ID: 1178751319

View in Genome Browser
Species Human (GRCh38)
Location 21:35306250-35306272
Sequence CTCTGTAAACTGTTAATAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 134}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178751319 Original CRISPR CTCTGTAAACTGTTAATAGC AGG (reversed) Intronic
901323656 1:8354439-8354461 CTCTGTATTCTGTCAATAGTTGG + Exonic
904332955 1:29776688-29776710 CTCTGAAAACTGAGAATAGATGG - Intergenic
906788371 1:48636415-48636437 CTCTGTAAAATGTTAATACAGGG - Intronic
913441763 1:118905965-118905987 CTCTGTACACTGTCATTAGCTGG + Intronic
915321033 1:155056638-155056660 CTGTGTACACTGTGACTAGCTGG - Intronic
916420491 1:164633457-164633479 CTCTTTAGACTATTAATAGTTGG + Intronic
919234966 1:194828967-194828989 CTCTGGAAGATGTTGATAGCTGG + Intergenic
921629772 1:217419335-217419357 CTCTGTCAGTTATTAATAGCTGG + Intergenic
1063276667 10:4576271-4576293 CTCTGAAAAATGTTAATGGAAGG + Intergenic
1064456600 10:15492887-15492909 CTCTGGCAACTTTTAATAGTAGG - Intergenic
1064842217 10:19606319-19606341 CTCTTTAAACTTTTAGTAGCAGG + Intronic
1065096426 10:22285277-22285299 CACTGTAAACTGTTACTCCCTGG + Intergenic
1069787021 10:70995025-70995047 CTCAGAAAACTGCTAATAGTGGG - Intergenic
1070130078 10:73649719-73649741 CTGTCTAAACTGTTAGTAACAGG - Intronic
1071029666 10:81161643-81161665 CTCTGTTAACTTTTAAAAACTGG - Intergenic
1071287763 10:84164610-84164632 CTCTTTGAAATGTTAAAAGCAGG + Intergenic
1071951171 10:90703972-90703994 CTCTGTAAACAGTTCACACCAGG + Intergenic
1072147247 10:92652499-92652521 CTTTGTTAACTGTTGAAAGCAGG - Intronic
1073859066 10:107716112-107716134 CTCTGGAAACTTTTATCAGCGGG - Intergenic
1083826528 11:65206974-65206996 CTCTGCAAACTGTAAAGTGCTGG - Intronic
1084102268 11:66957689-66957711 CTTTGTAAACTACTAAAAGCTGG + Intronic
1087093161 11:94296063-94296085 CTCTGAAAAATGTTAATAGTTGG - Intergenic
1087106317 11:94411712-94411734 CACAGTGAAATGTTAATAGCAGG + Intergenic
1093408572 12:18837506-18837528 CTCTGTAATTGGGTAATAGCAGG - Intergenic
1094750390 12:33399428-33399450 CTCTTTAAACTGCTAATAAAAGG + Intronic
1096910126 12:54974784-54974806 CTCTGAAAACTCTAAATACCGGG + Intronic
1097301871 12:58027497-58027519 CTCTGTCCACTGTTAATATCAGG - Intergenic
1098386162 12:69921070-69921092 CATTTAAAACTGTTAATAGCTGG + Intronic
1099944749 12:89231830-89231852 CTCTGTAAAATGGAGATAGCTGG + Intergenic
1104378358 12:128285430-128285452 CTCTTTAATCTTTTAAAAGCTGG - Intronic
1104580180 12:130005845-130005867 CTCTGTACACTGTTCCTAACCGG - Intergenic
1106216434 13:27705665-27705687 CTCAGCAAACTGTGAATAGAAGG - Intergenic
1106788911 13:33134878-33134900 CTCTCAAGACTATTAATAGCAGG - Intronic
1114693202 14:24604566-24604588 CACTGTAAACTCACAATAGCTGG - Intergenic
1118449819 14:65889944-65889966 CTCTGTAAATTGTAGATAGCTGG - Intergenic
1125280867 15:38041531-38041553 ACCTGTAAACTGGTATTAGCAGG - Intergenic
1125823219 15:42651673-42651695 CTATTTATCCTGTTAATAGCAGG + Intronic
1128615303 15:69104339-69104361 CTCGATAAAATTTTAATAGCAGG - Intergenic
1128997241 15:72306195-72306217 CTTTGTAAACTGCCAAGAGCTGG + Intronic
1132323884 15:100949829-100949851 CTCAGTAAACTAGTAATAGAAGG + Intronic
1133335362 16:5003562-5003584 CTCTGGACACTGGTAAGAGCTGG + Exonic
1134466468 16:14483069-14483091 CTTTGTAAACTGTAAAGAACCGG + Intronic
1135264792 16:21014424-21014446 CTCAGTAAACTAGTAATAGAGGG + Intronic
1136657642 16:31720211-31720233 CTCTGTAGACTTTAAATGGCTGG + Intronic
1139936914 16:70578193-70578215 CTCTGTCAAGTTTTCATAGCAGG - Intergenic
1140015026 16:71174461-71174483 CTGTGTATCATGTTAATAGCAGG - Intronic
1140143736 16:72285450-72285472 CTATGTAAACTCTTTACAGCTGG - Intergenic
1147908598 17:43840522-43840544 CTCCATATACTGTAAATAGCAGG - Intergenic
1154408486 18:14119266-14119288 TTCTGTAAACTGTTTTTGGCAGG - Intronic
1155721949 18:29026245-29026267 CTCTTTAAACTGTTTTTAGATGG + Intergenic
1157498940 18:48176670-48176692 TGCTGTAAAATGTTAACAGCAGG + Intronic
1157847856 18:51020027-51020049 CACTGCAAAATGTTAATAGTTGG - Intronic
1158288370 18:55910956-55910978 CTCTGTGATCTGCTTATAGCAGG + Intergenic
1164310344 19:24040781-24040803 CTCTGTAAACTTTAAAAAGCTGG + Intronic
1167031019 19:46960670-46960692 CAATTTAAACTCTTAATAGCAGG - Intronic
925610702 2:5699147-5699169 CTCAGAAATCTGTTAAAAGCAGG - Exonic
926610179 2:14938956-14938978 CTCTCTTCACTGTTAATTGCAGG + Intergenic
928050272 2:27986329-27986351 GTCTGTCAGCTTTTAATAGCAGG + Intronic
929125326 2:38518328-38518350 CTCTGTTAACTGATCATAGGGGG - Intergenic
929550299 2:42886341-42886363 CTCTGTCAACTGATAGTAGGGGG - Intergenic
931746644 2:65296850-65296872 CTTTGGGGACTGTTAATAGCAGG + Intergenic
932084776 2:68748168-68748190 TTCAGAAAACTGTTAATAGAAGG - Intronic
932536218 2:72599369-72599391 CTCAGCAAACTGCTAATAGAAGG + Intronic
935030147 2:99313772-99313794 CTCTTTAAACTGTCAATGGCAGG - Intronic
935617239 2:105099199-105099221 TCATGTAAACTGTTAATAGATGG + Intronic
943910513 2:193560632-193560654 TTCTATAAACTGTTAATATTAGG - Intergenic
943947044 2:194079921-194079943 CTCTGTAAATTGTTTATAATTGG - Intergenic
946045859 2:216820474-216820496 TTTTGTAAACTGTTAATATGTGG + Intergenic
946848622 2:223883383-223883405 TTCTGTTAACTGTTAATAAATGG + Intronic
947319851 2:228904927-228904949 GTCTCAAGACTGTTAATAGCTGG - Intronic
1172748581 20:37232912-37232934 CTCTGTAAAGTTTTAAAAGGTGG + Intronic
1174361037 20:50029173-50029195 CTCTGTTCACTGTTTAAAGCAGG - Intergenic
1178751319 21:35306250-35306272 CTCTGTAAACTGTTAATAGCAGG - Intronic
949751520 3:7357549-7357571 CCCTGTAAAATCTAAATAGCTGG + Intronic
950212001 3:11130517-11130539 CTCTGTAAGTCGGTAATAGCTGG - Intergenic
951621599 3:24607972-24607994 CTCTGGAAACTTTTAAGAGAAGG - Intergenic
951877121 3:27439900-27439922 CTCTGCAAACTAAGAATAGCAGG - Intronic
953462388 3:43092154-43092176 CTCTGTAAGATGTTATTAGTAGG + Intronic
956511571 3:69999411-69999433 CTCCGTAAACTATAAAAAGCAGG - Intergenic
956769829 3:72515766-72515788 CTTTGTTAACTGTTAAGAGTTGG + Intergenic
963805805 3:149721274-149721296 CTCAGTAAACTCTGAATAGAAGG - Intronic
964312510 3:155409902-155409924 TTCTCTAAACTGGTAGTAGCTGG - Intronic
966280118 3:178216257-178216279 ATCTGCAAAATGTTAGTAGCAGG + Intergenic
969815651 4:9685442-9685464 CTATGTAAAATGTTACCAGCAGG - Intergenic
969961744 4:10951793-10951815 TACTTTAAACTGTTAATAGAAGG + Intergenic
970339420 4:15089234-15089256 CTCAGTAGACTGTTAATATGGGG + Intergenic
970436344 4:16039397-16039419 CTTTGTAAAATATTAATATCAGG - Intronic
970675680 4:18447835-18447857 CTCAGGAAACTATTAATAGAAGG + Intergenic
972480139 4:39488988-39489010 CCATGTAAACAGTTCATAGCTGG + Intergenic
972847815 4:43010627-43010649 CTCTCTTAATTATTAATAGCAGG + Intronic
973879830 4:55258730-55258752 CTTTGTAAAGTGTTAAGAGATGG + Intergenic
974522195 4:62996121-62996143 CTCTGTAAACTGTGAAGAACTGG - Intergenic
977439292 4:97042094-97042116 CTATTTAAAGTGTTAATAACAGG + Intergenic
978834035 4:113126155-113126177 CTCTGTACACTGATAATACCAGG + Intronic
980382544 4:132042563-132042585 CTCTGTAGACTTTTACTAACAGG + Intergenic
980480643 4:133382859-133382881 CTCTTTATACTATTAATAGGTGG + Intergenic
986527532 5:8696462-8696484 CTTTAGAAACTGTTAATAACTGG - Intergenic
986605424 5:9518467-9518489 CTTAGTAAACAGATAATAGCTGG - Intronic
986785644 5:11111742-11111764 CTCTGTAAAATGGTCATAACAGG + Intronic
988792103 5:34618198-34618220 TTCTGTAAACTGTAAATATAAGG + Intergenic
992429350 5:76692657-76692679 CTCAGTAAACAGTAAAGAGCTGG - Intronic
993956957 5:94245876-94245898 CTCTTTAAACTCTTAATAGAAGG + Intronic
995758158 5:115534285-115534307 ACCTGTAATCTTTTAATAGCAGG + Intronic
997504871 5:134409301-134409323 TTCTGAAAAGTATTAATAGCTGG + Intronic
997916614 5:137933121-137933143 TTCCCTAAACTGTTAATACCTGG - Intronic
1000571481 5:162919898-162919920 CTCTGCAAACTATTTATAGATGG - Intergenic
1001225836 5:169943962-169943984 CTCTGTAAAGTGGTAAGAGTGGG + Intronic
1001329621 5:170752919-170752941 ATCTGTAAACTGGGAATAACAGG + Intergenic
1003685805 6:8300833-8300855 CTTTGTAAACTGTAGAAAGCCGG + Intergenic
1004543595 6:16574699-16574721 CTTTGTAAGCTGTTAATATAGGG - Intronic
1007013209 6:38437378-38437400 CTCTGAAAACTGTTGTGAGCTGG - Intronic
1008064133 6:47029481-47029503 CTCTGTAAACCATTAATACCAGG + Intronic
1010180278 6:73078726-73078748 CTCTGTAAGTTGTTGATAACTGG - Intronic
1011423060 6:87195002-87195024 CTCTGTAAAATGGGAATAGAGGG + Intronic
1014939993 6:127426777-127426799 CTCTCTCAACAGTTGATAGCAGG + Intergenic
1015368002 6:132418794-132418816 CTCTGTACTCTGTTAATTTCAGG - Intergenic
1017662221 6:156686222-156686244 TGCTGTCAACTGTTAAAAGCTGG + Intergenic
1018649822 6:165984263-165984285 CTCTGTAGACTCTTACTACCTGG + Intronic
1020666138 7:11046474-11046496 CTCTGTAAACTATTCCTAGAAGG - Intronic
1020786881 7:12584676-12584698 CTCTGTAAATTGGTAAGATCTGG - Intronic
1027348554 7:77287314-77287336 CTCTGGAAAGTGTTTAGAGCTGG - Intronic
1027622473 7:80506541-80506563 TTCTGAAAACTGTAAATATCGGG + Intronic
1029820245 7:103139831-103139853 TTCTGTACACTGTAAATAACAGG + Intronic
1030228087 7:107174916-107174938 CTATCTAAACTGTTAATATTAGG + Intronic
1030571011 7:111224412-111224434 CTCTCTAAAATGTCATTAGCAGG - Intronic
1030846064 7:114413244-114413266 CCCTGTAAACTGTGAAGAGTTGG + Intronic
1031028727 7:116712030-116712052 CTCTGTGAACTGTTATGAGATGG + Intronic
1032930536 7:136663214-136663236 CTCTGCAAACTGTTAGTTCCAGG - Intergenic
1033944320 7:146697063-146697085 CTCTGTCAATTGCTAATAGAGGG + Intronic
1034226186 7:149485303-149485325 CTCTCCAAAATGTTAATAGATGG + Intronic
1035421528 7:158732978-158733000 CTGTTTAGACTGTTAAAAGCAGG - Exonic
1037668677 8:20996160-20996182 CTCTGTAAACTGTAAGGAGATGG + Intergenic
1039662999 8:39487502-39487524 CTCTGTAAACTGCTTAAAACTGG - Intergenic
1040555497 8:48474352-48474374 CTCTGTAAAGAATTAACAGCAGG - Intergenic
1042673645 8:71292576-71292598 ATCTGTAAGATGTTAATATCTGG + Intronic
1045358563 8:101411414-101411436 CCCTGTAAGATGTTAAGAGCAGG + Intergenic
1048063570 8:130945515-130945537 CTCTGTAAACTGGAGATAACTGG + Intronic
1048255743 8:132903903-132903925 CTCTGTAAACTGTTGAGCACTGG + Intronic
1055758103 9:79576411-79576433 CTCTGTACACTTTCAAAAGCAGG + Intronic
1058746378 9:107995292-107995314 CTCTGAAATCTGTAAATATCAGG - Intergenic
1060082943 9:120669419-120669441 TTTTGTAAACTGTTTGTAGCTGG - Intronic
1060534185 9:124370075-124370097 CTCTGTAAACTGTTGATAGACGG - Intronic
1061470723 9:130823318-130823340 CATTGAAAACTGTTAATAGAAGG - Intronic
1061909907 9:133716973-133716995 ATCTGTAAAATGGGAATAGCGGG - Intronic
1185763128 X:2703685-2703707 CTCTGTGAACTGCTAATAGTTGG + Intronic
1186611430 X:11141654-11141676 TTCTGTAAACTGTGGATGGCAGG - Intronic
1192137950 X:68622359-68622381 CTCAGAAAACTGGTAATAGAAGG - Intergenic
1193390880 X:80927739-80927761 CTCTGTAAACTGTAAACAAATGG + Intergenic
1194791650 X:98158559-98158581 CCAAGTAAACTGTTAATAGAAGG + Intergenic
1196289767 X:113925697-113925719 CTCTGTAAACTGTGTATAGAAGG - Intergenic