAGCTTTAGC 0: 1
1: 0
2: 0
3: 15
4: 87
Right 1178751257 21:35305641-35305663 AGCTTTAGCCACAGGGACGCTGG 0: 1
1: 0
2: 0
3: 11
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178751257 Original CRISPR AGCTTTAGCCACAGGGACGC TGG Intronic
901389126 1:8931786-8931808 ACCTTTAGCCACAGAGGGGCTGG + Intergenic
902348409 1:15835769-15835791 AGATGGAGCCAAAGGGACGCTGG - Intergenic
913647880 1:120878116-120878138 AGCTGTAGCCCCAGGTACTCTGG + Intergenic
914078748 1:144384732-144384754 AGCTGTAGCCCCAGGTACTCTGG - Intergenic
914100431 1:144581770-144581792 AGCTGTAGCCCCAGGTACTCTGG + Intergenic
914173655 1:145253276-145253298 AGCTGTAGCCCCAGGTACTCTGG - Intergenic
914298562 1:146355912-146355934 AGCTGTAGCCCCAGGTACTCTGG - Intergenic
914528317 1:148494462-148494484 AGCTGTAGCCCCAGGTACTCTGG - Intergenic
914638076 1:149572642-149572664 AGCTGTAGCCCCAGGTACTCTGG + Intergenic
921031162 1:211336295-211336317 AGCTTTAGCCCAAGGGTAGCAGG - Intronic
1063515716 10:6693174-6693196 GTCTTTAGCCACAGGGAGTCTGG + Intergenic
1063560435 10:7121312-7121334 AGCTGTTGCCACAGGAACGACGG - Intergenic
1064660929 10:17607296-17607318 AGTTGTAGCCACAGTGAAGCTGG - Intronic
1067450361 10:46378286-46378308 AGCTTCACCCACAGGAACGCAGG - Intronic
1067586884 10:47481477-47481499 AGCTTCACCCACAGGAACGCAGG + Intronic
1067633940 10:47989244-47989266 AGCTTCACCCACAGGAACGCAGG + Intergenic
1067762186 10:49056683-49056705 AGCTCTAGCCAGAGGGACACAGG - Intronic
1067777615 10:49174843-49174865 AGCCTTAGCGTCAGGGTCGCAGG - Intronic
1070961503 10:80503071-80503093 AGCTTTGGCAAGAGGGAGGCAGG + Intronic
1071396094 10:85225544-85225566 AGCCTGAGCCTCAGGGAGGCTGG + Intergenic
1072611660 10:97021151-97021173 AGCGGTCACCACAGGGACGCAGG + Intronic
1072859740 10:98990741-98990763 AGCTCTAGCAACAGGGACATTGG + Intronic
1076493694 10:130882448-130882470 AGCTTTGGCAGCAGGGAAGCAGG - Intergenic
1077369701 11:2175726-2175748 GGCTGTAACCACAGGGACGGCGG - Intergenic
1081461373 11:43275516-43275538 ACCTTCAGCCACAGGTACACTGG + Intergenic
1083281874 11:61631929-61631951 AGCTTGAGCCACACGGATGGCGG - Intergenic
1083430329 11:62611056-62611078 AGCTTCCGCCACAGGGCCACAGG + Intronic
1083477533 11:62923714-62923736 CGATTTAGCCGCAGGGAGGCTGG + Intergenic
1085954337 11:81372752-81372774 TGCTTTAGCCAAAGGGATGTTGG + Intergenic
1087262475 11:96026252-96026274 AACTTTAGCCGCAGGGCTGCAGG - Intronic
1091449229 12:562274-562296 GGCCTTACCCACAGGCACGCCGG - Exonic
1092111896 12:5970132-5970154 AGATTTGGCCACAGGGAGTCAGG - Intronic
1102136214 12:110578318-110578340 AGAATTAGCCACAGGGAAGAAGG + Intronic
1102530453 12:113542619-113542641 AACTTCAGCCACAGGCACACAGG - Intergenic
1105257210 13:18751698-18751720 AGCTGGAGCCACAGGGATGCAGG + Intergenic
1105505382 13:21005325-21005347 AGCGTAAGCCAGAGGGATGCTGG + Intronic
1105634151 13:22201209-22201231 ATCTTTAGCCACAGGGGACCAGG + Intergenic
1108744376 13:53376589-53376611 AACTATAGCCAGAGGGACCCTGG - Intergenic
1111494810 13:89034210-89034232 AGCTGTAGCAACTGGGATGCAGG - Intergenic
1113789750 13:113022072-113022094 AGCCTGAGCCACAGGGTCGAGGG - Intronic
1122434896 14:101688882-101688904 ACCACTAGCCACAGGGCCGCTGG + Intergenic
1125862179 15:43009332-43009354 AGCTCTAGGCACAGGGACAGGGG - Intronic
1126764897 15:52002080-52002102 AGCTTTCGCCAGAGGGTCTCTGG - Intronic
1128089120 15:64907019-64907041 AGCATTAACCAAAGGGAGGCAGG - Intronic
1128360597 15:66959031-66959053 AGCCTCAGCCACAGGGACCCTGG - Intergenic
1132657379 16:1046922-1046944 ACCCTCAGCCACAGGGACGGTGG + Intergenic
1134047709 16:11113273-11113295 AGCTTTACACAAAGGGACTCAGG - Intronic
1147452368 17:40513662-40513684 AGCCTTGGCCTCAGGGACCCTGG - Intergenic
1148054859 17:44787845-44787867 AGCTCTGGCCACAGCCACGCTGG - Intergenic
1148643316 17:49204385-49204407 AGCTGTAGCCACATGGCCGATGG + Intronic
1149569654 17:57663399-57663421 AGCCTCTGCCACAGGCACGCAGG - Intronic
1149641704 17:58206950-58206972 AGCTTAAGCCACAGGAAGGAAGG + Intronic
1151418931 17:73984880-73984902 AGGTTTAGCCACAGGCAGGTGGG + Intergenic
1151656646 17:75499361-75499383 GGCTTTAGCCCCAGGGACGGGGG - Exonic
1152297906 17:79479072-79479094 AGCTTTTGCCCCAGTGAGGCGGG - Intronic
1157537191 18:48468494-48468516 AGCTTCAGCCACAGGCCCCCTGG - Intergenic
1159953569 18:74503744-74503766 AGATACAGCCACAGTGACGCTGG + Intronic
1161352083 19:3799150-3799172 AGGTTCAGGCACAGGGACCCAGG - Intronic
1161703495 19:5806981-5807003 AGATTTAGACCCAGGGACACAGG + Intergenic
1161811304 19:6472774-6472796 AGCTATACCCTCAGGGACCCAGG + Intronic
1163311058 19:16514827-16514849 AGCTTTTGCCACAGGGTGGCAGG - Intronic
1166045788 19:40230076-40230098 TGCTTAAGTCACAGGGACACAGG - Intergenic
1167681395 19:50923996-50924018 AGGTTTGGACACAGGGACTCTGG + Intergenic
926321791 2:11753486-11753508 CAGTTTAACCACAGGGACGCTGG + Intronic
926894876 2:17674831-17674853 AACATTAGCCAAAGGGAAGCTGG - Intronic
934306822 2:91832092-91832114 AGGTTAAACCACAGGGACCCAGG + Intergenic
934326434 2:92020650-92020672 AGGTTAAACCACAGGGACCCAGG - Intergenic
934464798 2:94251267-94251289 AGGTTAAACCACAGGGACCCAGG - Intergenic
937077924 2:119120616-119120638 GGCTTTAGCCAGAGTGACACAGG - Intergenic
937136791 2:119560277-119560299 AGCTTTAGGCACAGGGCAGTGGG - Intronic
938729324 2:134134080-134134102 ACTTTTAGCAACAGGGAAGCGGG + Intronic
940017408 2:149121706-149121728 AGCTGCAGCCACAGAGAAGCAGG + Intronic
942409087 2:175687900-175687922 GGCTTAAGCTACAGGGACACTGG + Intergenic
946544011 2:220716459-220716481 ATCTTGAGCCACTGGGACACAGG + Intergenic
947508237 2:230726577-230726599 AGGTTAAGGCACAGGGATGCAGG - Intronic
1169895229 20:10498264-10498286 AGCTGTAAACACAGGGAGGCAGG - Intronic
1169970242 20:11261874-11261896 AGTTTTAGCCAGAGGGAAACGGG + Intergenic
1170146516 20:13181073-13181095 ATCTTTAACCAGAGGGATGCAGG - Intergenic
1175248419 20:57595084-57595106 AGCTTCAGACACAGGGAGGCGGG - Intergenic
1175875258 20:62226500-62226522 AGCTTAAGGGACAGGGTCGCAGG + Intergenic
1176199834 20:63855261-63855283 AGCTGTGGCCACAGGGCAGCGGG + Intergenic
1176595835 21:8694438-8694460 AGGTTAAACCACAGGGACCCAGG - Intergenic
1178751257 21:35305641-35305663 AGCTTTAGCCACAGGGACGCTGG + Intronic
1179908124 21:44434681-44434703 ATCTGTGGCCACACGGACGCAGG + Intronic
1180585950 22:16890414-16890436 AGGTTAAACCACAGGGACCCAGG - Intergenic
1181814323 22:25426654-25426676 AGCTCCAGCCACACAGACGCTGG - Intergenic
1181832820 22:25576160-25576182 AGCTCCAGCCACACAGACGCTGG - Intronic
1184486618 22:44783619-44783641 AGCTCTGGCCTCAGGGATGCCGG - Intronic
949926840 3:9048358-9048380 AGCTTTAGGCACTGGGGAGCTGG - Intronic
950263790 3:11560447-11560469 AGTGTCAGCCAGAGGGACGCTGG + Intronic
950939173 3:16876170-16876192 AGCTGTAGCCACAGGGATTTTGG - Intronic
952846439 3:37691441-37691463 AGCTTCACCCACAGGGCAGCAGG + Intronic
955137791 3:56237159-56237181 AGCCTTAGGCACAGGCAGGCAGG - Intronic
961654947 3:128436011-128436033 TGCTATAGCCCCAGGGACCCAGG + Intergenic
962569185 3:136694738-136694760 AGCTTTAGCTCAAGGGACACAGG + Intronic
963378182 3:144496336-144496358 AGCCTTAGCCACAGTGGCACAGG - Intergenic
969083408 4:4637714-4637736 AGGTTTGGGCACAGGGACACAGG - Intergenic
970238487 4:13982967-13982989 AGCTTTAGACTTAGGGACTCAGG + Intergenic
970486133 4:16526444-16526466 ATCTTCAGCCCCAGGGAAGCTGG - Intronic
974421578 4:61683376-61683398 AGCATTAGCCACACGGACACTGG + Intronic
975273515 4:72466635-72466657 AGATGCAGCCACAGGGAGGCAGG - Intronic
980707634 4:136520208-136520230 AGCTGTAGCGACTGAGACGCAGG + Intergenic
986549258 5:8934623-8934645 AGGTGGAGCCACATGGACGCAGG - Intergenic
991588861 5:68227696-68227718 AGCTTTGGCCACAGCGATCCTGG - Intronic
995254477 5:110030637-110030659 AGAGATAGCCACAGGGACCCAGG - Intergenic
998508136 5:142688720-142688742 AGGTTTATCCACAGAGACGTGGG + Intronic
999736075 5:154514330-154514352 CTCTTCAGCCAGAGGGACGCAGG + Intergenic
1001308236 5:170591286-170591308 AGTTTGAGCCACATGGAGGCAGG + Intronic
1004471606 6:15934349-15934371 AGCTTTGGTCACAAGGATGCTGG + Intergenic
1014209802 6:118696399-118696421 ACATTCAGCCACAGGGAGGCAGG - Intronic
1019321118 7:415735-415757 AGCTTTGGACACAGGCACGCGGG + Intergenic
1022922622 7:35032002-35032024 AGCATGAGGCACAGGGACACAGG - Intronic
1029524754 7:101087914-101087936 AGCTTCAGCCAGAGGCAGGCAGG - Exonic
1033765218 7:144482020-144482042 AGCTTTTGTCACAGGGAGACAGG + Intronic
1037703608 8:21296877-21296899 CGCTCTGGCCACAGGGAGGCAGG + Intergenic
1040329141 8:46377057-46377079 TGGTTTGGCCACAGGGACTCAGG + Intergenic
1041263814 8:56044825-56044847 AGATTTAGACACAGGGCGGCTGG - Intergenic
1044858752 8:96500783-96500805 AGCTTTAGCAACAAGGATGGAGG + Intronic
1044894995 8:96882216-96882238 GGCTTTTGCCACAGGGATGATGG + Intronic
1046157602 8:110313503-110313525 AGCTTTAGCCATATGGATCCAGG - Intergenic
1048758606 8:137766940-137766962 AGCTGGAGCCTCTGGGACGCAGG - Intergenic
1049674181 8:143882544-143882566 GGCTTTGGCCAGAGGGCCGCTGG - Intergenic
1050167938 9:2785875-2785897 AGGTTTAGGCACAAGGAAGCTGG + Intronic
1052879951 9:33595650-33595672 AGCTGGAGCTGCAGGGACGCAGG - Intergenic
1053496022 9:38548570-38548592 AGCTGGAGCTGCAGGGACGCAGG + Intronic
1053665738 9:40316384-40316406 AGCTTGAGCTGCAGGGATGCAGG - Intronic
1053694882 9:40628026-40628048 AGGTTAAACCACAGGGACCCAGG - Intergenic
1053915321 9:42941430-42941452 AGCTTGAGCTGCAGGGATGCAGG - Intergenic
1053941867 9:43258406-43258428 AGGTTAAACCACAGGGACCCAGG - Intergenic
1054269959 9:63012093-63012115 AGGTTAAACCACAGGGACCCAGG + Intergenic
1054306126 9:63427250-63427272 AGGTTAAACCACAGGGACCCAGG - Intergenic
1054376894 9:64456414-64456436 AGCTTGAGCTGCAGGGATGCAGG - Intergenic
1054404868 9:64751229-64751251 AGGTTAAACCACAGGGACCCAGG - Intergenic
1054438492 9:65236721-65236743 AGGTTAAACCACAGGGACCCAGG - Intergenic
1054491912 9:65785227-65785249 AGGTTAAACCACAGGGACCCAGG + Intergenic
1054518875 9:66059900-66059922 AGCTTGAGCTGCAGGGATGCAGG + Intergenic
1062095744 9:134702246-134702268 GGTTTTAGCCACAGAGACCCGGG - Intronic
1202777327 9_KI270717v1_random:1632-1654 AGGTTAAACCACAGGGACCCAGG - Intergenic
1192315725 X:70049938-70049960 ACCTGGAGCCACTGGGACGCTGG - Exonic
1195166624 X:102226612-102226634 AGCTATGGCAACAGGGACTCAGG + Exonic
1195192236 X:102460476-102460498 AGCTATGGCAACAGGGACTCAGG - Exonic
1195769088 X:108329879-108329901 AGCTTGAGCAACAGGGAGGATGG + Intronic
1199868265 X:151873705-151873727 AGCTATAGACTCAGGAACGCTGG - Intergenic