ID: 1178767870

View in Genome Browser
Species Human (GRCh38)
Location 21:35471407-35471429
Sequence GCTTGATATTGACCTGGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 135}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178767862_1178767870 8 Left 1178767862 21:35471376-35471398 CCAGGGTTCCTCAATCTTCCCCA 0: 1
1: 0
2: 2
3: 13
4: 237
Right 1178767870 21:35471407-35471429 GCTTGATATTGACCTGGGAAAGG 0: 1
1: 0
2: 0
3: 23
4: 135
1178767863_1178767870 0 Left 1178767863 21:35471384-35471406 CCTCAATCTTCCCCAATTCCTGA 0: 1
1: 0
2: 2
3: 33
4: 338
Right 1178767870 21:35471407-35471429 GCTTGATATTGACCTGGGAAAGG 0: 1
1: 0
2: 0
3: 23
4: 135
1178767859_1178767870 27 Left 1178767859 21:35471357-35471379 CCTCAGTCAAATGAGCTTTCCAG 0: 1
1: 0
2: 1
3: 16
4: 152
Right 1178767870 21:35471407-35471429 GCTTGATATTGACCTGGGAAAGG 0: 1
1: 0
2: 0
3: 23
4: 135
1178767864_1178767870 -10 Left 1178767864 21:35471394-35471416 CCCCAATTCCTGAGCTTGATATT 0: 1
1: 0
2: 2
3: 281
4: 6456
Right 1178767870 21:35471407-35471429 GCTTGATATTGACCTGGGAAAGG 0: 1
1: 0
2: 0
3: 23
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178767870 Original CRISPR GCTTGATATTGACCTGGGAA AGG Intronic
906564802 1:46791305-46791327 GAATGAAATTAACCTGGGAAGGG - Intronic
906790811 1:48657311-48657333 GCTTGCTGTAGACATGGGAATGG + Intronic
907138548 1:52162585-52162607 TCTTGATATGGACCTTTGAATGG - Intronic
907380690 1:54085074-54085096 CCTTTCTATGGACCTGGGAAAGG - Intronic
908588104 1:65596534-65596556 ACTTGATATTGAAGTGGAAATGG - Exonic
908808134 1:67951890-67951912 GCTAGATATGGAGCTGGGGATGG - Intergenic
909456203 1:75852382-75852404 TCTTGATATATACCTAGGAATGG + Intronic
912943262 1:114063519-114063541 GCTAAATATTGGCCAGGGAAAGG - Intergenic
913591650 1:120334462-120334484 GCTAAATATTGACATGGGATGGG + Intergenic
913651710 1:120920687-120920709 GCTAAATATTGACATGGGATGGG - Intergenic
914169395 1:145208378-145208400 GCTAAATATTGACATGGGATGGG + Intergenic
914524512 1:148452342-148452364 GCTAAATATTGACATGGGATGGG + Intergenic
914599156 1:149183488-149183510 GCTAAATATTGACATGGGATGGG - Intergenic
914641891 1:149614798-149614820 GCTAAATATTGACATGGGATGGG - Intergenic
915696302 1:157746050-157746072 GCTTGATATTGGTCTAGGAGGGG - Exonic
916381286 1:164214695-164214717 GCTGGATATAAACCTTGGAACGG - Intergenic
918641908 1:186851495-186851517 GCTGGATTCTGACTTGGGAACGG + Intronic
923638663 1:235727745-235727767 ACTTGATAGTGAACTGGGAGTGG + Intronic
924478355 1:244402386-244402408 GATTGCCATTGACCTGGAAAGGG + Intergenic
1063135191 10:3210156-3210178 GCTTGATTTTGAGCTGGAACAGG - Intergenic
1063198911 10:3768669-3768691 GCTTGCTGTGAACCTGGGAATGG - Intergenic
1063279601 10:4612509-4612531 TCTTAATATCTACCTGGGAATGG + Intergenic
1063563263 10:7148981-7149003 GCTTGATCATGAGCTGGAAATGG + Intergenic
1064721939 10:18237663-18237685 ACTTGATCTTGACGTTGGAATGG + Intronic
1066623880 10:37385912-37385934 GCTTGGTCTTGAGCTGGGGAGGG - Intergenic
1067221444 10:44347032-44347054 GCTTCATGCTGACCTGGGAGGGG - Intergenic
1068204116 10:53826394-53826416 TCATGAAATTGACCTGGTAATGG - Intronic
1069558830 10:69415429-69415451 GCTTGATCTTGCCCTGAGATGGG - Intronic
1070531501 10:77341524-77341546 GCTTTCTCTTGACCTGGGAGAGG - Intronic
1075518930 10:123132469-123132491 GCCTGAGATTAGCCTGGGAAAGG + Intergenic
1077183300 11:1225859-1225881 GCTGGGTATTGTCCTGGGCAGGG - Intronic
1079031154 11:16987333-16987355 CCTTGACTTTGACCTCGGAAAGG + Intronic
1083096867 11:60259933-60259955 GTTTGACATTCACTTGGGAAAGG + Intergenic
1084972444 11:72779203-72779225 GCCTGACTGTGACCTGGGAAAGG - Intronic
1085069353 11:73528754-73528776 CCTGGATGATGACCTGGGAAAGG + Intronic
1086559842 11:88154867-88154889 GCTGGATATTTGCCTGGGCATGG - Intronic
1089208282 11:116782978-116783000 GCTAGAATTTGAACTGGGAATGG - Exonic
1090417185 11:126548591-126548613 GTTGGAAATTGACATGGGAAAGG - Intronic
1095400916 12:41814045-41814067 CCTGGAGATTGGCCTGGGAATGG + Intergenic
1097197063 12:57248792-57248814 ACTTGTTGTTGACTTGGGAAAGG + Exonic
1097822612 12:64143319-64143341 GCTTGAACTTAACCTGGGAAAGG + Exonic
1097827285 12:64187189-64187211 GCTTGACATTGATCTAGGAAAGG - Intronic
1097890006 12:64768538-64768560 GTTTGATATTAGCCTGGGCAAGG - Intergenic
1099068717 12:78017992-78018014 GCTTTATATTCACATGGAAATGG - Intronic
1102103265 12:110298100-110298122 CTTTTATATTGACTTGGGAAGGG + Intronic
1102846700 12:116192652-116192674 TCTTGTTATTGTCCTGGAAATGG - Intronic
1104392292 12:128401053-128401075 GTTTGATTTAGACCAGGGAATGG + Intronic
1104715789 12:131015383-131015405 GATTGAGATGGACATGGGAATGG + Intronic
1104924376 12:132306299-132306321 GCTTGAGAGTCACCTGGGGATGG - Intronic
1108788582 13:53938223-53938245 TCCTCATATAGACCTGGGAAGGG - Intergenic
1114032545 14:18589100-18589122 GCCTGATATCCACCTGGGAATGG - Intergenic
1114077327 14:19168125-19168147 GCCTGATATCCACCTGGGAATGG - Intergenic
1114084837 14:19231438-19231460 GCCTGATATCCACCTGGGAATGG + Intergenic
1114946871 14:27693323-27693345 GTTTGATATTGACCTCTGCAGGG - Intergenic
1115598281 14:34930213-34930235 GTGTAATATTGACGTGGGAAAGG - Intergenic
1116563711 14:46417746-46417768 TCTTGACATTGATCTTGGAAAGG + Intergenic
1119288311 14:73474245-73474267 GCTTGCTCTTGACCTCTGAAAGG + Intergenic
1122043389 14:99006755-99006777 ACATGATATTGAACTGTGAAAGG - Intergenic
1202896434 14_GL000194v1_random:13249-13271 GCCTGCTATCCACCTGGGAATGG + Intergenic
1124521143 15:30407418-30407440 GATTGTTTTTGACCTGGGACTGG + Exonic
1124537519 15:30558802-30558824 GATTGTTTTTGACCTGGGACTGG - Exonic
1124761137 15:32448785-32448807 GATTGTTTTTGACCTGGGACTGG + Exonic
1124777497 15:32600278-32600300 GATTGTTTTTGACCTGGGACTGG - Exonic
1127246364 15:57179726-57179748 GTTTTTTATTGACCTAGGAAAGG + Intronic
1128145137 15:65328846-65328868 TCTTGCTTTTGACCTGAGAATGG + Exonic
1128594136 15:68929342-68929364 GCTAGGTTTTGAGCTGGGAACGG - Intronic
1129634613 15:77301862-77301884 GGTTGATGTTGACCTTGGGAGGG - Intronic
1130416258 15:83697434-83697456 GCTTGAGATTGGCGTGTGAAGGG - Intronic
1131447295 15:92511110-92511132 GATTTAAATGGACCTGGGAATGG - Intergenic
1143326643 17:6103365-6103387 GCTTTCCACTGACCTGGGAAAGG - Intronic
1144851267 17:18245260-18245282 GCTGGATATATACCTGGCAAGGG + Exonic
1144957585 17:19027000-19027022 GCTGGCTATAGAGCTGGGAAGGG - Intronic
1144977571 17:19147516-19147538 GCTGGCTATAGAGCTGGGAAGGG + Intronic
1147013757 17:37473618-37473640 GATTGGTATTCAGCTGGGAATGG - Intronic
1147336022 17:39727390-39727412 ATTTGATGGTGACCTGGGAATGG + Exonic
1149132567 17:53322689-53322711 ACTTTAAATAGACCTGGGAAAGG + Intergenic
1152143644 17:78553934-78553956 GCTTTAGATTGACCAGGGAAAGG - Intronic
1157218870 18:45810178-45810200 GCTTGATATTGGTCTGTGCAGGG - Intergenic
1157483664 18:48072459-48072481 GCTGCAGATCGACCTGGGAAAGG - Intronic
1159440551 18:68474129-68474151 ACTTGATATTGATCTGTTAAGGG - Intergenic
1159509670 18:69379974-69379996 GCTTAAAATTTAACTGGGAAAGG + Intergenic
1164916387 19:32055555-32055577 GCTTGATATATTCCTGGGGAAGG - Intergenic
1166752812 19:45172773-45172795 GATGGAGATTGGCCTGGGAAGGG - Intronic
1167456535 19:49599256-49599278 GCTTGATCTAGACATGGGAGTGG - Exonic
926700580 2:15800626-15800648 GCCTGCTATTCACCTGGGATGGG - Intergenic
928014369 2:27641530-27641552 GCTTTAAATTGACCTCTGAAAGG - Intronic
928319887 2:30274592-30274614 GCTTCATTTTGACCTGGGACAGG - Intronic
929931505 2:46259724-46259746 GCTTGTTATTTATCTGGGCAGGG + Intergenic
933411047 2:81925449-81925471 GCTTGTTATTGATCTGGTCAGGG - Intergenic
935929654 2:108110319-108110341 GCTTGATATTGATCTGTTCAGGG + Intergenic
936384760 2:112019445-112019467 GGTGGATATTGCCCTGGGAATGG + Exonic
936508147 2:113124465-113124487 GCTTGAGACTGGACTGGGAAAGG + Intronic
938491778 2:131764929-131764951 GCCTGATATCCACCTGGGAATGG - Intronic
938495789 2:131797413-131797435 GCCTGATATCCACCTGGGAATGG + Intronic
940682907 2:156808383-156808405 TATTGAAATTAACCTGGGAATGG + Intergenic
943025450 2:182622663-182622685 GCTTCCTACTGACCTGGGAGTGG - Intergenic
943501118 2:188690663-188690685 GCTTGATATTGATCTGCTCAGGG + Intergenic
946444671 2:219728090-219728112 GCTTAACACTGACCTGGGAGTGG + Intergenic
1168909721 20:1438213-1438235 TCTTGACTATGACCTGGGAATGG - Intergenic
1176616120 21:9029245-9029267 GCCTGCTATCCACCTGGGAATGG + Intergenic
1176709038 21:10134492-10134514 GCCTGCTATCCACCTGGGAATGG - Intergenic
1177394322 21:20512877-20512899 GCTTGATCTAGACTTGAGAATGG + Intergenic
1178767870 21:35471407-35471429 GCTTGATATTGACCTGGGAAAGG + Intronic
1179959555 21:44760477-44760499 GGTAGAAATTGCCCTGGGAAGGG - Intergenic
1180293134 22:10861755-10861777 GCCTGATATCCACCTGGGAATGG - Intergenic
1180456656 22:15516157-15516179 GCCTGATATCCACCTGGGAATGG - Intergenic
1180495938 22:15891177-15891199 GCCTGATATCCACCTGGGAATGG - Intergenic
1183623015 22:38985802-38985824 GCTTGAAATACACCTGGGAGAGG - Exonic
949282698 3:2364829-2364851 ACTTGATATTGTCATGGCAATGG - Intronic
950529455 3:13544798-13544820 GCTCGATATTGAAGTGGGAGGGG + Intergenic
951954783 3:28241880-28241902 GCTGGATGCCGACCTGGGAAAGG + Intronic
952199810 3:31114498-31114520 GCTGGATAGTGACCTGTTAAGGG + Intergenic
954150031 3:48652691-48652713 GCTTGATTTTGACCGGGGGTGGG + Intronic
956728871 3:72178357-72178379 GCTTGAGAATCACCTGGGGAAGG + Intergenic
962751497 3:138437327-138437349 CCTTGACAAGGACCTGGGAAAGG + Intronic
966462086 3:180187949-180187971 GAATCATATTGATCTGGGAAAGG - Intergenic
968709352 4:2101868-2101890 GCTTGGTCTTGAGCTGGGTAGGG + Intronic
969652861 4:8478061-8478083 GCTTGGGAAAGACCTGGGAAGGG - Intronic
974513970 4:62883639-62883661 GATTCATATTGTCCTGGGAAAGG + Intergenic
977139189 4:93345710-93345732 TCTTGACATTGATCTGGGCAAGG - Intronic
977286029 4:95108212-95108234 GCTTGCTACTGATCTGGGAAGGG - Intronic
979340038 4:119511916-119511938 GCTTAATATTCACGTGTGAAGGG - Intronic
983384962 4:167049545-167049567 GATTTATTTTGACCTGAGAAAGG + Intronic
987879016 5:23717211-23717233 TCTTGATATATACTTGGGAAAGG - Intergenic
989831326 5:45923216-45923238 GCTTAAGATTGACTTGGCAATGG + Intergenic
994456085 5:100009886-100009908 TCTTCATAATGACCTGGAAATGG - Intergenic
994748356 5:103707288-103707310 GCTTGAAATTGTCCAGAGAAAGG - Intergenic
995099235 5:108278547-108278569 GCTTGATCTTGAGCTTGGCAGGG + Intronic
1002296049 5:178232086-178232108 GCTCGAGAGTGACCTGGGAGGGG - Intronic
1007585213 6:42984991-42985013 GCAGGACAGTGACCTGGGAATGG - Intronic
1008734226 6:54522494-54522516 ACTTGATATTGACGTGGTTAAGG + Intergenic
1013546802 6:111166289-111166311 GCTTAAAATTGAACTGGGAAGGG - Intronic
1024244558 7:47459521-47459543 GCCTGAGACTGACCTGGGAGGGG - Intronic
1039715891 8:40108767-40108789 CCTTGAGATTGACCTAGCAATGG - Intergenic
1043310185 8:78849424-78849446 GTTGGAAATTGACCTGGGAATGG + Intergenic
1043850642 8:85212546-85212568 GCTTGAAATTGGCCTGGGTAGGG - Intronic
1045002002 8:97886666-97886688 TCCAGAAATTGACCTGGGAATGG - Intronic
1045711007 8:104983899-104983921 GCTTGATATTTACTAGGGAAAGG - Intronic
1048317616 8:133373896-133373918 GCTAGATATTGACCAGGAAGGGG + Intergenic
1053212265 9:36240829-36240851 GCTTGTTATTGACCTGTTCAGGG + Intronic
1053646010 9:40120011-40120033 GCCTGATATCCACCTGGGAATGG - Intergenic
1053759706 9:41343529-41343551 GCCTGATATCCACCTGGGAATGG + Intergenic
1054327022 9:63717908-63717930 GCCTGATATCCACCTGGGAATGG - Intergenic
1054538560 9:66255965-66255987 GCCTGATATCCACCTGGGAATGG + Intergenic
1056742422 9:89269398-89269420 GCTTGACATTGGTCTGGGATAGG - Intergenic
1059985287 9:119815097-119815119 GCTTGAGAGTGACTTGGGAGGGG + Intergenic
1061189621 9:129074631-129074653 GCTTGATGCTGGCCTGGGACTGG - Intergenic
1061201980 9:129143290-129143312 GCTTGACCTTGGCCAGGGAAGGG + Intronic
1062535611 9:137019941-137019963 GCTGGACATTGGCCTGGGAGGGG - Intronic
1202793798 9_KI270719v1_random:103462-103484 GCCTGCTATCCACCTGGGAATGG - Intergenic
1189331937 X:40149522-40149544 CCTTTAGCTTGACCTGGGAATGG - Intronic
1193859061 X:86641182-86641204 GATTCATATTGTCCTGGGATTGG - Intronic
1194882299 X:99268988-99269010 GCTTGTTATTGACCTGTTCAGGG + Intergenic
1196689185 X:118541194-118541216 GCATGGTACTGAACTGGGAATGG - Intronic
1196999077 X:121418027-121418049 CCTTGCTAGTGACCTGGGCAGGG - Intergenic
1199605996 X:149580064-149580086 ACATGATAGTGACCGGGGAAGGG + Intergenic
1199633125 X:149789304-149789326 ACATGATAGTGACCGGGGAAGGG - Intergenic
1199868596 X:151876453-151876475 GCTGGATATATACCTGTGAAAGG + Intergenic
1201149504 Y:11087969-11087991 GCCTGCTATCCACCTGGGAATGG + Intergenic