ID: 1178765957

View in Genome Browser
Species Human (GRCh38)
Location 21:35451042-35451064
Sequence GCCTCTGGACCTGTAGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2097
Summary {0: 1, 1: 2, 2: 112, 3: 704, 4: 1278}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178765949_1178765957 2 Left 1178765949 21:35451017-35451039 CCACAAAACCATTCTTTCCTCCT 0: 13
1: 271
2: 720
3: 1257
4: 2181
Right 1178765957 21:35451042-35451064 GCCTCTGGACCTGTAGTGGGAGG 0: 1
1: 2
2: 112
3: 704
4: 1278
1178765951_1178765957 -6 Left 1178765951 21:35451025-35451047 CCATTCTTTCCTCCTAGGCCTCT 0: 42
1: 303
2: 869
3: 1519
4: 2019
Right 1178765957 21:35451042-35451064 GCCTCTGGACCTGTAGTGGGAGG 0: 1
1: 2
2: 112
3: 704
4: 1278
1178765948_1178765957 3 Left 1178765948 21:35451016-35451038 CCCACAAAACCATTCTTTCCTCC 0: 11
1: 245
2: 700
3: 1221
4: 1971
Right 1178765957 21:35451042-35451064 GCCTCTGGACCTGTAGTGGGAGG 0: 1
1: 2
2: 112
3: 704
4: 1278
1178765947_1178765957 24 Left 1178765947 21:35450995-35451017 CCATTCGCGTCTCAGGCTTGGCC 0: 1
1: 0
2: 0
3: 7
4: 73
Right 1178765957 21:35451042-35451064 GCCTCTGGACCTGTAGTGGGAGG 0: 1
1: 2
2: 112
3: 704
4: 1278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178765957 Original CRISPR GCCTCTGGACCTGTAGTGGG AGG Intronic
Too many off-targets to display for this crispr