ID: 1178767604

View in Genome Browser
Species Human (GRCh38)
Location 21:35469002-35469024
Sequence CACCAGTGTGTGCATCGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 97}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178767604 Original CRISPR CACCAGTGTGTGCATCGGCA GGG Intronic
900557878 1:3289179-3289201 CACCAGTGTGGCCACGGGCAAGG + Intronic
902216247 1:14936087-14936109 CTCCAGTGTGTGGAAAGGCAGGG + Intronic
903260990 1:22131852-22131874 CACCAGTCTGTGCATCCCCTGGG - Intronic
905448392 1:38042359-38042381 CACCAGTGTGGGGAACGGCTGGG + Intergenic
905926006 1:41750440-41750462 CTCCAGTGTGTGCATCATCTGGG + Intronic
907868736 1:58423809-58423831 AACCCCTGAGTGCATCGGCATGG + Intronic
911976739 1:104507365-104507387 CACCATTCTGTGCAGCGGCCTGG - Intergenic
912132249 1:106618019-106618041 CAACAGTGTATCCATCTGCAGGG + Intergenic
912719657 1:112009097-112009119 TACCAGTGTGGGGACCGGCACGG - Intergenic
915978439 1:160405687-160405709 CAGCTGTGTGTGGAGCGGCAGGG - Intronic
919496667 1:198280403-198280425 CACACGTGTGTGCATGAGCAGGG - Intronic
1067390876 10:45862408-45862430 CATCAGTGTGTGCACAAGCATGG - Intergenic
1067872404 10:49973698-49973720 CATCAGTGTGTGCACAAGCATGG + Intronic
1068457065 10:57269799-57269821 AAACAGTGTGTGAATAGGCAAGG + Intergenic
1069870574 10:71530346-71530368 CCCCACTGTGGGCACCGGCAGGG - Intronic
1070138061 10:73712626-73712648 CATCAGTGTGTGCACAAGCATGG - Intergenic
1073512288 10:104050339-104050361 CACCAATTTGTGCAACAGCAGGG - Intronic
1075279023 10:121122810-121122832 CACAGGTGTGTGCAACAGCACGG + Intergenic
1075781819 10:125022190-125022212 CGCATGTGTGTGCACCGGCAGGG - Intronic
1076259625 10:129055133-129055155 CACCAGTGAGTGCAGGGGAAGGG - Intergenic
1077608150 11:3626166-3626188 CAGCAGTGTCTGCATCAGCAAGG + Intergenic
1077919776 11:6633427-6633449 CACCAGTGTGGGCATAGTCCAGG - Exonic
1079312513 11:19379030-19379052 CCCCAGTGTGTGCAGGGGCAGGG + Intronic
1085295834 11:75431152-75431174 ACCCAGTGTGTGCATGTGCAGGG + Intergenic
1091166332 11:133479648-133479670 CAACAGTGTGAGCAGTGGCAGGG - Intronic
1091406577 12:213233-213255 CACCAGTGTGTGTATGGGAATGG - Intronic
1091617043 12:2057552-2057574 CTCCAGTGTGTGCGGCGGCACGG - Intronic
1092953706 12:13530544-13530566 AACCAGTGGGTGCATCCACATGG - Intergenic
1097186692 12:57199995-57200017 CACCTGTGTGTCCAACTGCACGG + Exonic
1101843044 12:108341667-108341689 CACTATTCTGTGCATTGGCAAGG - Intergenic
1102420729 12:112800864-112800886 CAGCAGTGTGTGCAGAGTCAAGG + Intronic
1104257775 12:127154956-127154978 CACCACTGGGTGGATAGGCAAGG - Intergenic
1106130636 13:26936454-26936476 CACCAGTGTGCCCAGGGGCATGG + Intergenic
1107886643 13:44879182-44879204 GACCAGTGTGCACATAGGCAAGG + Intergenic
1110967162 13:81713805-81713827 CACCAGTGTGTGAGTTTGCAGGG - Intergenic
1121022377 14:90588175-90588197 CACCAGAGGTTGCATCAGCAGGG - Intronic
1123776839 15:23588929-23588951 CAAGGGTGTGTGCATCCGCAGGG - Intronic
1132815763 16:1825968-1825990 CGGGACTGTGTGCATCGGCAGGG - Intronic
1133994757 16:10740035-10740057 CACCAGCCTGTGCATTGGCCAGG + Intergenic
1134667769 16:16031628-16031650 CAGCAGTGTGTGCAAAGGCCCGG - Intronic
1136479442 16:30532623-30532645 CACCAATGGGTCCATCGGCCCGG - Exonic
1136483153 16:30555318-30555340 CACCAGTGGGTTCATCGGCCCGG - Exonic
1138135280 16:54516013-54516035 CAGCAGTGTGTGGATCTACAGGG + Intergenic
1138532649 16:57643218-57643240 GACCAGTGTGTGCAAAGGCTTGG + Intronic
1141441565 16:84032849-84032871 CACATGTGCGTGCATGGGCACGG + Intronic
1141621045 16:85236565-85236587 GAACAGTGTGTGCATAGGCCTGG + Intergenic
1142033588 16:87850497-87850519 CACCAGAGCGTGCATCCGCCGGG + Intronic
1143264585 17:5626546-5626568 CAAGAGTGTGAGCATAGGCAGGG - Intergenic
1145817966 17:27809053-27809075 GAACAGTGTGTGCAAAGGCATGG - Intronic
1147160725 17:38568105-38568127 CACCGGGGTGCGCATCTGCACGG - Intronic
1152626195 17:81388914-81388936 CACCAGTGTGAGAATAGGCCTGG + Intergenic
1153452195 18:5241859-5241881 CAACAGTGTGAGCATCGCCTAGG - Intergenic
1154172137 18:12060142-12060164 CACCAGGGCTTGCATCTGCATGG + Intergenic
1165146886 19:33736494-33736516 CACCAGAGAGTGCCTCGGAAGGG - Intronic
1165170198 19:33887068-33887090 CACCTGTGTGTGCCTAAGCAGGG - Intergenic
1167006428 19:46779022-46779044 CAGCAATGTGTGCTTCAGCATGG + Intronic
936055862 2:109261506-109261528 CACCTGTGTGTGCAGCAGCCAGG + Intronic
940219203 2:151334278-151334300 CACCATTGTTTTCATAGGCAGGG + Intergenic
945681154 2:212916124-212916146 CACCATTGTGTTCAGCAGCAGGG - Intergenic
947896297 2:233676262-233676284 CACCCCTGTGTGCATCCACAGGG + Intronic
1170353655 20:15469513-15469535 CCCCAGTGTGTCCTTAGGCAGGG + Intronic
1170438657 20:16355524-16355546 CACCAGTGTGTGCATGCATAAGG - Intronic
1174409124 20:50322176-50322198 CACCAGCCTGTGCTGCGGCAGGG - Intergenic
1175320592 20:58085031-58085053 CACCAGGGTGGGCACCAGCAGGG - Intergenic
1175776734 20:61658594-61658616 CACCAGTGTGGCCCTGGGCAGGG + Intronic
1177269283 21:18825001-18825023 CACCAGCCTTTGCATCAGCAAGG - Intergenic
1178430527 21:32514845-32514867 GTCCAGTGTCTGCATCGGCCTGG + Exonic
1178767604 21:35469002-35469024 CACCAGTGTGTGCATCGGCAGGG + Intronic
1183415335 22:37678564-37678586 CACCATCGTGTGCAACAGCAAGG + Exonic
1184952799 22:47856402-47856424 CAGGGGCGTGTGCATCGGCAGGG + Intergenic
951694628 3:25433496-25433518 CACCTGTGTGTGCGTGGACAGGG + Intronic
955663042 3:61321765-61321787 CAGCAGTGTGTGCTGGGGCAGGG + Intergenic
968107241 3:196009673-196009695 GCCCAGTGTGTGCACCGCCAGGG - Intergenic
969463311 4:7340286-7340308 CCCCACTGTGTGCAATGGCATGG - Intronic
978390673 4:108222291-108222313 CACCAGGCTGTGCCTAGGCATGG + Intergenic
978940844 4:114434630-114434652 CATCTGTGTGTGCATTTGCATGG + Intergenic
986174774 5:5342459-5342481 CACCATTGTGTCCACCAGCAGGG + Intergenic
990381338 5:55224034-55224056 TACCAGTGTGGGAAGCGGCAGGG + Intronic
992945020 5:81801569-81801591 CAACAGTGTGGGCACAGGCAGGG + Intergenic
996315794 5:122159343-122159365 CACCAGTGTGTGCAGAAGGAAGG + Intronic
997758813 5:136424926-136424948 CACCAATGTGTGCATAGCCAAGG - Intergenic
998769962 5:145531628-145531650 CTGCAGACTGTGCATCGGCAAGG + Intronic
1001596922 5:172904522-172904544 CACCAGTGTGGGCAGTGGGAAGG - Intronic
1004405447 6:15328892-15328914 CACCTGTGTGGGGATGGGCATGG + Intronic
1005361922 6:25038960-25038982 TACCAATGTCTGCATGGGCATGG + Intronic
1006644271 6:35505495-35505517 CAGCAGTGTGGGCATCGCCTGGG + Intronic
1008505465 6:52225632-52225654 GCACAGTGTGTGCATGGGCACGG - Intergenic
1010655068 6:78502699-78502721 CACCAGTGTGCACATGTGCAGGG - Intergenic
1013368755 6:109453424-109453446 TACCAGTGTGTGCCTGGTCAGGG + Intronic
1013468460 6:110438803-110438825 CACCTTCGTGTGCATCGCCATGG - Exonic
1015736186 6:136402500-136402522 CACCACTGTGTGCAGTGACAGGG - Intronic
1017797007 6:157854069-157854091 CACCAGTGTGTGTATTTACAAGG - Intronic
1020009665 7:4801174-4801196 CATGGGTGTGTGCATCTGCATGG - Intronic
1021097095 7:16547261-16547283 CACCAGTGGGTGACTCGGCCTGG - Intronic
1027532948 7:79358201-79358223 CACCTGTGTGTGCAGGGGTAGGG - Intronic
1035458263 7:159023516-159023538 CAGCAGTGTCTGCATCGGGTGGG - Intergenic
1035458314 7:159023711-159023733 CAGCAGTGTCTGCATCGGGTGGG - Intergenic
1039986083 8:42449188-42449210 CCCCAGTATGTCCATCCGCAGGG - Intronic
1044803752 8:95983669-95983691 CAACAGTGTGTGCATGACCAAGG + Intergenic
1049251885 8:141593582-141593604 GACCAGTGTCTGCACAGGCAAGG + Intergenic
1189528902 X:41857777-41857799 CAGCAGTGTGTGTATGGACATGG - Intronic
1196982615 X:121231818-121231840 CACCAGTGTGACCACAGGCACGG - Intergenic
1197262619 X:124334056-124334078 CACCAGGGTGTGCATCCTCCGGG - Intronic
1201556344 Y:15267537-15267559 CACCACTGTGGGCTTCTGCATGG + Intergenic