ID: 1178762092

View in Genome Browser
Species Human (GRCh38)
Location 21:35412736-35412758
Sequence GAGCAGATCCTCTGTGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 1, 2: 2, 3: 16, 4: 251}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178762087_1178762092 14 Left 1178762087 21:35412699-35412721 CCCACTCAGAAAGCAGAAGAAAG 0: 1
1: 0
2: 5
3: 55
4: 547
Right 1178762092 21:35412736-35412758 GAGCAGATCCTCTGTGGAGGAGG 0: 1
1: 1
2: 2
3: 16
4: 251
1178762088_1178762092 13 Left 1178762088 21:35412700-35412722 CCACTCAGAAAGCAGAAGAAAGC 0: 1
1: 0
2: 5
3: 37
4: 371
Right 1178762092 21:35412736-35412758 GAGCAGATCCTCTGTGGAGGAGG 0: 1
1: 1
2: 2
3: 16
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178762092 Original CRISPR GAGCAGATCCTCTGTGGAGG AGG Intronic
901630756 1:10647079-10647101 GAGCTGCTACTCTGGGGAGGAGG + Intronic
901930426 1:12593502-12593524 GAGCAGAACCTGTGAGAAGGTGG - Intronic
902383654 1:16064460-16064482 GAGCAGAGCCTCTGGGGGGAGGG - Intronic
904542674 1:31243811-31243833 GGGCTGAGCCTTTGTGGAGGTGG - Intergenic
905672952 1:39804417-39804439 GGGAAGGTCCTCTGAGGAGGTGG + Intergenic
905676344 1:39828121-39828143 GGGAAGATCCTCTGAGGAGGTGG - Intergenic
911120990 1:94296284-94296306 TAGCAGATCGACTGTTGAGGTGG + Intergenic
913213908 1:116604002-116604024 GAGCAGCATCTCCGTGGAGGTGG - Exonic
914323168 1:146584867-146584889 CAGTGGATGCTCTGTGGAGGGGG - Intergenic
915507947 1:156369151-156369173 GAGCAGGGCCTCTGTGGGCGGGG + Intergenic
915531717 1:156505996-156506018 GAGCAGAACCACTGTGAAAGTGG + Intergenic
919801873 1:201359180-201359202 GAGCAGATCTTTGGTGAAGGAGG + Exonic
921150448 1:212397756-212397778 CAGCAAAGACTCTGTGGAGGGGG + Intronic
921945053 1:220880334-220880356 GGGCAGAGCCACTGTGGTGGGGG - Exonic
922503440 1:226112849-226112871 GATCCTATCATCTGTGGAGGAGG - Intergenic
922792698 1:228318891-228318913 GAGCCCAGCCTCTGTGGATGAGG + Exonic
924569258 1:245223166-245223188 TAGCTGATTCTCTGTGGTGGGGG - Intronic
924942013 1:248818556-248818578 GAGCAGATCCTGTGGGAGGGAGG + Intronic
1064174812 10:13065659-13065681 GAGGAGCTATTCTGTGGAGGGGG - Intronic
1064423813 10:15213019-15213041 GGGCAGATCTTCTCTGGTGGGGG + Exonic
1065742398 10:28808796-28808818 GAGCAGATCCGGTGTTGTGGGGG + Intergenic
1066455347 10:35567430-35567452 GGGCACACCCTCTCTGGAGGAGG - Intronic
1067067145 10:43110621-43110643 GAGCAGAGCCTCTGGGAAAGAGG - Intronic
1067232254 10:44420054-44420076 AAGCATGTTCTCTGTGGAGGAGG + Intergenic
1070302184 10:75211324-75211346 GACCACCTCCTCTGCGGAGGAGG + Intronic
1074273480 10:111978478-111978500 CAGCAGAGCCTCTGAGGAAGAGG + Intergenic
1074929549 10:118110066-118110088 CAGCAGATCCCCTGGGTAGGAGG - Intergenic
1077416786 11:2427646-2427668 GAGGAGACCCTGTGTGGACGTGG + Intergenic
1077480807 11:2813570-2813592 GAGTATGTCCTCTGTCGAGGGGG + Intronic
1083199741 11:61113327-61113349 GAGCAGCTCATCTGTGGCTGGGG - Intronic
1084117158 11:67049145-67049167 GAGCAGATCCTCCGGGGCAGGGG - Exonic
1085203694 11:74717646-74717668 GAGGAGATCCTGTGGGGTGGCGG - Intronic
1085741465 11:79081286-79081308 GAGAAGATGCTCTGTTGAGCAGG + Intronic
1085997505 11:81937997-81938019 GAGCAGATTCTATGTGGTGGGGG - Intergenic
1086890583 11:92253541-92253563 GAGCTGTTCCTCTGTGGAATGGG + Intergenic
1087050147 11:93878616-93878638 GATCAGGTCCTTTCTGGAGGGGG + Intergenic
1087076736 11:94132910-94132932 GAGCAGGTTCTCTGTGGGGGTGG + Intronic
1087128748 11:94651265-94651287 CAGTAGGTCCTCAGTGGAGGAGG + Intergenic
1088764165 11:112960810-112960832 CAGCAGATCCCCTGGGAAGGAGG - Intergenic
1088884557 11:113996792-113996814 GAGCAGATCCTGGGAGTAGGAGG - Intergenic
1089848774 11:121479554-121479576 GAACAAATCCTGTCTGGAGGAGG + Intronic
1090915610 11:131159922-131159944 GACTAGAACGTCTGTGGAGGTGG + Intergenic
1091452431 12:581610-581632 GAGCAGCAGCTCTGTGAAGGGGG + Intronic
1091840125 12:3614764-3614786 GAGCAGAGCCCCTGGGTAGGGGG + Intronic
1096521870 12:52189076-52189098 GAGCAGAGACTCTCAGGAGGTGG - Intronic
1097884762 12:64717892-64717914 GAATAGATCCTCTGTGGATAAGG + Intronic
1099794513 12:87382107-87382129 GAGTAGATTCCCGGTGGAGGAGG - Intergenic
1100449950 12:94696193-94696215 GTGAAGAGGCTCTGTGGAGGGGG - Intergenic
1101824972 12:108213107-108213129 GATGAGCTCCTCTGTGGATGAGG + Intronic
1102212576 12:111138097-111138119 TGGCAGATCCTCTGTGGGAGGGG - Intronic
1102562138 12:113769771-113769793 GAGGAGATTCTCTAGGGAGGAGG - Intergenic
1103555819 12:121765891-121765913 CAGGAGAGCCTGTGTGGAGGCGG + Intronic
1103922106 12:124404449-124404471 GGGCAGATGCTCTGGGAAGGAGG - Intronic
1104641993 12:130473368-130473390 GAGCAGATCCTCTGGGTAACAGG - Intronic
1104844226 12:131838764-131838786 GAGCGGGGCCTCCGTGGAGGTGG + Intronic
1106537426 13:30659864-30659886 GAGCAGCTCCCCTGTGTCGGCGG + Intronic
1106575248 13:30968418-30968440 GTGCAGATTCCCTGTGGATGCGG + Intronic
1109835565 13:67852095-67852117 GAGCAGATCCTGGTTGGAGAAGG + Intergenic
1113529239 13:111008377-111008399 GAGCAGAACCTTTGTTGTGGTGG + Intergenic
1115780676 14:36764877-36764899 GTTCAGATCCTCTGTGCAGAAGG - Intronic
1117196875 14:53349188-53349210 AAGAACAGCCTCTGTGGAGGCGG + Intergenic
1121019328 14:90569500-90569522 GGCAAGCTCCTCTGTGGAGGAGG + Intronic
1122505722 14:102230634-102230656 AAGCAGACCCTCTGTCCAGGAGG + Intronic
1122579123 14:102760771-102760793 GAGCAGATCCTCTCCGTAGAAGG + Intergenic
1125172286 15:36779268-36779290 GAGCAGAGGGTCTGTGAAGGAGG - Intronic
1126373379 15:47970400-47970422 GAAAAGATCCACTGGGGAGGGGG + Intergenic
1126784244 15:52163694-52163716 GAGCAGATACGCTGTGCTGGGGG - Intronic
1128156664 15:65395819-65395841 GAGCAGCTCCGCTGTGTTGGTGG - Exonic
1129440848 15:75579621-75579643 GCTCAGATCCTCGGAGGAGGAGG + Intergenic
1130607454 15:85330960-85330982 GAACAGATCTGCTGGGGAGGAGG + Intergenic
1131467561 15:92667865-92667887 AAGCAGAGCCTCAGAGGAGGTGG - Intronic
1133978451 16:10617007-10617029 GAGCTGCCCCTCTGGGGAGGGGG + Intergenic
1134252381 16:12583405-12583427 GAGCAGCTGCTCTGTGGAAGGGG + Intergenic
1134807892 16:17141198-17141220 CACCAGATCGTCTGTGGAGAAGG + Exonic
1135549762 16:23389076-23389098 GATCAGATAGTCTGTGGGGGCGG + Exonic
1135771915 16:25224343-25224365 CAGCAGCTTCTCTGTGCAGGCGG + Exonic
1135823710 16:25707492-25707514 GAGCATATCCTCTGTAGATGAGG + Intronic
1136553003 16:30991420-30991442 GGGCAGCACCTCTGGGGAGGGGG + Exonic
1136751364 16:32638311-32638333 GAGCTGGGCCTCTGTGGAAGGGG + Intergenic
1137375655 16:47949716-47949738 AAACAGATCCTCTCTGGAGTTGG - Intergenic
1137447057 16:48538440-48538462 GGGGAGTTCCTCTGTGGTGGTGG - Intergenic
1140010392 16:71125983-71126005 CAGTGGATGCTCTGTGGAGGGGG + Intronic
1140087648 16:71810884-71810906 TAGCAGAACCCCAGTGGAGGAGG - Intergenic
1140720624 16:77768619-77768641 GAGCAGAACTTCTGTTCAGGAGG + Intergenic
1140913332 16:79473194-79473216 AGTCATATCCTCTGTGGAGGGGG + Intergenic
1142008602 16:87702228-87702250 TGGCAGAGCCACTGTGGAGGAGG - Intronic
1203053498 16_KI270728v1_random:897566-897588 GAGCTGGGCCTCTGTGGAAGGGG + Intergenic
1143317890 17:6046563-6046585 GAGCACATCCTCTGGGAAGAGGG + Intronic
1146770559 17:35565084-35565106 TGGCAAATACTCTGTGGAGGAGG - Intergenic
1147160573 17:38567394-38567416 AAGCATAGCCTCTTTGGAGGAGG - Intronic
1147455297 17:40534144-40534166 GGGCAGAGCGGCTGTGGAGGGGG + Intergenic
1148962764 17:51407182-51407204 GTGCAGGTCCTCAGTGCAGGTGG - Intergenic
1149460650 17:56827633-56827655 GCTGCGATCCTCTGTGGAGGTGG + Intronic
1149885737 17:60338382-60338404 GAGTAGATGTTCTGAGGAGGTGG + Intronic
1150604172 17:66676679-66676701 GATCAGATACCCTGAGGAGGAGG + Intronic
1151652023 17:75475983-75476005 TAGCACATCCTGTGTGGAGGGGG - Intronic
1154324471 18:13380039-13380061 GAGCAGAACCTCTACGGGGGTGG + Intronic
1157223119 18:45841143-45841165 CAGCAGATTCCCTGGGGAGGGGG + Intronic
1160389555 18:78519656-78519678 CAGCTGTTCCCCTGTGGAGGCGG - Intergenic
1162029342 19:7910633-7910655 GAGCAGAGCCTCTGGGGGGTGGG + Intronic
1164885038 19:31771277-31771299 AATCTGAGCCTCTGTGGAGGGGG - Intergenic
1164888126 19:31800702-31800724 TATGAGGTCCTCTGTGGAGGAGG - Intergenic
1165824492 19:38698099-38698121 GAGCAGGCACACTGTGGAGGGGG + Intronic
1165845141 19:38813138-38813160 GAGCACTTCCTCTTTGCAGGAGG - Exonic
1165909740 19:39218066-39218088 GAGGAGATCCCCTGCGAAGGTGG + Intergenic
1167013200 19:46822242-46822264 GGGTAGCTCCTCTGTGCAGGTGG - Intergenic
1167349159 19:48964042-48964064 GAGCAGCTCCTCTGTAGGGCAGG + Intergenic
925030266 2:645077-645099 GTGCACTTCCTCTGTGCAGGTGG - Intergenic
926198643 2:10778222-10778244 GGGCAGAGCCTCTGAGAAGGTGG + Intronic
926198981 2:10780040-10780062 GAGGAGCTCCTCAGTGCAGGCGG - Intronic
926297022 2:11576538-11576560 GAGCAGGTTGGCTGTGGAGGAGG + Intronic
926967694 2:18433221-18433243 CAGCAGATCCTCTAAGGACGTGG - Intergenic
927142613 2:20140405-20140427 GATCAGAGCCCCTGCGGAGGGGG + Intergenic
927216258 2:20669306-20669328 GAGCAAATCCCCAGTGGTGGGGG + Intronic
928215341 2:29356683-29356705 GAGCAGACCCACTGGGGTGGTGG + Intronic
928593840 2:32842214-32842236 GACCAGAACCTCTGGGGAGCGGG + Intergenic
929667685 2:43846041-43846063 GGACATATCCTCTGTGGAGAGGG + Intronic
929748500 2:44684757-44684779 GGATAGATCCTCTGGGGAGGAGG - Intronic
929783514 2:44972960-44972982 GAGGAGATCCCCTGAAGAGGAGG - Intergenic
929940918 2:46333458-46333480 CAGAAAAGCCTCTGTGGAGGTGG + Intronic
930725787 2:54680045-54680067 GAGCAAAACCCCTGTGGACGTGG + Intergenic
933444963 2:82368254-82368276 GATCAGGTACTCTCTGGAGGGGG + Intergenic
933784831 2:85830290-85830312 GAGCTGCTCCTCTGTGAAGCAGG + Intergenic
934297189 2:91752129-91752151 GAGCAGCATCTCCGTGGAGGTGG + Intergenic
934566214 2:95343032-95343054 GAGGAGAACCACAGTGGAGGTGG + Intronic
936284948 2:111174658-111174680 GAGCTGATGTTCAGTGGAGGTGG + Intergenic
938132110 2:128725404-128725426 GAGAAGAGCCTGTGTGTAGGAGG - Intergenic
938413719 2:131087127-131087149 GAGCAAAAATTCTGTGGAGGAGG + Intronic
941259213 2:163274838-163274860 GATGATATCCTCTGTGGAGCAGG + Intergenic
942457297 2:176147231-176147253 GTGCAGGTCCACTGGGGAGGGGG - Intergenic
943559747 2:189446665-189446687 GAACATATCCTCTGTGGACAAGG - Intronic
944959034 2:204848257-204848279 GAGCATATCCCCTGTGGATAAGG + Intronic
947578665 2:231297125-231297147 TAGCAGATCCTCTCTGGCAGGGG - Intronic
947702868 2:232249700-232249722 GAGCAGAGCCTGTTTAGAGGAGG + Intronic
947938256 2:234025879-234025901 GAGCAGATTCAATGGGGAGGAGG - Intergenic
948412514 2:237775095-237775117 GAGCACAGGCTCTATGGAGGCGG - Intronic
948509957 2:238457563-238457585 GAGCAGAGCCTTTGTGGGGATGG + Intergenic
948713039 2:239837013-239837035 GAGCAGCTCCTCTCTGCAGCTGG - Intergenic
948977400 2:241472036-241472058 GAGAAGACCCTGTTTGGAGGGGG + Intronic
1169411805 20:5377338-5377360 GAGCAGATCCTTTCTGGAGTGGG + Intergenic
1172169151 20:32918403-32918425 CAGCAGACCCTATGTGGAGCGGG + Intronic
1172292855 20:33788756-33788778 GAGCAGCTCCTCTAGGGAGGTGG - Intronic
1173217589 20:41100413-41100435 GAACATATCCCCTGTGGATGAGG - Intronic
1174458819 20:50668466-50668488 AATCAGATTCTCTGAGGAGGAGG - Intronic
1175247610 20:57591213-57591235 GAGCAGCTCTTCTGTGGGGCCGG + Intergenic
1175789695 20:61733473-61733495 GAGCAGAGGGTCTGTGGGGGAGG - Intronic
1178762092 21:35412736-35412758 GAGCAGATCCTCTGTGGAGGAGG + Intronic
1179282547 21:39946300-39946322 GAGCAGACTCTATGTGCAGGGGG + Intergenic
1179710808 21:43211946-43211968 CAGCACATCCTCTCTGGACGAGG - Intergenic
1179995724 21:44973280-44973302 GAGCTGAACCCCTGAGGAGGTGG - Intronic
1180191855 21:46169289-46169311 GTGAACATCCTCTGTGGATGGGG + Intronic
1180191917 21:46169560-46169582 GTGTACATCCTCTGTGGATGGGG + Intronic
1180191965 21:46169753-46169775 GTGAACATCCTCTGTGGATGGGG + Intronic
1180192013 21:46169946-46169968 GTGAACATCCTCTGTGGATGGGG + Intronic
1180192074 21:46170216-46170238 GTGAACATCCTCTGTGGATGGGG + Intronic
1180192116 21:46170412-46170434 GTGAACATCCTCTGTGGATGGGG + Intronic
1180192138 21:46170530-46170552 GTGAACATCCTCTGTGGATGTGG + Intronic
1180192153 21:46170608-46170630 GTGAACATCCTCTGTGGATGGGG + Intronic
1180192161 21:46170648-46170670 GTGAACATCCTCTGTGGATGGGG + Intronic
1180192170 21:46170688-46170710 GTGAACATCCTCTGTGGATGGGG + Intronic
1180192185 21:46170766-46170788 GTGAACATCCTCTGTGGATGGGG + Intronic
1180192211 21:46170885-46170907 GTGAACATCCTCTGTGGATGGGG + Intronic
1180192219 21:46170924-46170946 GTGAACATCCTCTGTGGATGGGG + Intronic
1180232535 21:46436002-46436024 GGGCAGAACCTAGGTGGAGGCGG - Exonic
1182529038 22:30941237-30941259 GGACAGATCAGCTGTGGAGGTGG - Intronic
1182899380 22:33885302-33885324 TAGCTGACCCTCTGCGGAGGGGG + Intronic
1183032197 22:35114720-35114742 GAGCACATCTTGGGTGGAGGCGG - Intergenic
1185334553 22:50265795-50265817 CACCAGATCCTATATGGAGGGGG - Intronic
952729114 3:36620496-36620518 GAGCAGAACCTCTGAGGACAGGG + Intergenic
952827585 3:37537146-37537168 GACCTGAACCTCTGAGGAGGGGG + Intronic
953052180 3:39354536-39354558 GAGAATGCCCTCTGTGGAGGGGG - Intergenic
953492466 3:43363245-43363267 GGGCAGAGCCTGTGTGGAAGCGG + Intronic
953960313 3:47261333-47261355 CAGCAGAGTCTCTCTGGAGGGGG + Intronic
955215215 3:56979595-56979617 GACCAGACCTTCTTTGGAGGGGG - Intronic
956702661 3:71972355-71972377 GAGCAGGTGGTCTATGGAGGTGG - Intergenic
956749516 3:72335082-72335104 AAGCATATTCTCTGTAGAGGGGG + Intergenic
958521073 3:95186212-95186234 GTGCAGAGCAGCTGTGGAGGAGG + Intergenic
960988508 3:123295720-123295742 GGGCAGGTCCTTTGTGGTGGGGG - Intronic
963287255 3:143445075-143445097 GGAGAGAGCCTCTGTGGAGGTGG - Intronic
964776446 3:160283858-160283880 GAATAGAACCTATGTGGAGGTGG - Intronic
965765132 3:172122607-172122629 GATCAGATCATCTGTTGAGAGGG + Intronic
967088574 3:186115759-186115781 CAGCAGAGCCTCAGCGGAGGTGG - Intronic
968453167 4:684493-684515 GAGCAGATCCTCTGTGCAAGCGG - Exonic
971450419 4:26795234-26795256 GAGCAGAGCCTTTGTAGAGCTGG - Intergenic
975822678 4:78287730-78287752 ATGCAGGTCCTATGTGGAGGAGG + Intronic
983527889 4:168778953-168778975 GAGCAGGACCTCTTTGGCGGAGG - Intronic
984850874 4:184151479-184151501 CAGGAGATCTTATGTGGAGGGGG + Intronic
987161793 5:15152412-15152434 GATGAGTTCCTCTGTGAAGGTGG + Intergenic
989490503 5:42047410-42047432 GAGCAAAGGCTCTGTGGGGGAGG + Intergenic
991093878 5:62719266-62719288 GAGCAATTGCTCAGTGGAGGTGG + Intergenic
991229671 5:64317660-64317682 GACCATATCCTCTGTGGATAAGG - Intronic
992332329 5:75730069-75730091 CAGCAGATCATCTGAGAAGGGGG - Intergenic
994298845 5:98121992-98122014 GAGCAGATGTGCTGTGCAGGGGG - Intergenic
995592119 5:113709951-113709973 GAGGAAATACTCTGTGAAGGTGG - Intergenic
996923807 5:128799819-128799841 GGGCAGCTCCTCTGTGCAGCTGG + Intronic
1000039429 5:157474155-157474177 GGGCAGCTCATCAGTGGAGGAGG - Exonic
1001090320 5:168735344-168735366 GAGCAGAGTCTCTGGGAAGGTGG - Intronic
1002931493 6:1637969-1637991 GAGAAGACCCTCAGGGGAGGTGG - Intronic
1004411688 6:15386937-15386959 GAGCAGATGGGCTTTGGAGGAGG + Intronic
1004743981 6:18491677-18491699 GAGCTGAGCCCCTGTGGAGGGGG - Intergenic
1005163919 6:22897445-22897467 GAGAAAATCACCTGTGGAGGTGG + Intergenic
1005243872 6:23859599-23859621 GAGCAGCTCCTCTGTGGAGGTGG + Intergenic
1005719955 6:28591247-28591269 GAGCAGCTGCTATGAGGAGGCGG + Intronic
1005806492 6:29478383-29478405 GAAAAGATCCGCTATGGAGGTGG + Intergenic
1005938890 6:30546194-30546216 GAGCAGCTCCTGTGAGGAGGAGG - Exonic
1006467078 6:34202370-34202392 GAGCAGCTCCTCTCTGCAGCTGG + Intergenic
1007119694 6:39369649-39369671 CAGCATGTTCTCTGTGGAGGAGG + Intronic
1007822785 6:44573206-44573228 GACCAGATCCACTATGGAGAAGG - Intergenic
1008688073 6:53946074-53946096 TGGCAGTTCCTCTGTGGGGGTGG - Intronic
1009838709 6:69039397-69039419 GAACATATCCTCTGTGGATAAGG + Intronic
1011547846 6:88500418-88500440 GAGCAGAACCTGTGTGAAGGAGG + Intergenic
1013074105 6:106755250-106755272 GAGGGGATCCTGGGTGGAGGTGG + Intergenic
1013638695 6:112052886-112052908 CACCAGATTCTCTGTGGTGGAGG + Intergenic
1016074253 6:139777434-139777456 GAGCAGAGACGCTGTGGGGGAGG + Intergenic
1019574565 7:1730255-1730277 GAACACATCCACTGGGGAGGGGG + Intronic
1019804791 7:3115772-3115794 GAGGAGGTCCTGAGTGGAGGAGG - Intergenic
1021021112 7:15599787-15599809 GGGCAGATCCTCTCTGCAGCTGG + Intergenic
1021662594 7:22935301-22935323 AAACAAATCCTCTGTGGAGGTGG - Intergenic
1022623039 7:32004614-32004636 GAGCAGAGCCTCTTTAGAGCAGG + Intronic
1023411708 7:39894591-39894613 GGGCAGGTCCTCTGGGGATGAGG + Intergenic
1023921511 7:44633697-44633719 GAGCAGATGCTTTGTGTAGCTGG + Intronic
1026015568 7:66668530-66668552 GAGAAGACCCTCTGGAGAGGGGG + Intronic
1026379251 7:69782720-69782742 GAGCAGATCCTCTATTGGGAAGG + Intronic
1026891980 7:73987694-73987716 GAGAAGACCCTCTGGGGAGTGGG + Intergenic
1027140646 7:75654666-75654688 GAGGAGATACTCGGAGGAGGAGG - Intronic
1028221375 7:88201010-88201032 TAGCATATGCTCTGTGGGGGAGG + Intronic
1028470560 7:91202077-91202099 GAGCAGTCCCGCTGTGCAGGTGG - Intronic
1030228255 7:107176596-107176618 GATCAGATCCTCTGGGGATGGGG + Intronic
1032132313 7:129240242-129240264 GAGAAGACTCTCTGTGGAGATGG - Intronic
1034690559 7:153010371-153010393 CAGCAGATCGCCTGTGCAGGGGG + Intergenic
1036396113 8:8372593-8372615 GAACAGTTCTTCTTTGGAGGAGG - Intronic
1036977306 8:13427999-13428021 GACAACATCCTCTGTGCAGGTGG + Intronic
1037957914 8:23072931-23072953 CAGCACAGCCTCTCTGGAGGAGG - Intergenic
1037962261 8:23106277-23106299 CAGCACAGCCTCTCTGGAGGAGG - Intronic
1038440970 8:27570553-27570575 GAGCAGATCCTCTGTGCAGATGG + Intergenic
1038446939 8:27611018-27611040 ATGCAGTCCCTCTGTGGAGGTGG - Intronic
1038707335 8:29907000-29907022 GAGCTGCTCCTCTTTGAAGGTGG - Intergenic
1039007473 8:33056017-33056039 GAACATATCCTCTGTGGATAAGG - Intergenic
1041263047 8:56038240-56038262 GGGCAGATCCAGTGAGGAGGAGG + Intergenic
1044625645 8:94233350-94233372 GAGCACAAACTCTGGGGAGGAGG - Intergenic
1047521501 8:125598690-125598712 GACCAGAACATTTGTGGAGGTGG - Intergenic
1049069405 8:140345206-140345228 GAGGAGGTCCTCTGTGTGGGTGG + Intronic
1049254972 8:141608898-141608920 GAGCACATCCTCTGAGCAGGTGG + Intergenic
1049393090 8:142382018-142382040 GGCCAGATGCTCGGTGGAGGAGG + Intronic
1050764924 9:9120623-9120645 AAGCAGATCATCTGGAGAGGAGG + Intronic
1051613191 9:18981465-18981487 GAGCAGATCCTCTGGGTAAGAGG + Intronic
1053184229 9:36001857-36001879 GAGCAGATCATCTTTGGATCTGG + Intergenic
1054979623 9:71189985-71190007 GAACAAATCCTCTGTTGATGTGG - Intronic
1055463258 9:76539168-76539190 CAGCACATCCTCTGGGAAGGGGG - Intergenic
1056515255 9:87343753-87343775 CAGCAGGTCCTCTGTGAATGGGG + Intergenic
1057082500 9:92183550-92183572 GAGGAGATGCTGTGTGGGGGGGG - Intergenic
1057484127 9:95468865-95468887 GAGCAGGTCCCTTGTGGAGCTGG + Exonic
1057570131 9:96198041-96198063 GAGCAGAGCCTCTCAGCAGGAGG - Intergenic
1060207048 9:121688280-121688302 CAGGAGGCCCTCTGTGGAGGTGG + Intronic
1061088758 9:128414653-128414675 GAGCACATGCTATGTGCAGGTGG - Intronic
1061208968 9:129179684-129179706 CAGAAGATCCCCTGAGGAGGCGG - Intergenic
1062004391 9:134231970-134231992 CAGCAGGGCCTCAGTGGAGGTGG + Intergenic
1062057335 9:134475384-134475406 GAGCAGATCCCCGGGGAAGGAGG + Intergenic
1062707724 9:137954472-137954494 AAGCAGCTGCTCTGTGGAGGGGG + Intronic
1186659893 X:11659228-11659250 GGACAGATCCTCAGAGGAGGTGG - Intronic
1189076073 X:37916114-37916136 GATCAGATCCTTTGAGAAGGAGG - Intronic
1189241079 X:39525122-39525144 GAACAGAAACTCTGTGAAGGAGG - Intergenic
1190633993 X:52416964-52416986 GAGCAGAGCCCCTGAGAAGGTGG + Intergenic
1190678730 X:52805670-52805692 GAGCAGAGCCCCTGAGAAGGTGG + Intergenic
1191779605 X:64850998-64851020 GGGCTGCTCCACTGTGGAGGAGG - Intergenic
1192634154 X:72802453-72802475 CACCAGCTGCTCTGTGGAGGGGG + Intronic
1192647556 X:72918348-72918370 CACCAGCTGCTCTGTGGAGGGGG - Intronic
1195108105 X:101619555-101619577 GAGGGGCTCCTGTGTGGAGGAGG + Intergenic
1195156747 X:102130924-102130946 GTGCAGAGCCTATGTGGAGAGGG - Intergenic
1198406231 X:136315386-136315408 GAGCAGATACTCACTTGAGGAGG - Intronic
1199599987 X:149536092-149536114 GAGCACCTCCTCTGTGGGAGAGG + Intergenic