ID: 1178763853

View in Genome Browser
Species Human (GRCh38)
Location 21:35430599-35430621
Sequence CAGGCAAATAAGTGTTAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178763847_1178763853 19 Left 1178763847 21:35430557-35430579 CCTGAGACTGTAGCTAACCTATT 0: 1
1: 0
2: 0
3: 3
4: 77
Right 1178763853 21:35430599-35430621 CAGGCAAATAAGTGTTAATCTGG 0: 1
1: 0
2: 0
3: 13
4: 141
1178763848_1178763853 2 Left 1178763848 21:35430574-35430596 CCTATTTTATTCTCTTACCAGAA 0: 1
1: 0
2: 2
3: 59
4: 548
Right 1178763853 21:35430599-35430621 CAGGCAAATAAGTGTTAATCTGG 0: 1
1: 0
2: 0
3: 13
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178763853 Original CRISPR CAGGCAAATAAGTGTTAATC TGG Intronic
902067712 1:13701592-13701614 TTGGCCAATAAGTGTTAGTCCGG - Intronic
907553690 1:55326412-55326434 CAGAGAAATAAGTTTCAATCTGG - Intergenic
910328697 1:86042732-86042754 CAGGGAAATAAGTGATCATTTGG + Intronic
912762420 1:112380895-112380917 CAGGAAAATAGATGTTAATTGGG - Intergenic
913591391 1:120330907-120330929 CAGGCATATAAATTTGAATCAGG - Intergenic
914169135 1:145204877-145204899 CAGGCATATAAATTTGAATCAGG - Intergenic
914599421 1:149187038-149187060 CAGGCATATAAATTTGAATCAGG + Intergenic
916819317 1:168382798-168382820 CAGGCAGATAAGTGCTAATAAGG + Intergenic
918219539 1:182424100-182424122 CATGCACAAAAGTGTCAATCTGG - Intergenic
918500101 1:185184958-185184980 CACCCAAACAAGTATTAATCAGG - Intronic
919467417 1:197939111-197939133 ACTGCAAATAAGTGATAATCAGG - Intergenic
923004249 1:230033035-230033057 CAGGTATATAAGTGTGTATCTGG - Intergenic
1065268830 10:24005564-24005586 CAGGAAAATAATTTTAAATCTGG + Intronic
1066329911 10:34409738-34409760 AAGAAAAATAAGTGTTACTCTGG - Intronic
1066674070 10:37870208-37870230 CAGGCAAATAAATGTGAAGTTGG - Intergenic
1071153946 10:82668136-82668158 CAGGCAAATAAAAGTTAAAAAGG - Intronic
1071867285 10:89748512-89748534 CAGCTAAATAAGTAATAATCTGG - Intronic
1074238853 10:111615582-111615604 TAGGCAAATAAGTTTTAAACTGG + Intergenic
1075271406 10:121054749-121054771 CAGGCAACGAAGGGTGAATCTGG + Intergenic
1080183908 11:29456498-29456520 CAGGCAACAAAGTGCTATTCTGG - Intergenic
1081514533 11:43813167-43813189 CAAGCAGAGAAGTGTTATTCTGG - Intronic
1082739076 11:56890417-56890439 CAGGCAAAGAAGTGAGAAGCTGG + Intergenic
1084004395 11:66315383-66315405 CAGGCAAATGAGTGGTGGTCTGG + Exonic
1085948655 11:81303331-81303353 CAGTTAAATAACTATTAATCTGG + Intergenic
1086751621 11:90502056-90502078 GAGGCAAGTAAGAGTTAATCAGG - Intergenic
1088757649 11:112899503-112899525 CAGGCAAGTCAGTGTGAAGCCGG + Intergenic
1090986313 11:131769469-131769491 AAGGAAAATAAGTGTTCATGAGG + Intronic
1091822846 12:3489641-3489663 TAGGAAAATAAATGTGAATCTGG - Intronic
1094726951 12:33129715-33129737 AAAGCAAATATGTGTTCATCTGG + Intergenic
1095581420 12:43805394-43805416 CATACAATTAAGTGTTCATCTGG + Intronic
1095887297 12:47202542-47202564 CAGGCAAATATCTGGGAATCAGG - Intronic
1096217021 12:49803452-49803474 CAGGGAAATAAGGGTTACTGTGG - Intronic
1098480221 12:70949298-70949320 CAGGCAAATTGGTGTCAATTTGG + Intergenic
1112746398 13:102531970-102531992 CAGGCAAATAAATACTAATTGGG + Intergenic
1112762648 13:102708879-102708901 CAGGCAAAAAAGGGTGAATTTGG - Intergenic
1113109736 13:106810245-106810267 CAGGCACAACAGAGTTAATCTGG - Intergenic
1114921270 14:27333093-27333115 TAGGCAAATAATTATTGATCAGG + Intergenic
1115392079 14:32865461-32865483 CAGCCAAAGCAGTGTTAATCAGG - Intergenic
1115667545 14:35569686-35569708 AGGACAAATAAGAGTTAATCAGG - Intronic
1116909356 14:50442900-50442922 TACGCAAATAAGAGTTAATTTGG - Intronic
1117764564 14:59067594-59067616 CAGGAAAATACGTGTTTATTTGG - Intergenic
1121365258 14:93303214-93303236 CAGGAAAGTAAGTGTTAATAAGG + Intronic
1124238225 15:28007774-28007796 CAGGCAAGAAAGTGCCAATCAGG + Intronic
1131676180 15:94673057-94673079 CAGGCTATTAAGTGATAATATGG - Intergenic
1138991542 16:62396098-62396120 AGGGTAAATAGGTGTTAATCAGG + Intergenic
1140828400 16:78728473-78728495 CAGGAAAAGAAGTGAGAATCTGG - Intronic
1143633902 17:8153567-8153589 CAGGCAATAAAATGTTAGTCTGG + Intronic
1146210809 17:30941754-30941776 AAGACAAATAAGTGGTTATCTGG + Intronic
1149475065 17:56953920-56953942 CAAGGAAATAATTCTTAATCTGG + Intronic
1150500821 17:65649414-65649436 CAGGAAAATAAGTGTGCATGAGG + Intronic
1150588039 17:66535980-66536002 CAGGCAAATAATTAATAATCAGG - Intronic
1153859898 18:9191942-9191964 CAGGAAAAAAAGTGTGAAGCAGG - Intronic
1154509797 18:15085596-15085618 CAGGGAAATTAGTGTTAAACTGG + Intergenic
1156013383 18:32520414-32520436 CAGTGAACTAAATGTTAATCTGG + Intergenic
1158644418 18:59231987-59232009 CAGCCAAACAAGTGATAGTCTGG - Intergenic
1162234013 19:9291635-9291657 CAGGCAAATAATTCTTAAACAGG + Intergenic
1165338569 19:35193276-35193298 AAAGAAAATAAGTGTCAATCTGG - Intergenic
926345860 2:11944311-11944333 CAGGGAAGAAAGTTTTAATCGGG + Intergenic
926897073 2:17704175-17704197 CAGGAGCATAAGAGTTAATCTGG + Intronic
927279651 2:21293059-21293081 CAGGCAAAAATGTGTGAATCAGG - Intergenic
930944248 2:57052423-57052445 CAGACAAATAAGAGGTCATCAGG + Intergenic
934922622 2:98358231-98358253 CAGGGAAATAATTGTTTATTCGG + Intronic
935099997 2:99984966-99984988 CAGGCAAAAATGAGTAAATCAGG + Intronic
937708039 2:124944089-124944111 CAAGCATATAAGTGTTCGTCTGG + Intergenic
938750569 2:134325222-134325244 CAGTCAAAGAAGTGTTGATTTGG - Intronic
939352601 2:141059206-141059228 CAGAAAAAAAAGTTTTAATCAGG - Intronic
943632700 2:190272170-190272192 CAGGCAAATATGGGGTAGTCTGG - Intronic
944157184 2:196619769-196619791 CAGGGAAATATGTGGTAACCAGG + Intergenic
944736054 2:202566979-202567001 CAAGCAATTCAGTGTTAAACTGG - Exonic
944923378 2:204438205-204438227 AAGGCAAATAAGTGCCACTCTGG + Intergenic
1169879865 20:10335084-10335106 CAGGCAAAAAAGAGTTAAGTAGG - Intergenic
1170249495 20:14264527-14264549 CAGGGAATTAAGTGATCATCTGG + Intronic
1173595350 20:44255599-44255621 CCAGCAAATAAGTGTAAAGCTGG + Intronic
1175298469 20:57926025-57926047 TAGGCAAATAATTCTTAAGCAGG - Intergenic
1177987419 21:27994388-27994410 CAGGGAAATTAGTGTTAAACTGG - Intergenic
1178309894 21:31521129-31521151 GAGGCAATTAAGAGTAAATCTGG - Intronic
1178763853 21:35430599-35430621 CAGGCAAATAAGTGTTAATCTGG + Intronic
951337249 3:21438874-21438896 CAGGCAAATAAAAACTAATCAGG - Intronic
955553645 3:60111923-60111945 GAGGCAAAAAAGGGCTAATCTGG - Intronic
959536579 3:107493171-107493193 CAGGTAATTAAGTGTGAATTTGG - Intergenic
960509690 3:118534094-118534116 GAGGAAAATAAATGTTAACCGGG + Intergenic
963135365 3:141898591-141898613 CAGTAAAAGAAGTGTTAATGAGG + Intronic
969873653 4:10120202-10120224 AAGGCAAATTAGTCTTATTCTGG - Intergenic
970045932 4:11853622-11853644 CAGGAAAATTATTGTTTATCTGG + Intergenic
971457209 4:26856624-26856646 AAGACAAATAAGTGTTGATGAGG - Intergenic
971987610 4:33846485-33846507 CAGGCATAAAAGTATTAATTTGG + Intergenic
977249890 4:94678003-94678025 GATGCAAATAAGTGTTACTCTGG + Intergenic
978265571 4:106820404-106820426 AAGACATACAAGTGTTAATCAGG - Intergenic
979772040 4:124538401-124538423 CAGGGAAATAAGGGTTAAAATGG - Intergenic
981244509 4:142518307-142518329 CATGCCAATAACTGTCAATCAGG - Intronic
981707712 4:147679044-147679066 CAGGCAAAAAAGGGTGAATTTGG - Intronic
986756361 5:10840060-10840082 CAGGAACATCAGTGATAATCTGG + Intergenic
986773065 5:10990752-10990774 CACGCAAACAAGTGTTTATTAGG + Intronic
987691938 5:21278521-21278543 CATGCAAATAAATTTTAAGCAGG - Intergenic
989029389 5:37102559-37102581 CAGGTAAAGCAGTGTTAATGGGG - Intergenic
991748448 5:69771573-69771595 CATGCAAATAAATTTTAAGCAGG + Intergenic
991800028 5:70351418-70351440 CATGCAAATAAATTTTAAGCAGG + Intergenic
991828572 5:70658621-70658643 CATGCAAATAAATTTTAAGCAGG - Intergenic
991892383 5:71350849-71350871 CATGCAAATAAATTTTAAGCAGG + Intergenic
992564751 5:77986213-77986235 CACACCAATAAGTGTCAATCCGG - Intergenic
994156803 5:96513100-96513122 CAGCCGAATGAGTGATAATCAGG - Intergenic
995782624 5:115794517-115794539 CAGGAACATCAGTGTTAATGGGG + Intergenic
995937961 5:117540671-117540693 CAGACAAATAATTCTTAAACTGG - Intergenic
996153806 5:120073262-120073284 CAGGAAAATAAGTGGTATTTGGG + Intergenic
996333851 5:122362026-122362048 CAGGCAAATCAGTGATGATTAGG - Intronic
996655639 5:125931954-125931976 CAGCCAAATAAGTGTCCATAGGG + Intergenic
996986825 5:129577444-129577466 CATACAAATAAGGGATAATCCGG + Intronic
999549424 5:152669899-152669921 TAGGCAAATAATTGTCAAACAGG + Intergenic
999987469 5:157017542-157017564 AAAGCAAAAAAGTGTGAATCTGG + Intergenic
1003419545 6:5944153-5944175 TAGGCAAATAAGTATTAGTTTGG + Intergenic
1005391187 6:25335039-25335061 CATGCAAATAAGAGCTAGTCTGG + Intronic
1007741086 6:44009789-44009811 CATGCAAAGAAGGGTTAAACTGG + Intergenic
1007917236 6:45572918-45572940 CAGGGAAAGCAGTGTTCATCTGG + Intronic
1009330421 6:62412661-62412683 CAGATAAATCAGTGTTAAGCAGG + Intergenic
1011085074 6:83530861-83530883 AAGGAAAATGAGTGTTAATTAGG - Intergenic
1013070661 6:106726182-106726204 CAGGCAAAGATTTCTTAATCAGG + Intergenic
1013344233 6:109244479-109244501 CAGAAAAATAAGTTTTAATTAGG + Intergenic
1014869156 6:126569818-126569840 CAGGCAAAGAAGTTTTAAAAAGG - Intergenic
1016220119 6:141657658-141657680 CAGGCAATTAAATATTAATAAGG + Intergenic
1021015615 7:15527545-15527567 CAAGCCAACAAGTGTTGATCTGG + Intronic
1021498283 7:21300765-21300787 CAGTTAAATAAGTGATCATCTGG + Intergenic
1021543185 7:21783321-21783343 CAGCAAAATAATGGTTAATCAGG + Intronic
1022276654 7:28861944-28861966 CAAGCAAGTAAGTGTTACTAAGG + Intergenic
1024500008 7:50094811-50094833 CAGGCACATAATCGTTAATCAGG - Intronic
1027990917 7:85360140-85360162 CAGGCAAATATGTGAAAATTTGG + Intergenic
1028775098 7:94666837-94666859 CAGGCATAGGAGTGTGAATCTGG - Exonic
1030088789 7:105839465-105839487 CAGGCTCATATGTGCTAATCAGG - Intronic
1031403056 7:121348269-121348291 CAGGAAAATAAGTGGTATTTGGG - Intergenic
1032375124 7:131406753-131406775 CAAGAAAGTAAGTGTCAATCTGG - Intronic
1032472713 7:132190015-132190037 CAGGCAAATATGCATTGATCTGG - Intronic
1034933030 7:155178669-155178691 CAGGCAAATATTTCTTAAGCAGG + Intergenic
1037781087 8:21869561-21869583 TAGGCAAAGAAGAGTTCATCAGG + Intergenic
1040476713 8:47784532-47784554 GAGGAAAAAAAGTTTTAATCTGG - Intronic
1041921759 8:63189675-63189697 AAGTCACATAAGTGTTAATTGGG + Intronic
1043109944 8:76168398-76168420 GAGGAATATAAGAGTTAATCTGG + Intergenic
1047846636 8:128813365-128813387 CAGGAAACTAAATGTTAAGCAGG + Intergenic
1048413408 8:134199415-134199437 CAGGCAGAGAAGGGTTAATTGGG + Intergenic
1050161202 9:2719973-2719995 CCTGGAAATAAATGTTAATCAGG + Intronic
1050793801 9:9510183-9510205 AAGCCAAATAAGTGTTGATGAGG - Intronic
1051130829 9:13858421-13858443 AAGTCAAATAAATGTTAATTAGG - Intergenic
1051210874 9:14741714-14741736 CAGGGAATTAAGGGGTAATCAGG - Intronic
1052669409 9:31536636-31536658 CAGGCAAATATGCCTTAATACGG + Intergenic
1052759330 9:32573473-32573495 CAAGCAAATAATTTTGAATCTGG - Intergenic
1056234705 9:84583036-84583058 TAGGCATATAAGTGTTCATCTGG + Intergenic
1056802705 9:89704243-89704265 CAGGCAAACATTTCTTAATCAGG + Intergenic
1059483215 9:114608289-114608311 AAGGCAGATAACTGCTAATCTGG - Intergenic
1059920318 9:119153156-119153178 CAGGCACATAAGTGATAAAATGG + Intergenic
1190597790 X:52064731-52064753 CAGGCAAATAGCTGCTAAACAGG - Intronic
1190611034 X:52189342-52189364 CAGGCAAATAGCTGCTAAACAGG + Intronic
1194322491 X:92467529-92467551 CAGCCAAATATGTATTGATCTGG - Intronic
1194334586 X:92629762-92629784 CAGGCAAATAACTGCTAAAGTGG - Intergenic
1198937461 X:141913511-141913533 AAAGCAAATATGTGTTCATCAGG - Intergenic
1198961591 X:142189354-142189376 AAAGCAAATATGTGTTCATCAGG + Intergenic
1199125884 X:144119654-144119676 CAGCCAAATGAGTGATAATGAGG - Intergenic
1200643066 Y:5746816-5746838 CAGGCAAATAACTGCTAAAGTGG - Intergenic