ID: 1178760923

View in Genome Browser
Species Human (GRCh38)
Location 21:35402058-35402080
Sequence AAAATTCTGAAAGACGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 186}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178760923_1178760925 11 Left 1178760923 21:35402058-35402080 CCTGGCACGTCTTTCAGAATTTT 0: 1
1: 0
2: 3
3: 8
4: 186
Right 1178760925 21:35402092-35402114 TAAAATTATCTTCATCCTTTTGG 0: 1
1: 0
2: 3
3: 55
4: 530

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178760923 Original CRISPR AAAATTCTGAAAGACGTGCC AGG (reversed) Intronic
901204505 1:7486336-7486358 AAAATTCTCAAAAATGTACCAGG + Intronic
903761201 1:25699990-25700012 AAAATTCTGAAAAGAGAGCCCGG + Intronic
905338892 1:37264837-37264859 AAAATTCTGAATCTAGTGCCTGG + Intergenic
906968163 1:50480822-50480844 TACCTTCTGAAGGACGTGCCTGG - Intronic
907502352 1:54890782-54890804 AATATTCTTAAAGAAGTTCCAGG - Intergenic
907634700 1:56122294-56122316 AAAATCCTGAAAGACAACCCAGG - Intergenic
907717578 1:56941672-56941694 CAAATTATGAAACACGTACCTGG + Intronic
908025047 1:59941560-59941582 TACCTTCTGAAAGACCTGCCTGG - Intergenic
908161713 1:61415419-61415441 AAAATTGTAACAGACGTGACAGG + Intronic
912124646 1:106520418-106520440 AAAAATTTAAAAGACGGGCCGGG + Intergenic
913218245 1:116638560-116638582 AAAATCCAGTAAGACGTACCGGG - Intronic
914842127 1:151257042-151257064 AAAATCCTGGAAGACCGGCCGGG - Intronic
917543614 1:175938994-175939016 TAAATTCTGAAAGAGGTCTCAGG - Intergenic
917996998 1:180450460-180450482 AAACTTCTGAAAGACTCGGCCGG + Intronic
919233185 1:194802584-194802606 AAAATTCTGAAAGCTGAGGCAGG - Intergenic
919393352 1:197014785-197014807 AAAATTCAGAAACAGTTGCCAGG - Intergenic
919677932 1:200404899-200404921 AAAATTCTGAAAAACGTTACTGG + Intergenic
921174050 1:212578253-212578275 AAAATTCTGAAAGAAGAGAAAGG - Intronic
923027322 1:230215770-230215792 AAAATGCTGTAAGACAGGCCAGG - Intronic
1062765391 10:58938-58960 ATAATTCTGAAAGTCCTGTCTGG - Intergenic
1065034074 10:21620221-21620243 AAAATTTTAAAAGAGGGGCCAGG - Intronic
1066107396 10:32167826-32167848 ACAGTGCTGCAAGACGTGCCTGG - Intergenic
1066950149 10:42109751-42109773 AATATTCTAAAAGAAGTGACAGG + Intergenic
1067754851 10:48997571-48997593 AAAAATGTGAAAGACGAGACTGG - Intergenic
1068615427 10:59109570-59109592 GAATTTCTGGAAGAAGTGCCAGG + Intergenic
1069234814 10:66057820-66057842 ACAATTTTGAAAAACATGCCTGG - Intronic
1070169510 10:73922016-73922038 AAAATTCTGATAGATGAGGCTGG - Intronic
1070387264 10:75936897-75936919 AAAATACTGAAATACATGCATGG - Intronic
1072254706 10:93610201-93610223 AAGATTATGAAAGATGGGCCGGG + Intergenic
1076836621 10:133024187-133024209 GAAAGTGTGAAAGACGTGACTGG + Intergenic
1078779511 11:14423641-14423663 AAGATGCAGAAAGACTTGCCAGG + Intergenic
1079596155 11:22250446-22250468 AACATTCTGAAGGAAATGCCAGG - Intronic
1084630747 11:70347543-70347565 AAAATTTTAAAAGATGAGCCAGG + Intronic
1085652966 11:78285065-78285087 ATAATTCTGAAAGCAGTGACCGG - Intronic
1087108055 11:94431760-94431782 AAAATGCTCAGAGAAGTGCCTGG + Intronic
1088256044 11:107904418-107904440 AAAATTCTGAAAGCACTTCCTGG - Intronic
1091729411 12:2869080-2869102 AAAAGTCTGAAAAACGGGCGTGG - Intronic
1092501588 12:9052849-9052871 AAAATGCTTAAAGCAGTGCCAGG + Intergenic
1093244064 12:16713663-16713685 AAAAATCTGAAAAACGTAGCTGG + Intergenic
1093350062 12:18088393-18088415 AAAATTCTAAAACACATGCTGGG - Intronic
1094130557 12:27070027-27070049 AAAATTCTGAAAGCACTGCTTGG + Intergenic
1096251576 12:50036548-50036570 TTAATTCTGAAAGACAAGCCAGG + Intergenic
1098797437 12:74908717-74908739 AAAATTCACAAAGACTGGCCTGG - Intergenic
1100041579 12:90325753-90325775 AAACTTCTGCAAGATTTGCCTGG + Intergenic
1100461138 12:94800426-94800448 AAAGTTCTGAAAGAAGAGACTGG + Intergenic
1100535282 12:95503195-95503217 AAAAATCTGAAAGAAATGCTGGG - Intronic
1100675670 12:96864092-96864114 AAAACTCTGAAAGACATTTCTGG - Intronic
1105588436 13:21767156-21767178 AAAATACAGGAAGACGTGGCAGG - Intergenic
1107217508 13:37938569-37938591 AAAGTTCTGAAAGACCAGTCTGG - Intergenic
1108150593 13:47529760-47529782 AAAAGTGTGAAAGACGTCACAGG + Intergenic
1108820011 13:54336847-54336869 CAGATTCTGAAAGACATGCATGG - Intergenic
1110946207 13:81421968-81421990 ATAATTCAGAAAAACGTCCCTGG - Intergenic
1111102463 13:83606090-83606112 AGATTTCTGAAAGACCTTCCAGG - Intergenic
1111265271 13:85802699-85802721 AAAAATCTGAAAGCCTTGCAGGG + Intergenic
1112869826 13:103956662-103956684 GAAATTCAGAAAGATATGCCTGG + Intergenic
1113109584 13:106807914-106807936 AGAATTCTGAAAGAGGTGAAGGG - Intergenic
1117784636 14:59269909-59269931 GAGATTCTGAGAGACGAGCCTGG + Intronic
1119214743 14:72860070-72860092 AAAATTCTGAATGTGGTCCCAGG - Intronic
1120047666 14:79826844-79826866 AAACTTCTTAAAGTCCTGCCAGG + Intronic
1120698033 14:87666212-87666234 AAAGTTCTGAAAAACATGCCAGG + Intergenic
1120930048 14:89839281-89839303 AAACTTGTGAAAGATGTTCCTGG - Intronic
1121853728 14:97247272-97247294 AAAATTCTGGAAGGTGTGCAAGG - Intergenic
1122913326 14:104844273-104844295 AAGATTTTGAAATGCGTGCCTGG - Intergenic
1125552490 15:40556540-40556562 AAAATTCTGTAAGGCAGGCCAGG + Intronic
1125710526 15:41781951-41781973 AAAATTATGAAATACAGGCCGGG + Intronic
1126585343 15:50280441-50280463 AAAATTTTAAAACACGTGCATGG - Intronic
1131116728 15:89800519-89800541 AAAATGCTTAAAGTAGTGCCTGG - Intronic
1131358567 15:91768301-91768323 TGAATTCTGAAAGATGTGGCAGG - Intergenic
1131860135 15:96644957-96644979 AAAATGCTGAAGGCCGTGGCAGG + Intergenic
1132800991 16:1753154-1753176 AAAATGCTGAGAGAGGTGCAGGG - Intronic
1136138460 16:28273203-28273225 AAAAATCTGAAAGAGAGGCCAGG - Intergenic
1139191520 16:64868886-64868908 AAAATGCTAAAATAAGTGCCAGG - Intergenic
1139397370 16:66651017-66651039 AAATATCTGAAAGACGAGACAGG + Intronic
1139571920 16:67818225-67818247 AAAATTCTGAAAAACAAGGCTGG + Intronic
1140113152 16:72020645-72020667 AAAATACTGAAAAACAGGCCAGG - Intronic
1142740093 17:1926872-1926894 AAAAATCTGAAATACGGGCGGGG + Intergenic
1150335804 17:64329937-64329959 AAAATTTTAAATGAAGTGCCAGG - Intronic
1152591537 17:81215705-81215727 AAAATTTTGAAAGGGGGGCCAGG - Intronic
1152866296 17:82725652-82725674 AAAATTTTGAAAGGGGGGCCAGG - Intronic
1152931152 17:83110523-83110545 AAAATTCTGAAAGAAATGCCCGG - Intergenic
1153608473 18:6857639-6857661 AAGATTCTGATAGACGGGACTGG - Intronic
1155575893 18:27246410-27246432 AAAATTTTGTAAGAAGTGGCCGG - Intergenic
1156215049 18:34989550-34989572 AAAATTTTGAAAAAATTGCCAGG + Intronic
1157460749 18:47891006-47891028 AAAAGTCTGTAAGAGGTGGCCGG + Intronic
1158906755 18:62020652-62020674 AAAATTTTTAAAGACTGGCCGGG + Intergenic
1162429257 19:10617448-10617470 AAAATGCAGAGAGAGGTGCCTGG - Intronic
1202672099 1_KI270709v1_random:64858-64880 AATATTCTAAAAGAAGTGACAGG - Intergenic
925049000 2:796581-796603 ACTATTAGGAAAGACGTGCCTGG + Intergenic
925308764 2:2867244-2867266 AAAGTTCTGAAGGTCGTGCCTGG - Intergenic
925743251 2:7023865-7023887 ACAATTCTGTAAGAAGAGCCAGG + Intronic
932311222 2:70743600-70743622 AAAATTCTGAAATACTTGCCAGG + Intronic
934953194 2:98593189-98593211 AACAGTGTGAAAGACCTGCCTGG - Intronic
936236048 2:110743714-110743736 AAAATTCTGAAAGCCTTGGGCGG - Intronic
937753773 2:125511307-125511329 AAAATTAGGAAAGATGTCCCTGG + Intergenic
939472721 2:142644980-142645002 AAAAATATCAAAGATGTGCCTGG + Intergenic
940608317 2:155957027-155957049 AAAATTCTGAAATACATGATTGG + Intergenic
941009840 2:160286849-160286871 ACACTTCTGAAATAGGTGCCAGG - Intronic
941554418 2:166958641-166958663 AAAATTCTTAAAAAGATGCCAGG + Intronic
941663979 2:168225416-168225438 AAAATTCTGAAAAATATACCTGG - Intronic
947446649 2:230169167-230169189 AAAGATCTCAAAGACGTGCTCGG - Exonic
1169983705 20:11418060-11418082 AAAATTCTGAAAGACGTCAGAGG - Intergenic
1172628557 20:36363081-36363103 AAGATTCTGAAAGAAGTGAGGGG + Intronic
1173611625 20:44372463-44372485 AGAATTCTAGAAGACATGCCTGG - Intronic
1173695368 20:45006393-45006415 AAAAATCTGTAAGACAAGCCCGG - Intronic
1174036599 20:47672388-47672410 CCACTTCTGAAAGACATGCCAGG + Exonic
1175163059 20:57022986-57023008 AAAATTCTGACACACCTGCTGGG + Intergenic
1175535109 20:59705251-59705273 AAAATTCTCAAATACTGGCCAGG - Intronic
1178141623 21:29690462-29690484 AAAACTCAGAAAGAAGTTCCAGG + Intronic
1178760923 21:35402058-35402080 AAAATTCTGAAAGACGTGCCAGG - Intronic
1179648676 21:42792545-42792567 AAAATTCTTAAAGGCGGGCCGGG + Intergenic
1179660643 21:42872637-42872659 AAAAATCTTAAAGACAGGCCGGG + Intronic
1180819551 22:18816639-18816661 AAAATCCAGTAAGACGTACCGGG - Intergenic
1181205778 22:21251084-21251106 AAAATCCAGTAAGACGTACCGGG - Intergenic
1182998811 22:34837868-34837890 AAAATTCTTACACAAGTGCCAGG + Intergenic
1185178733 22:49347308-49347330 GAAATCCTGAAAGACGTTTCTGG + Intergenic
1203221143 22_KI270731v1_random:44329-44351 AAAATCCAGTAAGACGTACCGGG + Intergenic
1203269682 22_KI270734v1_random:42492-42514 AAAATCCAGTAAGACGTACCGGG - Intergenic
952856789 3:37778321-37778343 AAAATTTTTAAAGACAGGCCGGG + Intronic
954579486 3:51695562-51695584 ATAATTCAGAAAGACCTGCTGGG + Intronic
954966796 3:54619031-54619053 AAATTTCAGAAAGACGTGAAGGG + Intronic
955468888 3:59265265-59265287 AAAATTCAGAAAAACAGGCCGGG - Intergenic
956647113 3:71467028-71467050 AAAATGCTGAAGGAGGTGACTGG + Intronic
958560238 3:95739817-95739839 AAAATTCAGAAAGAAGTGTAAGG - Intergenic
960536869 3:118824585-118824607 TAAATTCTGAAGAATGTGCCTGG - Intergenic
962268932 3:133963784-133963806 AACATTCTGAATGAGGTTCCAGG - Intronic
963537159 3:146543726-146543748 AAAATTCTTAGAGCAGTGCCTGG - Intronic
965446796 3:168782960-168782982 AAAATTCTGAAAGAAGTAAGAGG + Intergenic
969041639 4:4301985-4302007 AGAATTCTGAAAGAGGCTCCTGG - Exonic
970003297 4:11386178-11386200 AAGATATTGAAAGACTTGCCTGG + Intergenic
971636126 4:29060732-29060754 ACAATTTTGAAAGACGTGCTGGG - Intergenic
972844603 4:42972103-42972125 AAAATGCTCAAAGACAAGCCTGG - Intronic
976062852 4:81150365-81150387 AAAATTCTGAAAGAACTCCAGGG + Intronic
976104125 4:81598670-81598692 AAAATACTGAAAGTCGTGTGTGG - Intronic
976130726 4:81881464-81881486 AAATATCTGAAAGAGGGGCCAGG + Intronic
978340090 4:107713462-107713484 AAAAATATGAAAGACAGGCCAGG + Intronic
979039015 4:115763254-115763276 AAAAATGTGAAAGACATGCTTGG + Intergenic
979207762 4:118061180-118061202 AAAATTCTGAAACAGGAGCAAGG - Intronic
980847211 4:138338434-138338456 AAAATTATGAAATACCGGCCGGG + Intergenic
980999195 4:139811965-139811987 AATAATCTTAAAGAGGTGCCAGG + Intronic
981739912 4:147990853-147990875 AAAATACAGAAAAACGGGCCTGG + Intronic
982998222 4:162379295-162379317 AAAAATCTGAAAGAAGAGCCTGG - Intergenic
986749187 5:10770955-10770977 AAATTTCAGAAAAACGTGGCAGG - Intergenic
987140758 5:14943648-14943670 AATATCCTGAAACAGGTGCCTGG + Intergenic
989177961 5:38547723-38547745 ACAGTTCTGAGAGACGTGCTAGG + Intronic
990201850 5:53384675-53384697 AAAAATCAAAAAGATGTGCCGGG + Intergenic
992393489 5:76350718-76350740 AAAATTCTGTAAGATGGGCTGGG + Intronic
995205934 5:109481724-109481746 AAATTTCTGAGAAACATGCCGGG + Intergenic
995373482 5:111447824-111447846 AAAATCCTGAAAGTCCTGCTGGG + Intronic
995455209 5:112344310-112344332 AAAATTCTGTAGGACATCCCTGG + Intronic
996172264 5:120308524-120308546 AAAAGTCTTAAAGATGTCCCAGG + Intergenic
996560040 5:124818912-124818934 AAAAGTCAGAAAAACTTGCCAGG - Intergenic
996739653 5:126787277-126787299 GAAATTTTGAAAGACATCCCAGG + Intronic
999616174 5:153426781-153426803 AAAATTCTGAAAAACATCCTAGG + Intergenic
1001250657 5:170144372-170144394 AAAGCTCTGAAAGACCTGCAGGG - Intergenic
1001478456 5:172068043-172068065 AAAGTGCTGAAAGAAGGGCCGGG + Intronic
1002409677 5:179063817-179063839 AAAATGCTGAGAGAAGTGCATGG + Intronic
1003890659 6:10561139-10561161 AAAATTCTGAAAGAAGAGCCGGG - Intronic
1005222321 6:23600728-23600750 AAAATTCTGGAAGAAGTTCAAGG + Intergenic
1006655775 6:35591268-35591290 AAAATACTGAAGGAAGTGCCTGG - Intronic
1008512265 6:52287628-52287650 AAACTACTGAAAAAAGTGCCTGG + Intergenic
1010369997 6:75096599-75096621 AAAATTCTGTAACAGGGGCCGGG + Intronic
1011673176 6:89704083-89704105 AGAATTCTGAAAAACTGGCCAGG + Intronic
1012528223 6:100202829-100202851 AAAATTATGCAAGACTTTCCTGG - Intergenic
1015190854 6:130470627-130470649 AAAATTCTGGAAGAGGGGGCTGG + Intergenic
1018097396 6:160401289-160401311 AAAATTCTGAAAGAAGAGTGGGG + Intronic
1018474559 6:164127469-164127491 AAAAATCAGAAAAAAGTGCCAGG + Intergenic
1020538506 7:9430844-9430866 AAAATACTGAAAAACTAGCCAGG + Intergenic
1022387811 7:29917848-29917870 CAAATACTGAATGAAGTGCCTGG - Intergenic
1022592138 7:31673949-31673971 AAAATTCAGAAAAACTTGCTGGG + Intergenic
1024345916 7:48313149-48313171 AAGATACTCAAAGACGTGCTGGG - Exonic
1026976981 7:74505001-74505023 AAAATTCTGATAGCAGGGCCAGG - Intronic
1028646518 7:93103560-93103582 AAAATCCTGAAAAAAGTGCAAGG - Exonic
1031662452 7:124442935-124442957 AAAATTATGAGAAAAGTGCCTGG + Intergenic
1034600194 7:152244381-152244403 AAAATGCTGAAAAATGGGCCAGG + Intronic
1036728403 8:11240605-11240627 AAAATTGTGAGAAACCTGCCTGG + Intergenic
1038510783 8:28132820-28132842 TAAATTCTGAAAAACTTGCAAGG - Intronic
1038941923 8:32314670-32314692 AAAAGTCTGAAAGACGAGGAAGG + Intronic
1039794004 8:40897003-40897025 AAAACTCTGGAAGACTTTCCAGG - Intronic
1041113590 8:54511675-54511697 AAAATTGTAAAAAACGGGCCGGG + Intergenic
1043357453 8:79429802-79429824 AAAATACTGAAAGCTGTGTCTGG + Intergenic
1046010502 8:108540772-108540794 GAAATTATGAAAGATGTGTCTGG - Intergenic
1050511937 9:6405549-6405571 AAAATTATGAAATATGGGCCAGG - Intergenic
1050534416 9:6619430-6619452 AAAATCCTGACAGAAGGGCCAGG + Intronic
1051985175 9:23076575-23076597 AAAATTGTGAAAGCCGGGCAGGG - Intergenic
1055144863 9:72921402-72921424 AAAATCCAGAAAGAAGTTCCAGG + Intronic
1055263918 9:74473886-74473908 AAGATTCTGAAAGACATTTCAGG + Intergenic
1062404285 9:136387512-136387534 AAAATCCGGGAAGAGGTGCCAGG - Exonic
1186162047 X:6787614-6787636 GAAATTGTGAAAAATGTGCCAGG - Intergenic
1186383699 X:9087871-9087893 CTGATTCTGAAAGAGGTGCCAGG - Intronic
1188979205 X:36712095-36712117 AAAATTTGGAAAGATGTGCTTGG + Intergenic
1189355107 X:40304563-40304585 AAAATTGTGACAGACGTGGTAGG - Intergenic
1193022472 X:76805035-76805057 AAAATTCTGAGATAAGGGCCAGG - Intergenic
1194609998 X:96031513-96031535 ACAGTTCTGAAAGAAGTACCTGG + Intergenic
1196058607 X:111383769-111383791 AAAATACTGACACTCGTGCCTGG + Intronic
1196178632 X:112667079-112667101 AAAACTCTGAAGGACTTTCCAGG + Intronic
1196182650 X:112710702-112710724 AAAAATCTGTAAGACTTGTCTGG + Intergenic
1197047408 X:122014555-122014577 AAAATTCATAAAGAAGTGGCAGG + Intergenic
1198045204 X:132894434-132894456 AAAAATCTGAAACCCGGGCCTGG - Intronic