ID: 1178769239

View in Genome Browser
Species Human (GRCh38)
Location 21:35487249-35487271
Sequence GAGTGGGTAGGGAGGGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1375
Summary {0: 1, 1: 1, 2: 7, 3: 133, 4: 1233}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178769239 Original CRISPR GAGTGGGTAGGGAGGGCAGA AGG Intronic
900103925 1:974205-974227 GACTGGGGAGGGAGAGCAGGGGG + Intronic
900231865 1:1563109-1563131 GAGACAGCAGGGAGGGCAGAAGG + Intronic
900399517 1:2467317-2467339 GAGTGGGAAGGGAGGACACCTGG - Intronic
900404916 1:2488489-2488511 GAGTGGGCAGGCAGGGCGCAGGG - Intronic
900423263 1:2564772-2564794 GAGCGGGCAGGGGTGGCAGAGGG + Intronic
900561462 1:3309152-3309174 GACAAGGGAGGGAGGGCAGAAGG - Intronic
900738044 1:4311646-4311668 GAGGAGGTCGGGAGGGGAGACGG - Intergenic
901037989 1:6347926-6347948 GAGGGGCTTGGGAGGCCAGAGGG - Intronic
901125895 1:6928520-6928542 GTTAGGGTGGGGAGGGCAGATGG - Intronic
901147224 1:7073453-7073475 GACTGGGGAGGGAGTGGAGATGG + Intronic
901538900 1:9901956-9901978 GGCTGGGTAGAGAGGGCAAAGGG - Intronic
901777049 1:11567240-11567262 GAGGTGGCAGGGAGGGCTGAGGG + Intergenic
901787105 1:11632016-11632038 GGGAGGGGAGGGAGGGAAGAAGG + Intergenic
901794671 1:11673425-11673447 GAGTGGGTAGAGAGAGCAAGTGG - Intronic
901814774 1:11787888-11787910 GAGCTGGAAGGCAGGGCAGAGGG - Exonic
901877385 1:12174721-12174743 GAGGGGGTAGGGAGGGCAGCTGG - Intronic
902336788 1:15758743-15758765 GAGGGGGCGGGGAGGGCGGACGG + Intronic
902511042 1:16967344-16967366 GACAGGCTGGGGAGGGCAGAGGG - Intronic
902528264 1:17073610-17073632 GAGTGGGGAGGGAGAGAGGAGGG + Intronic
902781213 1:18706122-18706144 GAGTGAGGAGGGAGGGCAGTGGG - Intronic
903140786 1:21338059-21338081 GAGGGATGAGGGAGGGCAGAGGG - Intronic
903226774 1:21898361-21898383 GAGAGGGCAGGGAGAGGAGAAGG - Intronic
903320879 1:22542554-22542576 GCCGGGGTAGGGAGGGCAGTGGG + Intergenic
903639703 1:24849804-24849826 GAGGGGTCAGGGAGGGCAAAAGG + Intergenic
903739969 1:25553025-25553047 GGGTGGGTGGGGAGAGGAGAAGG - Intronic
903753831 1:25647150-25647172 GAGTGAGCAGGGAGGGCACGTGG + Intronic
903789997 1:25886243-25886265 CAGTGGGAGGGAAGGGCAGAGGG + Intronic
903790297 1:25888245-25888267 GAGTGGGTGAGGAGGGCTGTGGG + Intronic
904032710 1:27543189-27543211 GAGGGAGTAGGGAGGGGAGAGGG + Intronic
904111266 1:28128450-28128472 GAGTGGGGAGGGAGAGCATCAGG - Intergenic
904493894 1:30876379-30876401 GATCGGATAGGGAGGGAAGAGGG - Intronic
904895568 1:33814912-33814934 GACTGGATAGTGAGGGAAGAGGG - Intronic
904912983 1:33949334-33949356 CAGTGGCTGGGGAGGGCAGATGG + Intronic
905921510 1:41722473-41722495 GAGGGGAGAGGGAGGGGAGAGGG - Intronic
906196392 1:43933137-43933159 AAGTGGGTACTGAGGGCTGAAGG - Intergenic
906343961 1:45003795-45003817 GTGTGGGGAGGGAGGACAGAAGG + Intronic
906514634 1:46431716-46431738 GACTGGGTAGGGAGGAGAGGTGG + Intergenic
906650500 1:47509219-47509241 GGGAGGGCGGGGAGGGCAGAAGG - Intergenic
906969397 1:50495257-50495279 CAGAGGCTAGGGAGGGCAGTGGG - Intronic
907053099 1:51342963-51342985 CAGTGTGCAGGGAGAGCAGAGGG - Intronic
907157364 1:52346591-52346613 GGGTGGGATGGGAGGGCAGAGGG + Exonic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907255131 1:53173408-53173430 GAGAGGGAGGGGAGGGGAGAGGG - Intergenic
907401955 1:54229744-54229766 GAGTGGGAAGGGAGTGGAGGTGG + Intronic
907407107 1:54260395-54260417 CAGTGGTCAGGGAGGGCAGGAGG + Intronic
907747997 1:57233857-57233879 GAGTGGGGAGGTAGGGCACTGGG + Intronic
908661795 1:66445117-66445139 GAGAGGGGAGGGAAGGGAGAAGG - Intergenic
908703303 1:66924904-66924926 GAGGCGGAGGGGAGGGCAGAGGG + Intronic
909472882 1:76049317-76049339 GAGGGGGGAGGGAGGGAAGAAGG - Intergenic
909928995 1:81473140-81473162 GAGTGGGTGGGAGGGACAGAGGG + Intronic
910451552 1:87351754-87351776 GTGTGGGTGGGTAGGGCAGAGGG - Intergenic
910502411 1:87908034-87908056 GTGGGGGTGGGGTGGGCAGAAGG + Intergenic
910679110 1:89844086-89844108 GAGAGGGTGGAGAGGGCAGCTGG - Intronic
910979952 1:92950191-92950213 GAATGGGTATGGAGAGCAAATGG + Intronic
911053956 1:93695139-93695161 GGGTGGGCAGGGAAGGAAGAAGG - Intronic
911086512 1:93982232-93982254 GAGGGGGCAGGGAGGGAAGGGGG - Intergenic
911767917 1:101701651-101701673 GAGTGGGGAGGGGGGGGAGGGGG - Intergenic
912163997 1:107020643-107020665 GAGAGAGAAGGGAGGGGAGAAGG + Intergenic
912259836 1:108099387-108099409 GACTGGGAAGGGAAGGTAGAAGG - Intergenic
912474680 1:109928028-109928050 TACTGGGTAAGGAGGGAAGATGG - Intronic
912483394 1:110003498-110003520 GAGTGGGGATGGAGGGTAGGGGG + Intronic
912573401 1:110641796-110641818 GTGTGTGTAGGGAGGGAAGATGG + Intergenic
912673433 1:111653242-111653264 GAGACTGTAGGGAGGGCAAATGG + Intronic
912760738 1:112365130-112365152 AAGTGGGTAGGAAAGACAGATGG + Intergenic
912997645 1:114547273-114547295 GAGTGGGGAAAGAGGGCTGAGGG + Intergenic
913176565 1:116278107-116278129 GAGTGTGTGGGAAGGGCAAATGG - Intergenic
913206406 1:116543225-116543247 GGCTGAGTAGGGAGGGCAGCAGG + Intronic
913275985 1:117138168-117138190 GGATGGGAAGGGAGGGCACATGG - Intergenic
913613071 1:120527461-120527483 GAGTGGGGAGGGAGAGTAGGGGG + Intergenic
913697017 1:121336462-121336484 GAGAGGGAAGAGAAGGCAGAGGG - Intronic
913714432 1:121519477-121519499 GCCAGGGTAGGGAGGGCGGAGGG + Intergenic
913976677 1:143464004-143464026 AATTACGTAGGGAGGGCAGAAGG + Intergenic
914071078 1:144289621-144289643 AATTACGTAGGGAGGGCAGAAGG + Intergenic
914108077 1:144676734-144676756 AATTACGTAGGGAGGGCAGAAGG - Intergenic
914140542 1:144943582-144943604 GAGAGGGAAGAGAAGGCAGAGGG + Intronic
914342330 1:146770817-146770839 GACTGGATAGGGAGGGCACGAGG - Intergenic
914371421 1:147028199-147028221 GAGTGGGGAGGGAGAGTAGGGGG + Intergenic
914425292 1:147570578-147570600 GAGTGGGAATGGGGGGCAAAGGG - Intronic
914578115 1:148994788-148994810 GAGTGGGGAGGGAGAGTAGGGGG - Intronic
914934285 1:151964657-151964679 GCGTTGGCAGGCAGGGCAGAAGG - Intergenic
914959602 1:152194680-152194702 GGGGGGGTGGGGAGGGGAGAGGG - Intergenic
915042636 1:152981698-152981720 AGGTGGGTGGGGAGGGCAGCAGG + Intergenic
915106973 1:153540803-153540825 CAGCGGGCAGGGAGGGCAGGGGG + Intronic
915199947 1:154220247-154220269 GAGTGGGTGGAGAATGCAGACGG + Intronic
915334116 1:155130498-155130520 GAGAGGGGAGAGAGGGGAGAGGG + Intronic
915444435 1:155966795-155966817 GAGACGGCAGGGAGGGCAGAGGG - Intronic
915952244 1:160197358-160197380 GAGAGGGGAGGGTGGGCAAAGGG - Intronic
916065267 1:161131741-161131763 AAGAGGGTGGGAAGGGCAGAAGG - Intronic
916317851 1:163470410-163470432 GAGGGGGTAGTTAGGGGAGAGGG + Intergenic
916668485 1:166989537-166989559 GGGTGAGGCGGGAGGGCAGAAGG + Intronic
916772276 1:167922511-167922533 GTGTAGGTAGGGAGAGAAGAAGG + Intronic
917486426 1:175459122-175459144 GAGGTGGTAGTGATGGCAGAAGG - Intronic
918094311 1:181322000-181322022 GGGAGGGTAGGCGGGGCAGATGG + Intergenic
918139458 1:181708165-181708187 GGGTGGATAGGGATGGCAGGAGG + Intronic
918327069 1:183419931-183419953 GGGTGGAAAGGGAGGGCAAATGG + Intergenic
918522954 1:185434965-185434987 GAGAGGGAAGAGAGGGAAGAGGG - Intergenic
919481086 1:198090672-198090694 GAGTGAGAAGGGAGGTGAGAAGG + Intergenic
919767251 1:201135408-201135430 GAGGGGGAAGGCAGGCCAGAAGG - Exonic
919807859 1:201391400-201391422 GAGGTGGTAGGTAGGGCAGGTGG - Intronic
919847815 1:201652454-201652476 GAGTGAGTACCGAGGGCAAATGG + Intronic
920021124 1:202957789-202957811 GCGTGGGGAGGGAGGGCTGCGGG - Intronic
920039260 1:203085266-203085288 CAGTGGGGAGGAAGTGCAGAAGG - Intronic
920222903 1:204417042-204417064 GAGTGTGGGGGGAGGGGAGAGGG + Intergenic
920484348 1:206354799-206354821 GAGAGGGAAGAGAAGGCAGAGGG - Intronic
920500050 1:206480180-206480202 GAGTGGGCAGGAAGGGGAGATGG + Intronic
920536048 1:206737245-206737267 GAGTGGGTAGAGTGGGTAGCAGG + Intergenic
920626842 1:207611065-207611087 GTGAGGGTAGGGAGGGGAGGTGG - Intronic
920816000 1:209332631-209332653 GTGTTGGTAAGGAGGGCAGAAGG - Intergenic
920849998 1:209622353-209622375 GAGTGGGTGGGGAGGGCAGACGG + Intronic
921265015 1:213414962-213414984 GGGTGGGTGTGGAGGCCAGAGGG + Intergenic
921317352 1:213905131-213905153 GAGAGGTGAGGGAGGGAAGAAGG + Intergenic
921440113 1:215175641-215175663 GAGTGGGAAGGGAGGGAAGGGGG - Intronic
921602883 1:217125149-217125171 CACTGGGGAGGGAGGGCAGTGGG + Intronic
922020566 1:221700126-221700148 GAGAGGGAAGGGAAGGGAGAGGG + Intergenic
922020572 1:221700142-221700164 GAGAGGGAAGGGAAGGGAGAGGG + Intergenic
922020578 1:221700158-221700180 GAGAGGGAAGGGAAGGGAGAGGG + Intergenic
922210009 1:223479294-223479316 GAGAGGGTGGGGAGGTGAGAGGG + Intergenic
922232156 1:223696778-223696800 GAGAGGATAGGAAGGGGAGAGGG - Intergenic
923144391 1:231187701-231187723 GGGTGGGAAAGGCGGGCAGAAGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923433655 1:233948692-233948714 GAGGGGGTAGGGATGGCATTGGG - Intronic
923614334 1:235524434-235524456 AGGCGGGGAGGGAGGGCAGAAGG + Intergenic
924043900 1:240009275-240009297 GAGCGTGTAGGGAGGGGATAGGG + Intergenic
924424668 1:243940385-243940407 GACTGGGAAGGGAGGGAAGGAGG + Intergenic
924454519 1:244208344-244208366 GAGTGGGGAGGGATGGCATTAGG + Intergenic
924464842 1:244290617-244290639 CAGTGGGTAGGGAGGAAAGAAGG + Intergenic
924577583 1:245294274-245294296 GAGAGGGAGGGGAGGGGAGAGGG - Intronic
924716094 1:246575600-246575622 TAGTGGGTATGTAGGGCAGGGGG + Intronic
924799271 1:247315638-247315660 GAGTGGGTAAGGAAGAGAGAGGG + Intronic
1062823371 10:551103-551125 CAGTGTCTAGTGAGGGCAGAGGG - Intronic
1062856586 10:782871-782893 GAGTAGAGAGGGAGGGCACAGGG - Intergenic
1064183838 10:13143043-13143065 CAGGGGGTAGGGAAGGAAGATGG - Intergenic
1064476229 10:15691688-15691710 CAGAGGCTGGGGAGGGCAGAAGG + Intronic
1064511414 10:16097113-16097135 GAGTGGGGAGGGAGAGCATTGGG + Intergenic
1064599062 10:16974776-16974798 GAGTGGGTTGGGGAGGAAGAGGG - Intronic
1065173317 10:23053238-23053260 GAGTGGGGAGGGTGTGTAGAAGG + Intergenic
1066189678 10:33044909-33044931 GACAGGGTATGGAGGGGAGATGG + Intergenic
1066227683 10:33400168-33400190 GAGTGGGAAGGGAAGGGAAATGG - Intergenic
1067083760 10:43227606-43227628 GTGTGGGTAGGGTGGCCAGGAGG + Intronic
1067145267 10:43689542-43689564 GAGAGGGTACGGAGGGCATCAGG + Intergenic
1067481034 10:46597796-46597818 CGGGGGGTAGGGAGGGCGGAAGG - Intergenic
1067613717 10:47744026-47744048 CGGGGGGTAGGGAGGGCGGAAGG + Intergenic
1067732871 10:48825104-48825126 CAGTGGGTGGGGTGGGGAGAGGG - Intronic
1067807600 10:49404078-49404100 GAGGTGTTGGGGAGGGCAGAGGG - Intergenic
1068021136 10:51585974-51585996 GAGTGGGGAGGTAGGGCAAGAGG + Intronic
1068866777 10:61903178-61903200 GCGGGGGAGGGGAGGGCAGAGGG + Intronic
1068896528 10:62209604-62209626 GAGTGTGGAGGGTGGGAAGAGGG - Intronic
1069160205 10:65083766-65083788 GAGTGAGCAGGGGAGGCAGAAGG + Intergenic
1069629134 10:69887300-69887322 TAGTGGGTTGGGAGGGAAGATGG - Intronic
1069757318 10:70781334-70781356 CAGTGGGGAGGGATGGGAGATGG - Intronic
1069858219 10:71453440-71453462 GGGAGGCCAGGGAGGGCAGATGG + Intronic
1070460345 10:76661181-76661203 GAGTGGGGAGGGAGAGCATTGGG + Intergenic
1070543292 10:77432856-77432878 GAAGGGGCAGGGAGGGAAGAAGG + Intronic
1070721553 10:78760705-78760727 GAGTGAATATGCAGGGCAGAGGG + Intergenic
1070731269 10:78830157-78830179 GAGAGCTTAGAGAGGGCAGAAGG - Intergenic
1070822810 10:79372360-79372382 GATTGGGAAGTGAGGGGAGAGGG + Intergenic
1071346777 10:84701008-84701030 GGGTGGGAAGGGAGAACAGAGGG + Intergenic
1071399705 10:85257254-85257276 GATTGGATGTGGAGGGCAGAGGG - Intergenic
1071529029 10:86375074-86375096 ATGTGGGAATGGAGGGCAGAGGG - Intergenic
1071629128 10:87203998-87204020 CGGGGGGTAGGGAGGGCGGAAGG + Intergenic
1072029989 10:91509775-91509797 GAGCGGGTAGGGTGGGAGGAGGG + Intronic
1072250774 10:93580825-93580847 GAGGAAGCAGGGAGGGCAGAAGG - Intronic
1072535634 10:96360521-96360543 GAGCAGGTAGACAGGGCAGAGGG + Intergenic
1072594256 10:96856443-96856465 GAGGGGGGAGGTAGGGTAGAAGG - Intronic
1072713616 10:97734871-97734893 GAGTGGGTGGGGAGTGGCGATGG + Intergenic
1072862958 10:99025699-99025721 GAGTGGGGAGGGTAGGAAGAGGG + Intronic
1072874809 10:99160974-99160996 GAGTGGCCAGGGTGGGAAGATGG + Intronic
1072967904 10:99990311-99990333 GAGAGGCTAAGGTGGGCAGATGG + Intronic
1073136702 10:101224377-101224399 GAGGGGGAAGGGAGGGGAGGGGG + Intergenic
1073404733 10:103287248-103287270 GACTGGTGAGGGAGGGAAGAAGG + Intronic
1073426571 10:103458808-103458830 CAGTGGGCAGGGTGGGCAGCAGG - Exonic
1073730465 10:106281482-106281504 GAGTGAGAAGAGAGGGTAGAAGG + Intergenic
1074182664 10:111077705-111077727 GAGAGAGTAGGGAGAGCCGATGG - Exonic
1075284479 10:121171778-121171800 GAAGGGGAAGGGAAGGCAGAAGG + Intergenic
1075360354 10:121826760-121826782 GAGTGGGGAGAGAGGGAAGGTGG - Intronic
1075502569 10:122989189-122989211 GGGTGGGCGGGGTGGGCAGAAGG + Intronic
1075552501 10:123402426-123402448 GAGGGAGGAGGGAGGGAAGAGGG + Intergenic
1075814802 10:125256693-125256715 GGGTGGGGATGGAGGGCTGATGG + Intergenic
1076312520 10:129518525-129518547 GAGGGGGAAGGGAGGGGAGGAGG - Intronic
1076312534 10:129518550-129518572 GAGGGGGAAGGGAGGGGAGGAGG - Intronic
1076619518 10:131778344-131778366 GGGTGGGCAGGGAGGAGAGATGG + Intergenic
1076804805 10:132850013-132850035 GAGTAGGCAAGGAGGGCAGGCGG - Intronic
1077037683 11:503170-503192 GGGTGGGTGGGGTGGGGAGAGGG + Exonic
1077141987 11:1028808-1028830 GGGTGGGGAGGGAGCCCAGACGG - Intronic
1077185774 11:1234750-1234772 CAGCGGGCAGGGAGGGCAGGGGG + Intronic
1077268574 11:1664624-1664646 GAGGAGGCAGGGAGGGAAGAAGG + Intergenic
1077362567 11:2147215-2147237 AAGTGGGTAGAGAGGGAAAAAGG - Intronic
1077366351 11:2162846-2162868 GAGTGTGTAGGGAGGGAGGCTGG + Intergenic
1077464668 11:2728046-2728068 GAGTGGCTGGGGAGGGAGGAGGG - Intronic
1077673745 11:4180256-4180278 GAGTGAGTAGGGTGGGCAAGAGG - Intergenic
1078067999 11:8090364-8090386 AGCTGAGTAGGGAGGGCAGAGGG + Intronic
1079327344 11:19505568-19505590 GAGTGGGGAGAGAGAGAAGAAGG + Intronic
1079574724 11:21989304-21989326 CAGTGAGTAGGGAGGACAAAAGG - Intergenic
1079642004 11:22817129-22817151 GAGTGGGGAGAGAGGGAGGAGGG - Intronic
1079995760 11:27293574-27293596 GAGAGGGAAGGGAGGGGAGGCGG + Intergenic
1080086469 11:28288662-28288684 GAGTGGGGAGGGTGGGAGGAAGG + Intronic
1080368964 11:31611856-31611878 AAGTGGGCAGAGAGGGCAGTGGG + Intronic
1080614339 11:33932961-33932983 GAGAGGAAATGGAGGGCAGAGGG - Intergenic
1080784421 11:35461939-35461961 GAGAGGGTATGAAGGGCATAGGG - Intronic
1080972397 11:37294171-37294193 GAGTGGGGAGGGAAGGCATCAGG - Intergenic
1081737480 11:45414043-45414065 GGGTGGGTTGGGAGGGCTCATGG + Intergenic
1081845569 11:46238267-46238289 GAGGGGGCCGGGAGGGCAGGAGG - Intergenic
1081993511 11:47349962-47349984 GGGTGGGAAGGGGGGGCAGCAGG - Intronic
1082132350 11:48506184-48506206 GAGGGGGAAGGGAGGGGAAAGGG - Intergenic
1082311149 11:50649948-50649970 GAGGGGGGAGGGAGGGCATTAGG + Intergenic
1082755503 11:57072086-57072108 GAGTGGTTAGGGAGGGGTGATGG - Intergenic
1082835836 11:57649560-57649582 GAGGGGGAAGGGAGGACAAAGGG + Exonic
1082996148 11:59257136-59257158 GAGATGGCAGGGAGGGCAGCTGG - Intergenic
1083193617 11:61069764-61069786 GACTGGGGAGGGGGTGCAGAAGG + Intergenic
1083294698 11:61708952-61708974 GAGGGGATAGGGAGGTCTGAAGG + Intronic
1083592565 11:63904181-63904203 AAGGGGGTAGGGTGGGCTGAGGG - Intronic
1083747107 11:64742769-64742791 GAGTGGCTCGGGAGGGCACACGG - Intronic
1083913027 11:65720976-65720998 GAGAGGGGAGGGAGGAAAGAGGG - Intergenic
1084421611 11:69063315-69063337 GAGTGGGAGGGGACGGCAGAGGG - Intronic
1084756192 11:71240374-71240396 GAGGGGCTAGGGAGAGAAGATGG - Intronic
1084774149 11:71364499-71364521 GAGTGGGTAGGGTGGATGGATGG + Intergenic
1084794023 11:71492125-71492147 GGGAGGGGAGGGAGAGCAGATGG + Intronic
1084836451 11:71804821-71804843 GAGTGGGGAGGGAGTGCATCAGG + Intergenic
1084982720 11:72840017-72840039 GAGTGGGAAGAGAGAGCAGTGGG - Intronic
1085083839 11:73653798-73653820 GAGTGGGTAAGGAGGGAAGGAGG + Intronic
1085101058 11:73800409-73800431 GAGTGGGTGGTGAGAGCAGTGGG - Intronic
1085201669 11:74705776-74705798 GCCTGGGTGGGGAGGGCAGCAGG + Intronic
1085331611 11:75656653-75656675 GGGTGGGTAGGGAAGAGAGAGGG - Intronic
1085479098 11:76806962-76806984 GAGAGGGAAGGGAGGGAAGGAGG + Intergenic
1086124694 11:83338407-83338429 GACTGGGGAGGGAGGGAGGAAGG + Intergenic
1086138060 11:83462593-83462615 GACTGGGAAGGGAAGGCAGGAGG + Intronic
1086170647 11:83832604-83832626 GAGTGGGGAGGGAAGGAAAAGGG + Intronic
1086361783 11:86068294-86068316 GGGTGGGAAGGAAGAGCAGAAGG + Intronic
1087353700 11:97066506-97066528 GAGTGGGGAGAGAGGGAGGATGG + Intergenic
1087675088 11:101152507-101152529 GTGGGGGTAGGGAGAGCATAAGG - Intergenic
1088321604 11:108560015-108560037 GTGTGGGTAGGGTGGGAAGGAGG - Intronic
1088469546 11:110178030-110178052 TGGTGGGTGGGGAGGGCAGATGG - Intronic
1088903725 11:114138115-114138137 AAGTGGTGAGGGAGGGCAGGAGG + Intronic
1089002033 11:115060106-115060128 GAGAGGTCAGGGAAGGCAGAGGG - Intergenic
1089180382 11:116579570-116579592 GAGTGGTGAGGAAGGGCAGCTGG - Intergenic
1089287847 11:117419267-117419289 GAAAGGGTAGGTAGAGCAGAAGG - Intergenic
1089371159 11:117959152-117959174 GAGTTGGGAAGGAGTGCAGATGG + Intergenic
1089391852 11:118107639-118107661 GAGTGGCCAGGGAGTGGAGATGG - Intronic
1089458416 11:118639043-118639065 AAGTGGGAGGGGAGTGCAGAAGG + Intronic
1089611674 11:119672780-119672802 GAGTGAGTAGGCAGGGCTGGAGG - Intronic
1089905270 11:122031724-122031746 GAGTGGGGAGGGTGGGTGGAGGG + Intergenic
1090187121 11:124746055-124746077 GAGGGGTGAGGGTGGGCAGAGGG - Intronic
1090226405 11:125074620-125074642 GAGTGGGGTGGGAGGGGAAAGGG + Intronic
1090303728 11:125672097-125672119 GAGTGTGTAGGGATGGAAAAGGG + Exonic
1090378517 11:126308718-126308740 GGGTGGGGAGGGTGGGTAGAGGG - Intronic
1090623585 11:128585298-128585320 GGGAGGGAAGGGAGGGAAGAAGG + Intronic
1090632563 11:128662961-128662983 GGTTAGGGAGGGAGGGCAGAAGG - Intergenic
1090873864 11:130771617-130771639 GAGGGAGTAGGGAGGGCTGTCGG + Intergenic
1091167448 11:133492172-133492194 GAGTGGACAGGAAGGGAAGAGGG + Intronic
1091207027 11:133828756-133828778 GAGTGGGGAGGCAGGGAAGAAGG + Intergenic
1091390533 12:123607-123629 GAGAGTGCTGGGAGGGCAGATGG + Intronic
1091475999 12:773333-773355 GAGTGGGTAGGAAGTGGAAAAGG - Intronic
1091641062 12:2237888-2237910 GTGGAGCTAGGGAGGGCAGAGGG - Intronic
1091714750 12:2768793-2768815 GAGTGAGGAGGGAGGGCCGAGGG - Intergenic
1091721015 12:2813696-2813718 GAGTAGGAAGATAGGGCAGAGGG - Intronic
1091923120 12:4321386-4321408 GAGCGAGCAGGGAGGGGAGAGGG - Intronic
1091991235 12:4957711-4957733 GAATGGGTGGGGAGAGCAAAAGG - Intergenic
1092118136 12:6024094-6024116 GAGTGGGTTGTGAGGACAGATGG - Intronic
1092126915 12:6080950-6080972 CAGTGGGTGGGGTGGGCAGCAGG + Intronic
1092402788 12:8191287-8191309 GAGTGGGGAGGGAGTGCATCAGG - Intergenic
1093675850 12:21939650-21939672 GAGAGAGAAGGGAGAGCAGATGG + Intronic
1094199592 12:27781921-27781943 GAGTGGGATGAGAGGGGAGAAGG + Intronic
1094671994 12:32579482-32579504 GAGTAGGGAGGGAGAGGAGACGG - Intronic
1095413475 12:41948957-41948979 GAGGGGCCAGGGAGGGAAGAAGG + Intergenic
1095529029 12:43162661-43162683 GAGTGGGTGGGGTGGGGAAAGGG + Intergenic
1095533151 12:43214342-43214364 GGGTGGGAAGTGAGGCCAGATGG + Intergenic
1095814536 12:46406985-46407007 AAGTGGGTGGGGAGGGAAGATGG - Intergenic
1095904065 12:47359322-47359344 GAGTGGGGAGGATGGGAAGAGGG - Intergenic
1095961067 12:47834744-47834766 GAGTGGATGGGGAGGGCGGTGGG - Intergenic
1096493035 12:52023375-52023397 GAGTGGGGTGGGAGCGCAGAGGG + Intronic
1096518265 12:52170264-52170286 GAGTGGGCATGGAGGGAGGAAGG + Exonic
1096538535 12:52290297-52290319 GTGTGGGAAGGTGGGGCAGATGG + Intronic
1096540244 12:52303067-52303089 GTGTGGGAAGGTGGGGCAGATGG - Intronic
1096777707 12:53974132-53974154 GGGTGGGGAGGGAGGGAAAAGGG + Intronic
1096863809 12:54549526-54549548 GAGAAGGGAGGGAGAGCAGAGGG + Exonic
1096869693 12:54585552-54585574 CAGTGGGGAGGGAAGGCAAATGG + Intronic
1097260921 12:57719874-57719896 TATTGGGTAGGGCGGGAAGATGG + Intronic
1097262658 12:57728194-57728216 GTGGGGGTAGGGAAAGCAGAGGG + Intronic
1097386986 12:58962014-58962036 GAGTGGGGAGAGAGGGCAGCAGG - Intergenic
1097737136 12:63194772-63194794 AAGTGGCCAGGGAGGGGAGATGG - Intergenic
1097958741 12:65512279-65512301 GAGAGGGAGGGGAGGACAGAAGG - Intergenic
1097961333 12:65534518-65534540 GAGTGGGGAGGCAGGACAGCGGG + Intergenic
1097992862 12:65854711-65854733 GAGTGGGGAGGGAGAGCATCAGG - Intronic
1098233765 12:68398647-68398669 GAGTGGGGAGGGAGAGCATTAGG - Intergenic
1098365915 12:69703154-69703176 GAGTGGGTAGGGACTATAGAAGG + Intergenic
1100145698 12:91674941-91674963 GAGTGGGAAGGGAGAGCACCAGG - Intergenic
1100636715 12:96441547-96441569 GAGTGGGGAGGGATGGCATTAGG + Intergenic
1100785624 12:98074991-98075013 GAGCAGGTAGGGAGGGCAATAGG + Intergenic
1100938508 12:99698028-99698050 GGGTGGGTAGAAAGAGCAGAAGG + Intronic
1101638305 12:106565878-106565900 AAGGGGGTAGGGAGGGAGGAAGG + Intronic
1101898338 12:108772170-108772192 AAGTGGGCAGGGAGAGAAGAGGG + Intergenic
1101909531 12:108850829-108850851 GAGCTGGTGGGGAGGGCAGTTGG + Intronic
1102016333 12:109650356-109650378 GAGAGGCTGAGGAGGGCAGATGG + Intergenic
1102237679 12:111304333-111304355 AAGTGAGCAGGGAGGGCAGAGGG + Intronic
1102457891 12:113082205-113082227 GCGTGGGTGGGGAGGGATGAGGG - Intronic
1102670935 12:114618212-114618234 AAGTGGGGAGGGAGGGGAGGAGG + Intergenic
1102744972 12:115242467-115242489 GAGCCGGTAAGGAGGGGAGAAGG - Intergenic
1102864735 12:116365307-116365329 GAGGAAGAAGGGAGGGCAGAAGG - Intergenic
1102959858 12:117085407-117085429 GTGAGGGTCGGGAAGGCAGAAGG + Intronic
1103397466 12:120619125-120619147 GAGGGGGAAGAGAGGGCTGAAGG - Intergenic
1103398938 12:120629189-120629211 GAGTGGATCTGGAGGGCAAATGG + Intergenic
1103660006 12:122506636-122506658 GTGTGTGTAGGGAGGACAGTGGG + Intronic
1103948863 12:124541066-124541088 GAGGGGGTGGGGAGTGGAGATGG + Intronic
1103949132 12:124541849-124541871 GAGGGGGTGGGGAGTGGAGATGG + Intronic
1103971193 12:124673961-124673983 GGGTGGGGAGGGAGGGCATAGGG - Intergenic
1104080442 12:125425584-125425606 GAGAGGGTAGGTAGAGCACAGGG - Intronic
1104178774 12:126357849-126357871 GAGAGGGGAGGGAGGGGATAGGG + Intergenic
1104289205 12:127453544-127453566 GTGTGAGGAGGGAAGGCAGAAGG + Intergenic
1104400113 12:128468241-128468263 GGGTGTGCAGGGAGGGCAGGGGG + Intronic
1104849218 12:131863293-131863315 AAGTGGGGAGGGAGGGGTGAAGG + Intergenic
1104914870 12:132259488-132259510 GAAGGGGAAGGGAGGGCACAGGG + Intronic
1104971358 12:132532341-132532363 GAGTGGTGAGGGAGGTCTGAGGG - Intronic
1105202340 13:18191146-18191168 GAGTGGGTGGGGAGGGCAAGAGG + Intergenic
1105222556 13:18345815-18345837 AATTACGTAGGGAGGGCAGAAGG - Intergenic
1105415186 13:20205915-20205937 GAAAGGGAAGGGAAGGCAGAGGG - Intergenic
1105765169 13:23552147-23552169 GAGTGGGTAGGAGGGGAAGGAGG + Intergenic
1106058742 13:26264714-26264736 GAGTGGGGAGGGAGGAGAGGAGG - Intronic
1106073833 13:26440398-26440420 GAGTGGGTAGGGAGAGATGTAGG + Intergenic
1106635980 13:31528837-31528859 GAATGGGGAGAGAGGGAAGAGGG - Intergenic
1106936644 13:34729762-34729784 GATGGGGTAGGGAGTGGAGATGG - Intergenic
1107383530 13:39882567-39882589 GAGTGGGTCTGCAGGGCAAAGGG + Intergenic
1107420328 13:40240107-40240129 CAGTGTGGAGGGAGGGCAGGGGG - Intergenic
1107480119 13:40779297-40779319 GAGGAGTTAGGCAGGGCAGAAGG - Intergenic
1107788488 13:43977802-43977824 GGGAGGGAAGGGAGGGGAGAGGG - Intergenic
1108601348 13:51997875-51997897 GAGCGGGGAGGGTGGGAAGAAGG + Intronic
1108801924 13:54108571-54108593 GGGTGGGTGGGGGCGGCAGACGG - Intergenic
1108972013 13:56388322-56388344 GAGTGGGTAGGGATGGAGAAAGG - Intergenic
1109274559 13:60289539-60289561 GAGTGGGTAGGACAGGCAGGAGG - Intergenic
1109691367 13:65895028-65895050 GAGGGGTTAGGGAGGGGAGAGGG + Intergenic
1111892617 13:94103016-94103038 GAGTGGGTAGGGATAGCATTAGG - Intronic
1112234632 13:97624439-97624461 GAGAGGGCAGGGAGGCGAGAGGG + Intergenic
1112695915 13:101947685-101947707 GAGGGGGTAGGGAGGGATCATGG + Intronic
1113193576 13:107778756-107778778 GAGTGGGGAGGGAAGAAAGAGGG - Intronic
1113409273 13:110070208-110070230 GGTGGGGAAGGGAGGGCAGAGGG - Intergenic
1113409287 13:110070241-110070263 GCTGGGGAAGGGAGGGCAGAGGG - Intergenic
1113719286 13:112541115-112541137 GAGTTGATAGGGAATGCAGAGGG - Intronic
1113796533 13:113061742-113061764 GAGAGGGAAGGGAGGGGAAAGGG - Intronic
1113909813 13:113836560-113836582 GAGGGGGTGGGGAGGGGTGAGGG + Intronic
1113909825 13:113836582-113836604 GAGGGGGTGGGGAGGGGTGAGGG + Intronic
1113940824 13:114017867-114017889 GAGTGAGTGGGGAGGGGAAACGG - Intronic
1114482369 14:23043877-23043899 GAGAGGAAAGGCAGGGCAGAGGG - Exonic
1114533920 14:23411521-23411543 AAGGGGGTAGGGAGGGGACAAGG - Intergenic
1114879806 14:26770114-26770136 GAGTGGGAAGGGAAGGAGGAGGG + Intergenic
1115106554 14:29768978-29769000 GTGGTGGTAGGGTGGGCAGAAGG - Intronic
1115724174 14:36194708-36194730 GAGGGGGAAGGGAGGGGAGAGGG + Intergenic
1115926628 14:38442966-38442988 GAGTGGGAAGGGTGGGAAGAGGG - Intergenic
1116339632 14:43704517-43704539 GAGTGGGGAGGGATAGCAGTGGG + Intergenic
1116426814 14:44800440-44800462 GAGTGGGGAGAGAGGGAAGGGGG + Intergenic
1116639194 14:47439517-47439539 GAGGGAGTAGGGACAGCAGAAGG - Intronic
1116829690 14:49706103-49706125 GGGTGGGTAGGGATGGCTAATGG - Intronic
1116890654 14:50264727-50264749 AAGTGGGGAGGGAGGGAGGAAGG + Intronic
1117105485 14:52393957-52393979 GGGCGGGAAGGGAGGGCACAGGG - Intergenic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1117378473 14:55137105-55137127 TAGTGGGGACAGAGGGCAGATGG + Intronic
1117971342 14:61253959-61253981 GAGGAGGGAGGGAGGGAAGAAGG - Intronic
1118321876 14:64758133-64758155 GGGTGGATAGGGAGGGGTGAAGG - Intronic
1118443133 14:65829681-65829703 GAATGGGGAGGGAAGGCAGCAGG + Intergenic
1118485207 14:66208102-66208124 GAGGGGCTGGAGAGGGCAGAAGG - Intergenic
1118839792 14:69501713-69501735 TCCTGGGGAGGGAGGGCAGATGG - Exonic
1118888970 14:69891544-69891566 CAGGGGGTAGGGAGGGAAGAGGG - Intronic
1119276490 14:73361604-73361626 GAGTGGGGAGGGTGGGAGGAGGG - Intronic
1119595480 14:75928986-75929008 GGGTGGGGAGGGTGGGCAGGAGG - Intronic
1119779048 14:77266102-77266124 GACTGGGCAGGCAGGACAGAAGG + Exonic
1119900789 14:78257932-78257954 GGGTGGGTAGTGATGGAAGAAGG + Intronic
1120280231 14:82429853-82429875 AAGTGGGGAGGGAGGGGACAGGG - Intergenic
1120852819 14:89186544-89186566 GAGAGGGTGGGGTAGGCAGATGG + Intronic
1121232621 14:92368914-92368936 GAGTGGGTAGGGAGCTGAGCAGG - Intronic
1121304798 14:92899398-92899420 GAGTGGGGAGGGGAGGCAGGGGG - Intergenic
1121316558 14:92964403-92964425 GGGTGGGGAGGGAGGGGAGCTGG + Intronic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121565135 14:94903674-94903696 GACTGGGAAGGGAGGACAGGTGG + Intergenic
1121777940 14:96603059-96603081 GAGTGTCTGGGGAGGGGAGAGGG + Intergenic
1121868720 14:97387407-97387429 GAGTGAAAAGGGATGGCAGAGGG - Intergenic
1121916006 14:97837424-97837446 GAGTGGAGAGGGAGGGCAGCAGG + Intergenic
1122210825 14:100173006-100173028 GAGTGGGAAGGGGTGGCACAAGG - Intergenic
1122429448 14:101630553-101630575 GTGTGGGGTAGGAGGGCAGAGGG - Intergenic
1122443898 14:101755381-101755403 GGGTGGGTAGGGAGGGCTACTGG - Intergenic
1122740270 14:103868098-103868120 GAGTTGGAATGGAGGGCCGAGGG - Intergenic
1122878506 14:104679541-104679563 GAATGCCTAGGGAGGGCAGCTGG - Intergenic
1123068112 14:105628263-105628285 GAGAGGGGAGGGGGGGCAGGAGG - Intergenic
1123103235 14:105819651-105819673 CCGTGGGTGGGGAGGGCAAATGG + Intergenic
1123433274 15:20236219-20236241 GAGTGGGGAGGGACTGCTGAAGG - Intergenic
1123673924 15:22689838-22689860 GGGTGGGATGGGAGAGCAGAGGG - Intergenic
1123989224 15:25671051-25671073 TAGTGGGAAGGGAGGGGATAAGG + Intergenic
1124018005 15:25894449-25894471 GGGTTGGTGGGGAGGGCAGCAGG - Intergenic
1124035322 15:26048991-26049013 GTGTGGGGTGGGAGGGGAGAGGG - Intergenic
1124065806 15:26342626-26342648 GAGTGGGTAGGGAAGACAGGAGG - Intergenic
1124431372 15:29611564-29611586 AAGTGGCTGGGAAGGGCAGAGGG - Intergenic
1124610238 15:31203119-31203141 GTGTGGCTAGGCAGGACAGAAGG + Intergenic
1124970074 15:34479972-34479994 GGGTTGGTGGGGAGGGGAGAGGG - Intergenic
1125282995 15:38063031-38063053 GAGTGGGTAGGGAGAGAAGTGGG - Intergenic
1125533497 15:40429065-40429087 GAGTGGGCAGGCTGGGCGGAGGG - Intronic
1125542917 15:40481533-40481555 TGGTGGGGAGGGAGGGGAGATGG - Intergenic
1125832768 15:42728383-42728405 GGGTGGGGCGGGAGGGCAAACGG - Intronic
1125883868 15:43214213-43214235 GAGTGGGGAGGAAGAGAAGATGG + Intronic
1126069626 15:44854555-44854577 GAGTGGGCTGGTAGGGCAGCGGG - Intergenic
1126088905 15:45034608-45034630 GAGTGGGCTGGTAGGGCAGCGGG + Intronic
1126222982 15:46236303-46236325 GAGAGAGTTGGGAGGGCCGAAGG + Intergenic
1127166803 15:56252089-56252111 GAGTGGGTAGGGAATGGATAAGG - Intronic
1127357887 15:58218468-58218490 GAGGAGGCAGGGAGGGGAGAAGG - Intronic
1127489031 15:59444641-59444663 GAGTGGGGAGGCAGTGCTGAAGG - Intronic
1127534206 15:59874838-59874860 GGGCAGGTAGGGAGGGCAGGAGG - Intergenic
1127657746 15:61071561-61071583 GGAGGGGTAGGGAGGGGAGAGGG + Intronic
1127817653 15:62625836-62625858 GAGTGGGCAGAGTGGGCAGATGG + Intronic
1128056711 15:64705002-64705024 GAGTAGGTAGGGATAGCTGAGGG - Intergenic
1128234719 15:66059668-66059690 GAGTGGAGAGGGTGAGCAGAGGG + Intronic
1128237491 15:66078041-66078063 GGTTGGGGAGGGAAGGCAGAGGG + Intronic
1128307392 15:66608537-66608559 GAGTGGGGAGGGAGGAGGGAAGG + Intronic
1128368396 15:67021349-67021371 GAGTTGGGAGGGGAGGCAGAGGG + Intergenic
1128677822 15:69624691-69624713 GAGAGGAGAGGGAGGGAAGATGG - Intergenic
1128926652 15:71662271-71662293 GAGGAGGAAGGGATGGCAGATGG + Intronic
1128998137 15:72311916-72311938 GCTTGGGTAGAGAGGGCAGATGG - Intronic
1129164607 15:73769310-73769332 GGGTGGGGTGGGAGGGTAGACGG + Intergenic
1129293053 15:74583352-74583374 GAGTGGGTAGGGTGGAGGGATGG + Intronic
1129328035 15:74812393-74812415 GAGGGGGCAGGGAGGAGAGAAGG + Intergenic
1129442153 15:75589024-75589046 GAGTGGGAGGGGAGGGGAGAGGG + Intergenic
1129464251 15:75715129-75715151 GAGGGGGTGGGGGGGGGAGATGG - Intergenic
1129712362 15:77826785-77826807 GAATGGGGAGAGGGGGCAGATGG - Intergenic
1129944075 15:79524204-79524226 GAGTGGGAAGGGAGGAGTGATGG - Intergenic
1130006854 15:80107860-80107882 GATGGGGTTGGGAGGGCAGCGGG + Intronic
1130136882 15:81188933-81188955 GAGTGCTTTGGGAGGACAGAAGG + Intronic
1130246709 15:82258012-82258034 GTGTGGGTTGGGAGGGAAGCTGG - Intronic
1130316318 15:82800004-82800026 GAATGTCCAGGGAGGGCAGAGGG - Intronic
1130453956 15:84085334-84085356 GTGTGGGTTGGGAGGGAAGCTGG + Intergenic
1130962512 15:88672059-88672081 GAGTGGGGAGGAAGGAAAGATGG + Intergenic
1130990936 15:88875232-88875254 GCGGGGGTGGGGAGGGGAGAAGG - Exonic
1131233179 15:90674186-90674208 GAGGGGTTAGTGATGGCAGAGGG + Intergenic
1131468147 15:92672412-92672434 GAGCGGGAGGGGAGGGCAGATGG - Intronic
1132061902 15:98699093-98699115 GAGAGGGAAAGGAAGGCAGAAGG + Intronic
1132156133 15:99496361-99496383 GTGTGGGCAGGGAGGGCAGAAGG + Intergenic
1132270631 15:100520772-100520794 GAGTGGGCAGGGTGGGGAGGAGG + Intronic
1132574619 16:658731-658753 GTGGGGGCAGGGAGAGCAGAAGG + Intronic
1132650801 16:1020708-1020730 GAGGGTGGAGGGAGGGCAGGCGG + Intergenic
1132651776 16:1024432-1024454 GAGGGGACAGCGAGGGCAGATGG + Intergenic
1132763189 16:1520932-1520954 GGGTGGGTATGGAGGGGACAAGG + Intronic
1132839283 16:1971015-1971037 GAGTGGGTGCAGAGGGCAGAGGG - Intergenic
1133489112 16:6249905-6249927 GAGTGGGGAGGGACAGCAGTTGG - Intronic
1134224877 16:12381906-12381928 GTGTGGGTGGGGTGGGTAGATGG - Intronic
1134275321 16:12770823-12770845 GAAAGGAAAGGGAGGGCAGAAGG + Intronic
1134371506 16:13630211-13630233 GGGAGGCTAAGGAGGGCAGATGG - Intergenic
1135057552 16:19243173-19243195 GAGTCAGTAGGGCGGGCAGTGGG + Intronic
1135873431 16:26173794-26173816 GGGAGGCTAAGGAGGGCAGATGG + Intergenic
1135875550 16:26196666-26196688 CAGTGGGCAGGGTGGGTAGAGGG + Intergenic
1135983753 16:27168588-27168610 GAGAAGGGAGGGAGGGAAGAAGG + Intergenic
1136014141 16:27384048-27384070 GTGTGGGTGGGGAGGGCAGAGGG - Intergenic
1136413714 16:30091396-30091418 GGGTGGGGAGGGAGGGGAGGAGG - Intronic
1136619223 16:31416991-31417013 GAGGGGGGAGGGAGGGGGGAAGG - Intronic
1136851351 16:33614903-33614925 GAGTGGGGAGGGACTGCTGAAGG + Intergenic
1137049953 16:35700647-35700669 GAGGGGGTAGGGATGGCATTAGG + Intergenic
1137407153 16:48198107-48198129 CCGTGGGTAGTGAGGGCAGTGGG + Intronic
1137498418 16:48990395-48990417 GAAGGGGAAGGGAGGGAAGAAGG + Intergenic
1137506906 16:49062010-49062032 GAGTGGGGAGGGTGGGAGGAGGG - Intergenic
1137540908 16:49361028-49361050 GAGAGGCTAGGCAGGGCAGTGGG - Intergenic
1137581181 16:49634522-49634544 GAGGGGGTGAGGAGGGCAGAGGG - Intronic
1137601592 16:49760026-49760048 GGGTGGGTGGGGTGGGTAGATGG + Intronic
1137601617 16:49760139-49760161 GGGTGGGTGGGGTGGGTAGATGG + Intronic
1137601637 16:49760228-49760250 GGGTGGGTGGGGTGGGTAGATGG + Intronic
1137613391 16:49833841-49833863 GGGAGGGCAGGGAGGGCAGGTGG + Intronic
1137742175 16:50789459-50789481 GAGTGGGTAGGGAGGGATCAGGG + Intronic
1137746494 16:50824281-50824303 GTGTGGGGAGAGAGGGAAGAGGG + Intergenic
1137991590 16:53162213-53162235 CAGTGGGAAGAGAGGCCAGAGGG + Intronic
1138242227 16:55436287-55436309 GAGAGAGGAGGGAGGGGAGAGGG + Intronic
1138414145 16:56861604-56861626 AAGTGGGTAGGGAGGCCTGTGGG + Intergenic
1138667747 16:58586357-58586379 GAGGGGGAGGGGAGGGCAGGGGG + Intronic
1138678626 16:58669567-58669589 GAGTGGGTTGTGGGGGAAGAGGG + Intronic
1139094989 16:63694617-63694639 GAGGAGGGAGGGAGGGCAGTAGG + Intergenic
1139332421 16:66203731-66203753 GACAGGGTAGGGAGGAGAGAGGG + Intergenic
1139654084 16:68376954-68376976 GAGCGGGTAGGGAAGGAAGCAGG - Intronic
1139925360 16:70482993-70483015 GAAGGGGTAGGGAGAGGAGAGGG - Intronic
1139991946 16:70946603-70946625 GACTGGATAGGGAGGGCACGAGG + Intronic
1140615563 16:76658343-76658365 GAGTGGGGAGGGAGGGAGGGAGG + Intergenic
1140732121 16:77865810-77865832 GAGTGGGAAGAGAAGGGAGATGG + Intronic
1141193623 16:81842873-81842895 GGGTAGGCAGGGAGGGCTGAGGG + Intronic
1141285296 16:82666391-82666413 GATTGGAGAGGGAGGGCTGATGG - Intronic
1141373559 16:83509037-83509059 GAATGAGAAGGGAGGGCAGAGGG - Intronic
1141382687 16:83589953-83589975 AAATGTGCAGGGAGGGCAGAGGG + Intronic
1141501473 16:84447416-84447438 TGGTGGGGAGGGAGGGAAGAAGG - Intronic
1141610587 16:85178876-85178898 GGGTGGGCAGGGAGGGATGAGGG + Intronic
1141632268 16:85294674-85294696 GGGTGGGGAGGGAGGGAAGGGGG - Intergenic
1141638897 16:85329840-85329862 GAATGTGTGGGGAGGGCGGAGGG + Intergenic
1141838975 16:86562151-86562173 GAGGGGAGAAGGAGGGCAGAAGG - Intergenic
1142068146 16:88074417-88074439 CAGTGGGTTGGGAGGGTAGGGGG + Intronic
1142212770 16:88816321-88816343 GATTGGGTGTGGAAGGCAGAAGG + Intronic
1142262659 16:89050159-89050181 GAGTAGGAAGGGTGGGCAGGGGG - Intergenic
1142359329 16:89619209-89619231 GAGGGAGCAGGGAGGGCAGGGGG - Intronic
1142553514 17:755961-755983 GAGCAGGAAGGGAGGGAAGAGGG - Intergenic
1142669161 17:1479571-1479593 GGGTGAGTGGGGCGGGCAGAGGG - Exonic
1142715642 17:1745519-1745541 GAGAGGGTGGGGAGGACCGAAGG + Intronic
1143309006 17:5972892-5972914 GATGGGGTTGGGAGGGTAGAGGG - Intronic
1143365443 17:6405494-6405516 CATAGGGTAGGGAGGGCAGGTGG + Intronic
1143610421 17:8014783-8014805 GGGTGGGCTGGGAGGGCAGCTGG + Intronic
1143624925 17:8104220-8104242 GTGTGGGGAGGAAGGGTAGAGGG + Intronic
1143977094 17:10837901-10837923 GAGATGGAAGGAAGGGCAGAAGG + Intronic
1143984074 17:10895958-10895980 CTGGGGGTAGGGAGGGCATAGGG + Intergenic
1144447828 17:15347429-15347451 GAGTGGAAGGGGAGGGCTGATGG + Intergenic
1144447851 17:15347514-15347536 GAGTGGAAGGGGAGGGCTGATGG + Intergenic
1144447863 17:15347557-15347579 GAGTGGAAGGGGAGGGCTGATGG + Intergenic
1144669086 17:17121803-17121825 GAGTGGGGAGGGTGGGAAGAGGG - Intronic
1144753552 17:17666387-17666409 GAGTGTGTAGGGTGTGCAGGTGG - Intergenic
1144839331 17:18175943-18175965 GAGAGGACAGTGAGGGCAGAGGG - Intronic
1145007131 17:19344295-19344317 GAGTCTGTGGGGTGGGCAGAAGG + Intronic
1145043892 17:19597057-19597079 GTGTGAGTTGGGAGGGCAGAAGG + Intergenic
1145065651 17:19759740-19759762 CAGGGGGCAGGGAGGGCAGAGGG - Intergenic
1145715330 17:27014157-27014179 GAGTGGGGAGGGATGGCATTGGG + Intergenic
1145905532 17:28514302-28514324 GAATGGGCAGGGAGGGGAGTGGG - Intronic
1145925625 17:28644855-28644877 GAGTGGGTAGGGTGGAGGGAGGG - Intronic
1145965104 17:28911393-28911415 GTGTGGTGAGGAAGGGCAGATGG + Intronic
1146441295 17:32897326-32897348 GAGAGGGGAGGGAGGGAAGAAGG - Intergenic
1146635613 17:34502103-34502125 GAATGGATCTGGAGGGCAGATGG + Intergenic
1146799491 17:35807249-35807271 GAGTGGGGAGGGTGGGAGGAGGG + Intronic
1146959791 17:36964302-36964324 GAGTGGGGATGGAGTGGAGATGG + Intronic
1147266397 17:39237315-39237337 GAGGAGGGAGGGAGGGCAGTGGG + Intergenic
1147598519 17:41732150-41732172 GAGTGGGCAGGGACAGGAGAGGG + Intronic
1147644875 17:42027568-42027590 GACTGGGTCAGGAGGGGAGAGGG - Intronic
1147685936 17:42286991-42287013 GAGTGGGAAAGGAGAGGAGAGGG + Intergenic
1147742081 17:42675499-42675521 GAGGGGGGAGGGAGGGAAGCAGG - Intronic
1147853728 17:43462470-43462492 GAGTGGGGAGGGAGAGCATTAGG - Intergenic
1147882889 17:43665352-43665374 GGGTGGGTGGGGAGGTCAGGAGG + Intergenic
1148478651 17:47945801-47945823 GTGCTGGTAGGGAGGGCAGGTGG + Intronic
1148673838 17:49433359-49433381 GAGAAGGAAGGGAGGGAAGATGG + Intronic
1148744707 17:49911792-49911814 GAGGAGGGAGGGAAGGCAGAGGG + Intergenic
1148789144 17:50163760-50163782 GGGTGGGAAGGGAGGTCACAGGG - Intergenic
1148897202 17:50845845-50845867 GAGAGGGCAGGGTGGGCAGGTGG + Intergenic
1149027901 17:52051086-52051108 GAGTGGGAAGGGAGGAAGGAAGG + Intronic
1149101562 17:52912476-52912498 GAGTTGGGAGGGTGGGAAGAGGG + Intergenic
1149279375 17:55085219-55085241 GAGGGGGGAGGGATGGCAGTGGG + Intronic
1150004699 17:61462541-61462563 GAGGGTGCAGGGAGGGGAGAGGG + Intronic
1150182910 17:63145303-63145325 GAGTGGGAAAGAAGGGTAGAAGG - Intronic
1150287758 17:63963557-63963579 GAATGGGTAGAGGGGGCACAGGG + Intronic
1150368520 17:64613738-64613760 GTGTGTGGAGGGGGGGCAGAGGG + Intronic
1150947615 17:69765406-69765428 GAGAGGGAGGGGAGGGAAGAAGG - Intergenic
1150984847 17:70184530-70184552 GAGGGGGAGGGGAGGGGAGAGGG - Intergenic
1151191559 17:72401960-72401982 GCGGGGGTAGGGAGGGGAGTGGG - Intergenic
1151365378 17:73613344-73613366 GCGGGGGTGGGGAGAGCAGAGGG - Intronic
1151389665 17:73777508-73777530 GGGTGGGTAGGGCGGGCAGCTGG - Intergenic
1151519585 17:74618625-74618647 GAGTGGGGAGGAAAGGCAGATGG - Intronic
1151579696 17:74971232-74971254 GAGTGGGGAGGCAGGGAGGAAGG - Intronic
1151599778 17:75099088-75099110 GAGTGGGTGGGGAGCGGGGAAGG + Intronic
1151660581 17:75516176-75516198 GGCTGGGCAAGGAGGGCAGAAGG - Intronic
1151820231 17:76493075-76493097 GAGTGGGCAGTCAGGACAGAAGG + Intronic
1151886469 17:76925859-76925881 CAGGGAGTAGGGAGGGCAGAGGG + Intronic
1152007473 17:77691610-77691632 GAGATGGCAGGGAGGGCAGCTGG + Intergenic
1152542248 17:80982227-80982249 TAGTGGGGAGGGAGGGAAGGTGG - Intergenic
1152851624 17:82639874-82639896 GTGTGGGTCGGGAGGGCTGCTGG + Intronic
1152975955 18:218474-218496 GAGTGGGCAACGAGGGCAAAGGG + Intronic
1153101322 18:1473219-1473241 GAGTGGGGAGGGAGAGAGGAAGG + Intergenic
1153225778 18:2898467-2898489 GAGCAGGAAGGGAAGGCAGAGGG + Intronic
1153299805 18:3582829-3582851 GAGGGGGGAGGGAGGAAAGAAGG - Intronic
1153824545 18:8863664-8863686 GAGCTGGTAGGGAAGGCAGCTGG - Intergenic
1153836750 18:8970484-8970506 GAGGGGGAAGGGAGGGAGGAAGG + Intergenic
1154275166 18:12952745-12952767 GGGTGGGAGGGGAGGGGAGAGGG - Intronic
1154303029 18:13211370-13211392 GAGTGGGGAGGGATAGCATAAGG + Intergenic
1154406901 18:14100667-14100689 GAGTGGGTATGGTGGGGAGAAGG + Intronic
1155017910 18:21863641-21863663 GAGTGGGCAGGGTGGGCTGTGGG + Intronic
1155241429 18:23867137-23867159 AGGAGGGTGGGGAGGGCAGAGGG - Intronic
1155930533 18:31702861-31702883 GAGTGGATATGGAGGGGAAATGG + Intergenic
1156490212 18:37491634-37491656 GAGTGAGGAGGGAAGGGAGAAGG + Intronic
1156520785 18:37720935-37720957 GATTGGGTATGAAGAGCAGAGGG - Intergenic
1156656219 18:39290480-39290502 GAGTAGGTAGGAAGCACAGAGGG + Intergenic
1156673226 18:39496184-39496206 AAGTGGGTAGAGATGGAAGAAGG - Intergenic
1156683914 18:39621542-39621564 GAGAGGGAATGGAGGGCAGTTGG - Intergenic
1156772203 18:40742152-40742174 GAGAGGGGAGGAAGGGCAGAGGG + Intergenic
1157349239 18:46870100-46870122 GTGTGGTTAGGGAGGGCACGGGG - Intronic
1157442219 18:47719752-47719774 GAGGTGGTAGGGAGGGCCCAGGG - Intergenic
1157531322 18:48423264-48423286 GAGTGGGTGGGGAAGGGAGGAGG - Intergenic
1157690508 18:49678208-49678230 GAGGCGGAAGGGAGGCCAGATGG - Intergenic
1157721831 18:49931352-49931374 GTGGGGCTTGGGAGGGCAGAGGG - Intronic
1157778809 18:50419570-50419592 GAGTAGGGAGGGTGGGAAGAGGG - Intergenic
1157894948 18:51457075-51457097 GGGTGGGTGGGGAGAGCTGAGGG - Intergenic
1157994023 18:52533402-52533424 GAGAGGCTAGGGATGGTAGAAGG - Intronic
1158103825 18:53861488-53861510 GAGGAAGAAGGGAGGGCAGAAGG + Intergenic
1158811282 18:61039319-61039341 GAGTGGGAGGGTAAGGCAGAGGG - Intergenic
1159186153 18:64977105-64977127 GATTGGGTAGGTTGGGCAGGGGG + Intergenic
1159272051 18:66165478-66165500 TAGTGGATATGGAGGCCAGAAGG + Intergenic
1159827104 18:73226977-73226999 CAGTGAGGAGGGAGGGCAGGGGG - Intronic
1160343541 18:78110471-78110493 GAGTGTGCACGGAGGTCAGAGGG - Intergenic
1160409749 18:78667731-78667753 GAGAGGGGTGGGAGGGCGGATGG - Intergenic
1160409855 18:78667993-78668015 GGGTGGGATGGGAGGGCAGATGG - Intergenic
1160627716 18:80223988-80224010 GGCTGGGTAAGGAGGACAGAGGG + Intronic
1160660103 19:293963-293985 CAGTGGGCAGGGAAGGCTGAGGG + Intergenic
1160663774 19:313393-313415 CAGGGGCCAGGGAGGGCAGAGGG - Intronic
1160714640 19:570684-570706 GGGTGGGTGGGGGGGGCGGAGGG + Intergenic
1160917317 19:1503446-1503468 GACAGGGGAGGGAGGGCAGTGGG + Intergenic
1160972459 19:1775634-1775656 GAGTGGGCATGGAGGGAGGAAGG - Exonic
1160975463 19:1790382-1790404 GAGAGGGAAGGGAGGGGAGGGGG - Intronic
1160978556 19:1806203-1806225 GTGTGGGGAGGGTTGGCAGAGGG - Intronic
1161093872 19:2377548-2377570 GAGAGGGGAGAGAGGGGAGAGGG - Intergenic
1161258896 19:3324720-3324742 TAGTGGGAAGAGAGGGAAGAAGG - Intergenic
1161313482 19:3607333-3607355 GGGTGGGGTGGGAGGACAGAGGG + Intergenic
1161403802 19:4080937-4080959 GAGGGGATGGGGAGGGCAGGAGG + Intergenic
1161468630 19:4445598-4445620 GAGAAGGTCAGGAGGGCAGAGGG + Exonic
1161649868 19:5477912-5477934 GAGAGGGCAGGGAGGGGACAGGG - Intergenic
1161761037 19:6173004-6173026 GTGTGGGGTGGGAGGGCAGGTGG + Intronic
1161978659 19:7619551-7619573 GAGGGGGTGGGGAGGGGGGATGG + Exonic
1161994953 19:7706293-7706315 GGGTGGGGAGGAAGGGCAGTAGG + Intergenic
1162310075 19:9900996-9901018 GAGGGGGGAGGGAGGGAAGGAGG + Intronic
1162533931 19:11252267-11252289 GGGCAGGTAGGGAGGGCTGAGGG + Intronic
1162736135 19:12748143-12748165 GAGGGGGTGGGGAGGGTGGAGGG - Exonic
1162842006 19:13363591-13363613 GAGTGGGGAGGGAGGGCTCAGGG + Intronic
1162955055 19:14092828-14092850 AAGTGGGCTGGGAGGGCTGAGGG + Exonic
1162958242 19:14111810-14111832 CAGTGGGTGGGGAGGGTGGAGGG + Intronic
1163093821 19:15041287-15041309 GAGGGGGGAGGGAGGGGGGAGGG - Intergenic
1163370502 19:16898595-16898617 GAGTGGGGAGTGAGTGCTGATGG - Intronic
1163491664 19:17620498-17620520 GGGTTGGTGGGTAGGGCAGAGGG - Intronic
1163609672 19:18294399-18294421 GAGGGTGTGGGGAGGCCAGAGGG - Intergenic
1164656130 19:29923358-29923380 GAGGAGGTAGTGAGGGCAAATGG + Intergenic
1164757386 19:30700328-30700350 GAGGGGGGAGGGAGGGAGGAAGG - Intronic
1165072407 19:33263254-33263276 GAGAGGGAGGGGAGGGCAGCGGG - Intergenic
1165487667 19:36105158-36105180 AAGTGGGGAGGGAGGGTAGAAGG + Intergenic
1165558213 19:36654788-36654810 GAGGAGGTAGAGATGGCAGAGGG - Intronic
1165828600 19:38719514-38719536 GAGTGGATAGTGAGGGAGGAAGG + Intronic
1166072434 19:40395011-40395033 CAGGAGGAAGGGAGGGCAGAGGG - Exonic
1166326466 19:42053936-42053958 GGGTGGGGAGGTGGGGCAGAGGG + Intronic
1166367543 19:42284919-42284941 GAGTGGTTAGTGATGGCAGGTGG + Intronic
1166633049 19:44424856-44424878 GAGTGGGTTGGTAGGGGAGATGG - Intronic
1166743640 19:45129655-45129677 GGGTGAGTGGGGAGGGCACAAGG - Intronic
1167062958 19:47162584-47162606 TAGGGGGTGGGGAGGGTAGAGGG - Intronic
1167200532 19:48062067-48062089 GAGTGGGAAGGGAGTGTTGATGG + Exonic
1167506012 19:49871509-49871531 GGGGAGGTAGGGAGGGCAGCTGG - Intronic
1167521674 19:49959313-49959335 GAGTCCATTGGGAGGGCAGAGGG - Intronic
1167523709 19:49971409-49971431 GAGTCCATTGGGAGGGCAGAGGG + Intergenic
1167756358 19:51415851-51415873 GAGTCCATTGGGAGGGCAGAGGG - Intronic
1168062428 19:53900386-53900408 GGGTGGGTGGGGACGTCAGAAGG - Intronic
1168174248 19:54611927-54611949 GAGTGGGGAGAGAGGGAGGAGGG + Intronic
1168433914 19:56302707-56302729 GAGGTGGGAGGGAGGGAAGAAGG - Intronic
1168705628 19:58468769-58468791 GTCTGGTCAGGGAGGGCAGAGGG + Intronic
925281833 2:2690419-2690441 GTGTGAGTAGGGAGGAGAGAGGG - Intergenic
926087332 2:10028672-10028694 GAGGGGAAAGGGAGGGGAGAAGG - Intergenic
926223777 2:10953316-10953338 GAGTGGGTAAAGAGGGGATAGGG + Intergenic
926370834 2:12177276-12177298 GTGTGGGGAGGGAGGGCACACGG - Intergenic
926858741 2:17285273-17285295 GGGTGGGATGGGAAGGCAGAGGG + Intergenic
927067164 2:19484802-19484824 GAGAGGGTAGGGAGAGTAAAAGG + Intergenic
927121701 2:19970470-19970492 GATTGAATTGGGAGGGCAGAGGG - Intronic
927264668 2:21131953-21131975 GAGAGGGTAGGGAGGGGCTAGGG + Intronic
927279174 2:21288534-21288556 GAGTGGGAGGGGAGGGGAGGGGG + Intergenic
927612671 2:24557540-24557562 AAGGGGGAAGGGAGGGGAGAAGG - Intronic
927877758 2:26670263-26670285 GACTGGGGAGGAAGGGCAGGGGG + Intergenic
927928152 2:27027110-27027132 CAGGGGGTGGGGAGGGCAGGTGG - Exonic
927964719 2:27262050-27262072 GGGTGGGCAGGGAGGTCGGACGG + Intronic
927966533 2:27273438-27273460 CACTGGGTAGAGAGAGCAGAAGG - Intronic
927966573 2:27273804-27273826 CACTGGGTAGAGAGAGCAGAAGG - Intronic
928111844 2:28516895-28516917 GCGTGTGTATGGAGGGGAGAGGG + Intronic
928129247 2:28637761-28637783 GAGTGGGCAAGGAGGTGAGAAGG - Intronic
928331313 2:30360025-30360047 GAGTGTGGACAGAGGGCAGAGGG + Intergenic
928372429 2:30750305-30750327 GAGTGGGGAGGGTGGGAGGAGGG + Intronic
928796796 2:35033161-35033183 CAGTGGGTAAGAGGGGCAGAGGG + Intergenic
928926537 2:36585505-36585527 GGGTGGGGAGGGAGAGCAGAAGG + Intronic
930130963 2:47850148-47850170 GAGTGGGTATGGTGGGCTGGGGG + Intronic
930692929 2:54383012-54383034 GAGGGGAGAGGGAGGGCAGAGGG - Intronic
931094001 2:58919422-58919444 GATTGGGTTGGTAGGGGAGAAGG - Intergenic
931344319 2:61432232-61432254 GAGTGGCCAAGGTGGGCAGATGG + Intronic
931455470 2:62406726-62406748 GTTTGGATAGTGAGGGCAGAGGG + Intergenic
931784752 2:65608822-65608844 GAGTGGGTAGGAAGGCAGGAGGG + Intergenic
931808950 2:65835311-65835333 GACTGGAAAGGAAGGGCAGATGG + Intergenic
932142012 2:69287392-69287414 ATGTGGGTAGGGAGGGAACAGGG - Intergenic
932449489 2:71800491-71800513 CAGTGGGAAGGCTGGGCAGATGG - Intergenic
932524288 2:72446620-72446642 GAGTGGGGAGAGTGGGAAGAAGG + Intronic
932622967 2:73277020-73277042 GAGAGGGCAGGGTGGGGAGAAGG - Intronic
932692096 2:73921705-73921727 GATGGGGAAGGGAGGTCAGATGG - Intergenic
932875067 2:75442805-75442827 AAGTGGGAAGGGTGGGAAGAGGG + Intergenic
933234511 2:79850283-79850305 GAGGGGGGAGGGAGGGAGGAAGG - Intronic
933368149 2:81381061-81381083 GAGGTGGAAGGGAGGTCAGATGG + Intergenic
933684584 2:85133373-85133395 GAGCGGGGAGGGAGGGAGGAGGG - Intergenic
933720136 2:85392471-85392493 GAGGGGGTCCGGAGGACAGAAGG - Intergenic
934181377 2:89624967-89624989 AATTACGTAGGGAGGGCAGAAGG + Intergenic
934291679 2:91699209-91699231 AATTACGTAGGGAGGGCAGAAGG + Intergenic
934504641 2:94880686-94880708 GGGTGGGCAGGGAGAGCAGAGGG - Intergenic
934576822 2:95407169-95407191 CAGTGACTAGGGAGGGCAGTGGG - Intronic
934639042 2:96015337-96015359 CAGTGACTAGGGAGGGCAGTGGG - Intergenic
934640326 2:96023906-96023928 GAGGAGGTAGGCAGGGCAGTTGG - Exonic
934712746 2:96526625-96526647 GAGTGGGTGGGGTGGGCCCAGGG - Intergenic
934793325 2:97081510-97081532 GAGGAGGTAGGCAGGGCAGTTGG + Intergenic
934794606 2:97090075-97090097 CAGTGACTAGGGAGGGCAGTGGG + Intronic
934856195 2:97731904-97731926 CAGTGAGGAGGGAGGGCAGCTGG - Intronic
934987795 2:98900150-98900172 CAGTGGGAAGGGGAGGCAGATGG + Intronic
935150841 2:100433780-100433802 GAGTGTGTTGGGGAGGCAGAGGG - Intergenic
935266999 2:101403238-101403260 AAGTGGGTAAGGAGGCCAGCTGG + Intronic
935282920 2:101534557-101534579 AGGGGGGTAGGGAGGGCAGGTGG + Intergenic
935327363 2:101948949-101948971 GAGTGGGTGGGAAGGGCATTGGG - Intergenic
935422773 2:102887028-102887050 GAGGGGGGAGGGAGGGGAGGGGG - Intergenic
935796438 2:106645642-106645664 GGGTGGGAAGGGAGGGGAAAAGG + Intergenic
935979548 2:108613487-108613509 GTGTAGGGAGGGAGGGCAGAAGG - Intronic
935999363 2:108811143-108811165 AGGGGGGTAGGGAAGGCAGAGGG - Intronic
936376553 2:111946090-111946112 GAGTGAGTGGGGAAGACAGAGGG + Intronic
936562358 2:113552096-113552118 GGGTGGGCATGGAGGGGAGAGGG - Intergenic
936728574 2:115354321-115354343 GAGGGGGTAGGGAGGGAATGTGG - Intronic
937044332 2:118843287-118843309 GGGTGGGGACCGAGGGCAGAAGG + Intronic
937190202 2:120088433-120088455 GAGTGGGGAGGGTGGGAAGAGGG + Intronic
937274974 2:120678557-120678579 GAGTTGGTCGGGGGTGCAGATGG + Intergenic
937347752 2:121137174-121137196 CAGAGGCTTGGGAGGGCAGAGGG - Intergenic
937639766 2:124198559-124198581 GAGTGGGGAGAGAGGGAGGAGGG - Intronic
938052743 2:128190234-128190256 GAGAAGGTGGGGAGGGCACAAGG - Exonic
938107650 2:128544378-128544400 GAGTGGGTAGGTGGGGCATGTGG + Intergenic
939417373 2:141916767-141916789 GAGTGGGAAGGGAGAGAGGACGG + Intronic
939618394 2:144386919-144386941 GAGGGGGTGGGGGGGGCAGGGGG - Intergenic
939975362 2:148710857-148710879 GAGTGGGGAGGGATGGCATTAGG + Intronic
940384746 2:153057809-153057831 TAGTGGGGAGGGAGGGCATGGGG - Intergenic
940497632 2:154453545-154453567 CAGGGGATAGGGAAGGCAGATGG - Exonic
940522354 2:154767315-154767337 GAGTGGGGAGGGATGGCATTAGG - Intronic
940884935 2:158981110-158981132 GAGGGGGTCGGAAGTGCAGAGGG - Intronic
941268960 2:163401277-163401299 GTGTTGGTATGGAGGGTAGAAGG - Intergenic
941483442 2:166047343-166047365 GAGGGGGTAGATAGGGCTGAAGG + Intronic
941604496 2:167580555-167580577 GGCTGGGTAGGGAGGACACAGGG - Intergenic
942210887 2:173668719-173668741 GGTTGGGAGGGGAGGGCAGAGGG + Intergenic
942229591 2:173847691-173847713 GAGGGGCTCTGGAGGGCAGAAGG + Intergenic
942333905 2:174859721-174859743 GAGAGGATAGGGAAGTCAGAAGG - Intronic
943031650 2:182692530-182692552 GAGTGGGTAGGGATAGCATTAGG + Intergenic
943766928 2:191673059-191673081 GAGTGGGGAGGGATAGCAGTAGG + Intergenic
944361749 2:198865332-198865354 GGGTGGGCAGGGAGGGCAGCTGG - Intergenic
944824104 2:203463525-203463547 CAGTGGTTAGGGAAGGCAGTGGG + Intronic
944912776 2:204326710-204326732 GAGTGTGTATTGAGGGTAGAGGG + Intergenic
945412507 2:209528092-209528114 GGGTGGGCAGGGGGGGAAGATGG - Intronic
945689809 2:213019700-213019722 CACTGGGTAGGTAGAGCAGAGGG - Intronic
945906295 2:215597307-215597329 GGGTGTGGAGGAAGGGCAGAGGG - Intergenic
946033425 2:216723298-216723320 GAGTGGGGTTAGAGGGCAGAAGG - Intergenic
946074923 2:217065828-217065850 GAGGAGGCTGGGAGGGCAGATGG - Intergenic
946109737 2:217404111-217404133 GGGAGGGGAGGGAGGGAAGAAGG - Intronic
946179987 2:217943180-217943202 TAGTGGTTGGAGAGGGCAGAGGG + Intronic
946452099 2:219789078-219789100 GAGTGGGGAGGGAAGGAGGAAGG - Intergenic
946519122 2:220446694-220446716 GAGGAGGGAGGGAGGGGAGAAGG - Intergenic
947179421 2:227399014-227399036 GAGGGAGGAGGGAGGGAAGAAGG + Intergenic
947406242 2:229780545-229780567 GACTGAGCAGGGTGGGCAGAGGG - Intronic
947464349 2:230327692-230327714 GTGAAGGTAGAGAGGGCAGAGGG - Intronic
947749727 2:232525964-232525986 GGGTGGGGAGGGAGGGCCGGGGG - Intergenic
947927658 2:233935769-233935791 AAGTGGGTGGGGCAGGCAGAAGG + Intronic
948201941 2:236135905-236135927 GAGGGGGCTGGGAGGGCAGCAGG - Intergenic
948542330 2:238699531-238699553 GAGTGGGCGGTGAGGGGAGAGGG + Intergenic
948871955 2:240805113-240805135 GAGAGGGGAGGGAGGGCGGAGGG + Intronic
948871968 2:240805142-240805164 GAGTGGGGAGGGAGGCGGGAGGG + Intronic
948917011 2:241039528-241039550 CGGTGAGGAGGGAGGGCAGAGGG + Intronic
948990988 2:241553916-241553938 GAGTGGGGAGGGAGGTCTGCCGG - Intergenic
949033825 2:241807601-241807623 GAGGGGGGAGGGAGGGAAGGTGG - Intergenic
949033941 2:241807882-241807904 GAGGGGGGAGGGAGGGAAGGTGG - Intergenic
1168750321 20:277389-277411 GAGGGGTTAGGGAGGTCAGCAGG + Intronic
1168771132 20:417687-417709 GAGTGGGAAGGGAGGGCCAGAGG - Intronic
1168963576 20:1885453-1885475 GAGTGGTCAGGGTGGGCAGTGGG - Intergenic
1169002376 20:2177373-2177395 GAGTGGGGCAGGAGGGCACAGGG - Intergenic
1169066163 20:2695213-2695235 GAGTGGGTGAGGAGTGCTGATGG + Intronic
1169066606 20:2697568-2697590 AAGGGGGTAGGGAGAGCAGAGGG + Intronic
1169208461 20:3752905-3752927 GGGTGGATGGGGAGGCCAGAGGG + Exonic
1169241620 20:3986265-3986287 GAGTGAGGAGGGAGGGAGGAAGG - Intronic
1169297013 20:4408731-4408753 GAGTGGGTTGTGAGGCTAGAAGG - Intergenic
1169355502 20:4901620-4901642 CAGTGGGAGGGGAGGGCAGCCGG - Intronic
1170220365 20:13935620-13935642 GAGTGAGTGGGGTGGGGAGAGGG + Intronic
1170316289 20:15044470-15044492 GAGTGGGTCTGGAGGGCAAATGG - Intronic
1170464659 20:16611661-16611683 GAGTGAGCAGGAAGGGAAGATGG + Intergenic
1170594078 20:17792464-17792486 GAGGGGGCAGGGAGGCCAGAGGG - Intergenic
1171002310 20:21426815-21426837 CAGTGGAGAGGGAGAGCAGAAGG - Intergenic
1171022879 20:21602698-21602720 CTGTGGGTAGGGAGGGCTGGAGG + Intergenic
1171042278 20:21776557-21776579 GTGTGGGTCTGGAAGGCAGAAGG + Intergenic
1171255976 20:23689227-23689249 GAGTGGGGAGGAGGGGGAGATGG - Intergenic
1171263324 20:23751124-23751146 GAGTGGGGAGGAGGGGGAGATGG - Intronic
1171360228 20:24582137-24582159 CAGTGGGGAGGGAGTGCAGCAGG - Intronic
1171448853 20:25222506-25222528 GAGGGGGAATGTAGGGCAGATGG + Intronic
1172241005 20:33412457-33412479 GTGGGGGAAGAGAGGGCAGAGGG + Intronic
1172280437 20:33703983-33704005 TAGGGGTTGGGGAGGGCAGAGGG - Exonic
1172285086 20:33734552-33734574 GAGTGGGGAGGGGGAGCAGTGGG + Intronic
1172728538 20:37066892-37066914 GACAGTGTAGGAAGGGCAGAGGG + Intronic
1172766751 20:37355224-37355246 GTGGGGGTGGGGAGGGCAGGAGG - Intronic
1172995141 20:39064834-39064856 GAGGGGGTGGGGAGGCCAGGTGG - Intergenic
1173075577 20:39815868-39815890 GAGTTGGTGTGGAGGGAAGAAGG - Intergenic
1173460992 20:43243281-43243303 CACTGGGCAGCGAGGGCAGATGG + Intergenic
1173661152 20:44734668-44734690 GAGGGGGTTGAGAGGGTAGAGGG - Intergenic
1173803513 20:45909889-45909911 GAGTGGGTCAGGAGGGCTGGAGG - Intronic
1173870877 20:46341473-46341495 GAGTGGGCAGGGAGGGACGGGGG - Intergenic
1174236034 20:49092663-49092685 GCAGGGGAAGGGAGGGCAGAGGG + Intronic
1174804492 20:53593862-53593884 GAGGGGGCGGGGAGGGCGGAGGG + Intronic
1174843443 20:53920998-53921020 GAGGAGGCAGGGAGGGGAGAAGG - Intergenic
1175020206 20:55838942-55838964 GAGTATGGAGGAAGGGCAGATGG - Intergenic
1175224932 20:57439342-57439364 GAGTGGGGTGGCACGGCAGAGGG - Intergenic
1175238098 20:57526640-57526662 GAATGGATAAGGAGGGGAGAAGG + Intergenic
1175238161 20:57526810-57526832 GAATGGGTAAGGAGGGAAGAAGG + Intergenic
1175259912 20:57667801-57667823 GTGGGGGTAGGTAGGGGAGAGGG - Intronic
1175292065 20:57882542-57882564 AAGTGGGGAGGGATGGCTGACGG + Intergenic
1175373029 20:58505508-58505530 GAGAGGGAAGGGAGGTCAGGAGG - Intronic
1175487291 20:59355448-59355470 GAGAGGGGAGAGAGGGGAGATGG - Intergenic
1175852377 20:62100440-62100462 GAGTGAGCGGGGAGGGCAGTCGG - Intergenic
1175943390 20:62548056-62548078 GACGGGGTAGAGGGGGCAGAAGG - Intergenic
1175943403 20:62548092-62548114 GAGACGGGAGGGAGGGGAGAGGG - Intergenic
1175961032 20:62636438-62636460 GTGCGGGTAGGGAGGGGAGGTGG + Intergenic
1176057093 20:63154700-63154722 GAGGGAGGAGGGAGGGCAGAGGG - Intergenic
1176057110 20:63154752-63154774 GAGGGAGGAGGGAGGGCAGAGGG - Intergenic
1176102168 20:63369595-63369617 GGGTGGGCAGGGTGAGCAGAGGG - Intronic
1176125545 20:63473007-63473029 GAGGGGGAGGGGAGGGCAGGGGG + Intergenic
1176283238 20:64327398-64327420 GAGTGAGCGGGGAGGGGAGATGG - Intergenic
1176304476 21:5115965-5115987 CAGTGGGTGGGGAGGGCCGAGGG + Intergenic
1176715612 21:10346862-10346884 GAGTGGGTGGGGAGGGCAAGAGG - Intergenic
1176731105 21:10498239-10498261 AATTACGTAGGGAGGGCAGAAGG - Intergenic
1177155540 21:17497827-17497849 GAGTGGGGAGGGATGGCATTGGG - Intergenic
1177272192 21:18864105-18864127 GAGGGTGTAGGGTGGGAAGAGGG - Intergenic
1177664826 21:24141176-24141198 GAGTGGGGAGGGAAGGAGGAGGG + Intergenic
1177942804 21:27432041-27432063 GAGTGGGTAGGGATAGCATTAGG - Intergenic
1178408400 21:32344860-32344882 GAGTGGGTAGTGTGGGGAGCAGG - Intronic
1178477540 21:32950479-32950501 CATTGGGTGGGGCGGGCAGAGGG + Intergenic
1178512353 21:33216078-33216100 GGGTGGCTAAGGAGGGCAGCTGG + Intergenic
1178518554 21:33268112-33268134 GAGGGGGTAGGGTGGGCACATGG - Intronic
1178769239 21:35487249-35487271 GAGTGGGTAGGGAGGGCAGAAGG + Intronic
1179315647 21:40241996-40242018 GAGTGGGGAGGGTGGGAGGAGGG + Intronic
1179428194 21:41298938-41298960 GAGTGGGGAGGGAAGGCAGGGGG + Intergenic
1179595024 21:42437642-42437664 GAGTGGGAAGGGAGTGGAGGTGG + Intronic
1179714467 21:43280260-43280282 GAGGGGGAAGGGAGGGGAGGTGG + Intergenic
1179714542 21:43280438-43280460 GAGGGGGAAGGGAGGGGAGGTGG + Intergenic
1179714564 21:43280488-43280510 GAGGGGGAAGGGAGGGGAGGTGG + Intergenic
1179792658 21:43764478-43764500 GTGGGGGTGGGGACGGCAGATGG + Intergenic
1179837719 21:44048322-44048344 CAGAGGGTGGGGAGGGCAGGGGG - Intronic
1179852580 21:44146065-44146087 CAGTGGGTGGGGAGGGCCGAGGG - Intergenic
1179893926 21:44351019-44351041 GAGAGGGCAGGGAGGCCACACGG + Intronic
1180076928 21:45467756-45467778 GAGTGGGCGGGCAGGGCACAGGG + Intronic
1180569568 22:16702511-16702533 GAGTGGGTTGTGAGGACAGATGG - Intergenic
1180602735 22:17033091-17033113 GAGTGGGTGGGGAGGGCCAGAGG + Intergenic
1180868465 22:19133118-19133140 CACTGGGTGGGGAGGGCACACGG - Exonic
1180996979 22:19970579-19970601 GAGTGGGGTGGGGGGGCAGGAGG + Exonic
1181081628 22:20419471-20419493 GAGTGGGAAGGGTGGGAGGAAGG - Intergenic
1181138448 22:20786211-20786233 GGGTGGGTAGGAAGGGCAAGTGG - Intronic
1181387714 22:22557900-22557922 GGGTGGGGAAGGAGGGGAGATGG + Intronic
1181466875 22:23115145-23115167 GAGTGGACAGGGAGACCAGATGG + Intronic
1181523062 22:23460282-23460304 GTGTAGGGAGGGAGGGGAGAGGG + Intergenic
1182050698 22:27310593-27310615 GAGGGGGGAGGGAGGGAAGGAGG + Intergenic
1182050708 22:27310612-27310634 GAGGGGGGAGGGAGGGAAGGAGG + Intergenic
1182253165 22:29018071-29018093 GTGTGGGAGGGGAGGGCGGACGG + Intronic
1182415853 22:30221108-30221130 GAGGGCAAAGGGAGGGCAGACGG + Intergenic
1182969379 22:34558620-34558642 GAGTGGGGAGGGATGGCATTAGG - Intergenic
1183093335 22:35538444-35538466 AAGTGGGTGGGGAGGGGGGAAGG + Intergenic
1183305956 22:37083354-37083376 GAGTGGGGAGGGTGGGCAAGGGG - Intronic
1183325338 22:37188313-37188335 GAGGGCGGAGGGAGGGCGGAGGG + Intronic
1183405241 22:37627319-37627341 GAGTGTGGAGGGAGAGCTGAAGG + Intronic
1183535517 22:38398544-38398566 GAGGGGGCGGGGAGGGCGGAGGG + Intergenic
1183615802 22:38944663-38944685 GAGAGGGGAAGGAGGGCAAAAGG - Intergenic
1183640353 22:39088946-39088968 GAGGGAGAAGGCAGGGCAGAGGG - Intergenic
1183698772 22:39438103-39438125 GAGTGAGGAGGGAGGGAAGGGGG - Intergenic
1183751492 22:39723598-39723620 GAGAGGAGAGGGAGGGCAGGAGG - Intergenic
1183845010 22:40535763-40535785 AAGATGGTAGGAAGGGCAGAGGG + Intronic
1183943162 22:41308069-41308091 GACTGGGTAGGAAGAGCAGTGGG - Intronic
1184035301 22:41915137-41915159 GAGAGAGGAGGGAGGGCGGAAGG + Intergenic
1184657676 22:45950013-45950035 GATTGGGGAGGGGGCGCAGATGG - Exonic
1184817164 22:46881126-46881148 GGGTGGGTAGGGATGGCAGTAGG - Intronic
1184885530 22:47342831-47342853 GATTGGGTAGGGAGGGGATTGGG - Intergenic
1184924195 22:47625930-47625952 GTGGGAGTATGGAGGGCAGAGGG - Intergenic
1184983681 22:48114756-48114778 GAGTGGGAAGGGCTGGCAGGAGG - Intergenic
1185102571 22:48849575-48849597 GAGGGAGCTGGGAGGGCAGATGG + Intronic
1185229815 22:49673571-49673593 GAAGGGGGAGGGAGGACAGAGGG + Intergenic
949284380 3:2383762-2383784 GAGAGGGAAGGGAGAGGAGAGGG - Intronic
949607349 3:5668289-5668311 GAGAGGGGAGGGTGGGAAGAGGG + Intergenic
950016989 3:9761358-9761380 GGGAAGGAAGGGAGGGCAGAGGG + Intronic
950096116 3:10331678-10331700 GGGTAGGCAGGGAGGGGAGATGG - Intronic
950153871 3:10708128-10708150 GAGTGAGCAGGGAGGGCGGGAGG - Intergenic
950465803 3:13153097-13153119 GAGAGGAGAGGGAGGGGAGAGGG - Intergenic
950726779 3:14922020-14922042 GAGTGGGTGGGCAGGGCCCACGG + Intronic
950750373 3:15123558-15123580 ATGTGGGCAGGCAGGGCAGATGG + Intergenic
950967965 3:17159538-17159560 GAGTGGGTGAGGATGGCAGAGGG - Intronic
951355067 3:21656220-21656242 GTGTGGGTAGGCAGATCAGATGG + Intronic
951537209 3:23751025-23751047 GTGTGGGTAGGGAGAGAGGAAGG - Intergenic
951623165 3:24628970-24628992 GAGTGGTTGGGGAAGGCTGAGGG - Intergenic
951709318 3:25573175-25573197 GAGTGGGCAGGGAAGGAAGGCGG - Intronic
952107530 3:30087572-30087594 GAGGAGGGAGGGAGGACAGAGGG - Intergenic
952231123 3:31432150-31432172 GAGTGGGAGGGGAGTGCAGTGGG - Intergenic
952237536 3:31495587-31495609 GAGTGGCTTGGGAGAGCTGAGGG + Intergenic
952520851 3:34155878-34155900 CAATGGGTAGGGAGAGCAGCGGG - Intergenic
952619816 3:35324215-35324237 GAGTGGGGAGGGTGGGAGGAGGG + Intergenic
952755039 3:36858507-36858529 GAGTGGTCAGGGAGGGTTGATGG - Intronic
952925627 3:38317257-38317279 GAGCAGGGAGGGAGGGCAGGGGG - Intronic
953098866 3:39806704-39806726 GAGAGGGAAGGGAGGGAGGAAGG + Intergenic
953135112 3:40175497-40175519 GAATGGGAAAGGAGGGCAGCAGG - Intronic
953227694 3:41035441-41035463 GAGTGGGGAAGAAGGGGAGAAGG - Intergenic
953389966 3:42528220-42528242 GGGTGGGGTGGGAGGGAAGAGGG - Intronic
954051689 3:47984590-47984612 GGGAGGGTGGGGAGAGCAGATGG + Intronic
954573548 3:51662372-51662394 GAGTGGCCAGGGAGAGAAGAAGG - Intronic
954916147 3:54149973-54149995 GAGGGGGAGGGGAGGGAAGAAGG - Intronic
955252161 3:57294587-57294609 GAATGAGAAGGGAGGGAAGAAGG + Intronic
955446890 3:59021482-59021504 GTGTAGGCAGGGTGGGCAGATGG - Intronic
956203920 3:66736664-66736686 GAGGCAGTAGGGAGGGAAGAGGG - Intergenic
956737247 3:72247271-72247293 GCGTGGGTGGGGAGGGTGGAAGG - Intergenic
956758235 3:72411718-72411740 GAGTGGGGAGGGAGGGCATTTGG - Intronic
956784854 3:72633878-72633900 GACTGGGTAGGGGGAGCATAGGG + Intergenic
957467081 3:80608087-80608109 GAGGGGGAAGGGAGGGAAGGAGG + Intergenic
957794188 3:84981671-84981693 GAATGGGAAGGGAGGGAAGGAGG - Intronic
957857643 3:85898443-85898465 GAGTGGGCAGAGAAGGCAAAGGG - Intronic
957989882 3:87614441-87614463 GTGTGGTTAGGGAAGGCAGGGGG + Intergenic
958501679 3:94918803-94918825 AATTGGGAAGGCAGGGCAGAGGG + Intergenic
958537168 3:95418558-95418580 GTGTGGGTAGGGAGGGAACCCGG + Intergenic
958723089 3:97870285-97870307 GAGTGGGGAGGATGGGAAGAGGG - Intronic
959006836 3:101029135-101029157 GAGTGTGGAGGGTGGGAAGAGGG - Intergenic
959087599 3:101868105-101868127 GAGGGGAGAGGGAGGGAAGAAGG - Intergenic
959145205 3:102535676-102535698 GAGAGAGTAGGGAAGGCAGGAGG - Intergenic
959156643 3:102674497-102674519 CAGTGGCTGGGGCGGGCAGAAGG - Intergenic
959714220 3:109414966-109414988 GAGTGGGTAGGGATTACAAAAGG + Intergenic
959899871 3:111648739-111648761 GAGTGGGTAGTGGGGGAAGGAGG - Intronic
960204978 3:114886066-114886088 GAGTGGGTAGAGGGAGCAGAAGG - Intronic
960431902 3:117579727-117579749 GAGTGGAGAGGGAGGTGAGAGGG + Intergenic
960591364 3:119368944-119368966 GGGTGGGTAGAGAGGGGAGAGGG + Intronic
960923665 3:122774637-122774659 GTGTGGGAAGGGAGGGCAAGGGG + Intronic
960934890 3:122892758-122892780 AAGAGGGAAGGGAGGGAAGAAGG - Intergenic
960965752 3:123103614-123103636 GAGGGAGAAGGAAGGGCAGAGGG - Intronic
961094482 3:124142745-124142767 GAGTGGGTGGGGGGTGGAGATGG - Intronic
961247957 3:125473179-125473201 GAGCGGGGAGGGAGGGTGGAAGG - Intronic
961479757 3:127172123-127172145 GTATGGGGAGGGAGAGCAGAGGG + Intergenic
961871027 3:129988410-129988432 GAATGGGTCTGGAGGGCAAATGG - Intergenic
961909623 3:130301264-130301286 GTGGGGGCTGGGAGGGCAGAGGG + Intergenic
961999939 3:131285282-131285304 GAGTGGGTAGAGAGAGAAGGTGG + Intronic
962222205 3:133573625-133573647 GAGTGGGGAGGGGAGGGAGAGGG - Intergenic
962438282 3:135386531-135386553 GAGTGGGGAGGGATGGCATTAGG + Intergenic
963121541 3:141780849-141780871 GAGTTGGAAAGGAGGGGAGAGGG + Intronic
964242343 3:154611261-154611283 GAGGGGGAAGGGAGGGAAGAAGG - Intergenic
965652238 3:170946824-170946846 GAGAGAGGAGGGAGGGAAGAGGG + Intergenic
965652262 3:170946902-170946924 GAGAGAGGAGGGAGGGGAGAGGG + Intergenic
965888429 3:173478403-173478425 GAGTGGGGAGGGAGAGCATCAGG + Intronic
966086748 3:176077632-176077654 AATTGGGAAGGGAGGGAAGAAGG + Intergenic
966140630 3:176752384-176752406 GAAAGGGAAGGGAGGGGAGAAGG + Intergenic
966140657 3:176752504-176752526 GAGCGGGGAGGGAGGGAGGAAGG + Intergenic
966603813 3:181801698-181801720 GAGTGGGGAGGGAGGGAGGAAGG + Intergenic
966715740 3:183011400-183011422 GGGAGGGTAGGGAGGGGACAGGG + Intergenic
966989277 3:185212429-185212451 GAGTGGGAAGGGAGTGTAGAAGG - Intronic
967116483 3:186344590-186344612 GAGTGGGGAGGGTGGGAGGAAGG + Intronic
967299676 3:188000592-188000614 GAGGGGGAAGGCAGGGGAGAGGG + Intergenic
967706530 3:192657491-192657513 GAGAGGGGAGGGAGGTGAGAAGG + Intronic
967869053 3:194214540-194214562 CAGTGCATAGGGAGGGCAGCTGG + Intergenic
968052221 3:195662975-195662997 GGGTGGGTGGGGAGGGTAGATGG - Intergenic
968103589 3:195985363-195985385 GGGTGGGTGGGGAGGGTAGATGG + Intergenic
968301891 3:197622956-197622978 GGGTGGGTGGGGAGGGTAGATGG + Intergenic
968909292 4:3469419-3469441 GGGTGGGTGGGCAGGGCTGATGG + Intronic
968924686 4:3541028-3541050 GAGGGGGGAGGGAGGACAGAGGG - Intergenic
968943461 4:3651427-3651449 GCGTGGGCAGGGCAGGCAGAGGG + Intergenic
969036938 4:4262027-4262049 GGGTGGGGATGGAGGGCACAAGG - Intergenic
969240587 4:5894456-5894478 GACTGGGTGGGGACTGCAGAGGG + Intergenic
969495309 4:7523026-7523048 GAGGGAGGAGGGAGGGAAGAGGG - Intronic
969777858 4:9372343-9372365 GAGTGGGGAGGGAGTGCATCAGG + Intergenic
970444520 4:16112703-16112725 GGGAGGGGAGGGAGGGAAGAAGG + Intergenic
970444529 4:16112724-16112746 GGGAGGGGAGGGAGGGAAGAAGG + Intergenic
970444538 4:16112745-16112767 GGGAGGGGAGGGAGGGAAGAAGG + Intergenic
970637148 4:18021883-18021905 GAGGGGGAGGGCAGGGCAGAGGG - Intergenic
972267071 4:37471707-37471729 GAGAGGGGAGGGAAGGGAGAAGG + Intronic
972904652 4:43729673-43729695 GGGTCGGGAGGGAGGGGAGAGGG + Intergenic
973088501 4:46100321-46100343 GAGTGGGGAGGGTGGGAGGAGGG + Intronic
973213516 4:47642755-47642777 AAGAGTGTAGGGAAGGCAGAGGG + Intronic
973342031 4:49015274-49015296 GAGTGGGGAGGAGGGGCATAAGG - Intronic
973532906 4:51850943-51850965 GAGTTGTGGGGGAGGGCAGAGGG + Intronic
973533987 4:51862275-51862297 GAGTAGGTCTGCAGGGCAGAGGG - Intronic
973892860 4:55385371-55385393 GAGGGGGCAGTGAGGGGAGAAGG - Intergenic
974020548 4:56688320-56688342 GAAGGGGAAGGGAGGGAAGAAGG + Intergenic
974079807 4:57200290-57200312 AAGTTGGTAGGGACGGCACAAGG - Intergenic
974917863 4:68200053-68200075 GAGTGGGGAGGGAGAGCATTGGG + Intergenic
974918147 4:68202944-68202966 GAGTGGGGAGGGAGAGCATTGGG + Intergenic
975094967 4:70447062-70447084 GGGTGGGTGGGCAGGGAAGAGGG + Intronic
975335844 4:73174076-73174098 GCGAGGGAAGGGAGGGGAGAAGG + Intronic
975351255 4:73349899-73349921 GAGTGGATGTTGAGGGCAGAGGG + Intergenic
975529720 4:75387679-75387701 GAGGGGGTAGGGAGAGCATTAGG - Intergenic
975668033 4:76753438-76753460 GAGTGGATCTGGAGTGCAGATGG - Intronic
975957539 4:79859269-79859291 GAGTGGGAAAGGAGGTGAGAGGG - Intergenic
976038188 4:80849705-80849727 CAGAGGCTAGGGAGGGTAGAGGG + Intronic
976108199 4:81641894-81641916 GAGTGGGTAGAGATGGGACAAGG - Intronic
976261467 4:83148948-83148970 ATGTGGGTAGAGAGGGAAGAGGG + Intergenic
976466245 4:85372039-85372061 GAGTGGGGAGGGAGGGTTGAAGG + Intergenic
976576347 4:86676851-86676873 GACTGGGCAGAGAGGGTAGAGGG + Intronic
976582107 4:86749247-86749269 GAGGAGGGAGGGAGGGGAGAAGG - Intronic
976821621 4:89213439-89213461 GACTGGCTTGGGAAGGCAGATGG - Intergenic
976890808 4:90045230-90045252 GGGTTGGTAGGAAGGGCAGAAGG - Intergenic
977229180 4:94431585-94431607 GAGAGGCTAAGGTGGGCAGATGG - Intergenic
977891304 4:102314528-102314550 GAGTTGGTGGGGAAGGTAGAAGG - Intronic
978049016 4:104172096-104172118 GAGTGGGGAGAGTGGGAAGAGGG - Intergenic
978099801 4:104824198-104824220 CAGAGGGTAGGGAGGGAGGAGGG + Intergenic
978100514 4:104834738-104834760 GAGGGGGTTGGGAGGTGAGATGG - Intergenic
978644723 4:110916102-110916124 GAGTGGGAGGAGAGGTCAGAGGG + Intergenic
978978790 4:114915841-114915863 GAGAGGGAAGGGAAGGAAGAGGG + Intronic
979474463 4:121138850-121138872 GAGGGGGTAGGGAGAGATGATGG - Intronic
980546909 4:134276137-134276159 GAATGGGCTGGGAAGGCAGAGGG + Intergenic
981532214 4:145763843-145763865 GAGGGGGAGGGGAGGGCAGAAGG - Intronic
981591334 4:146366078-146366100 TGGTGGGTAGGGAATGCAGATGG - Intronic
981785237 4:148470190-148470212 GAATGAGGAGGCAGGGCAGACGG + Intergenic
982209078 4:153020485-153020507 GAGTGGGGAAGGAGGGGAGTGGG - Intergenic
982236314 4:153254077-153254099 GTGTGACTAGGGAGGACAGAAGG + Intronic
982353561 4:154443033-154443055 GAGTGAGTAGGCTGGACAGAGGG - Intronic
982374541 4:154674994-154675016 GAGAGGGGAGGCAGGCCAGATGG - Intronic
982468894 4:155762227-155762249 CAGAGGGTAGGGAGGGGAGGAGG - Intronic
982653746 4:158120031-158120053 GAGTGGGGAGGGATGGCATTTGG + Intergenic
982814778 4:159871252-159871274 GAGAGGGTATGGAGAGCAGGAGG + Intergenic
983336100 4:166394549-166394571 GAGGGGGAAGGGAGAGAAGAGGG + Intergenic
983672490 4:170254412-170254434 GAGGGAGTAAGGAGGACAGAAGG - Intergenic
984100205 4:175475482-175475504 GAGTGGGTAGGGATAGCATTTGG - Intergenic
985118558 4:186616386-186616408 GAGTGGGTGGGGAGGGGCCATGG - Intronic
985367954 4:189253397-189253419 GAGTGGGTAGGGTGGGAGGAGGG + Intergenic
1202754234 4_GL000008v2_random:42717-42739 GAGTGGGTAGGGATAGCATTAGG - Intergenic
985561064 5:586094-586116 GAGAGGGTAGGAAGGGAAGAAGG + Intergenic
985627661 5:998228-998250 GACGGGGGAGGGAGGGAAGAGGG + Intergenic
985709410 5:1419915-1419937 AAGTGGGAAGGAAGGGGAGAAGG - Intronic
985851149 5:2389818-2389840 GGGTGGGAAGGCAGGGCAGGGGG - Intergenic
985937198 5:3106432-3106454 GGGAGGGGAGGGAGAGCAGAGGG - Intergenic
986357795 5:6945612-6945634 GAGTGATGAGGGAGGGCAGGAGG - Intergenic
986365775 5:7029099-7029121 GAGAGGGTAGGGAGAGCATTAGG + Intergenic
986495076 5:8333213-8333235 GAGTGGGTAGGGAGGGAGTGAGG + Intergenic
986565673 5:9111299-9111321 AAATGGGTATGGAAGGCAGAGGG + Intronic
986587762 5:9336287-9336309 AAGTGGGAATGCAGGGCAGAAGG + Intronic
986740388 5:10700479-10700501 GAGTCGTTAGGGATGGGAGAAGG + Intronic
986991767 5:13561936-13561958 GAGTGGGGAGGGAGAGCATTAGG + Intergenic
987091169 5:14509048-14509070 GGGTGGGTAGGGGAGGCAGGTGG - Exonic
987116093 5:14728120-14728142 AAGTGCGGAGGGAAGGCAGAGGG + Intronic
987702985 5:21425960-21425982 GAGTGGGGAGGGTGGGAGGAAGG - Intergenic
988428103 5:31087573-31087595 GGGTGGGTGGGGAGGGGAGGAGG - Intergenic
988444942 5:31275345-31275367 GAGTGGGGAGGGAGGTGGGAGGG - Intronic
988798435 5:34673958-34673980 GAGTGGGTGGGGAGGGTAGGAGG + Intronic
988864258 5:35317548-35317570 GAGGGGGCAGAGTGGGCAGAAGG - Intergenic
988965577 5:36414169-36414191 CAGGGGTTAGGGAGGACAGAGGG + Intergenic
989077197 5:37576121-37576143 GAGGGGGGAAGGAGGGCGGAGGG - Intronic
989534019 5:42542776-42542798 GAGGGGGTAGGGGTGGCTGAGGG - Intronic
990879631 5:60524660-60524682 GAGAGGGCAGGGTGGGCAAAGGG - Intergenic
991646676 5:68807978-68808000 GAGTGGGAAGGGAAGGGAGGGGG + Intergenic
991693161 5:69245281-69245303 GAGGGGGAAGGGAGGGGAAAAGG - Intronic
991939153 5:71833409-71833431 GAGAGGAGAGGGTGGGCAGATGG - Intergenic
992029312 5:72705213-72705235 GGGTGGGGAGGGAGGGTAAAGGG + Intergenic
992076739 5:73198789-73198811 GACTGGGTGGGGAGCCCAGAAGG + Intergenic
992674870 5:79096023-79096045 GAGTGGGGAGGGATGGCATTCGG - Intronic
993001406 5:82384951-82384973 GAGTTGGGAGGGACGGAAGAAGG + Intronic
993818296 5:92581108-92581130 GATTGGGCAGGGAAGTCAGAGGG + Intergenic
994140929 5:96340337-96340359 GAGTGGGGGTTGAGGGCAGAAGG - Intergenic
995459355 5:112386903-112386925 GAGTGGGGATGGATAGCAGAAGG - Intronic
996515447 5:124364249-124364271 GAGGGGGTAGGGATGGCATTAGG + Intergenic
998150967 5:139757226-139757248 GAGTGGGCTGGGTGGGCAGTGGG + Intergenic
998238324 5:140419901-140419923 GAGGGGGAAGGAAGGACAGACGG - Intronic
998393282 5:141801647-141801669 GACTGAAGAGGGAGGGCAGAGGG - Intergenic
998607390 5:143648964-143648986 GAGTGGGTAGAGAGGGTGGCTGG + Intergenic
999275124 5:150325099-150325121 GAGTGGGGAGGGAGGGAGAAAGG + Intronic
999284395 5:150385627-150385649 GAGTGGGGAGAGGGGGCTGATGG - Intronic
999295273 5:150455672-150455694 GCTGGGGTAGGGAAGGCAGAGGG + Intergenic
999428567 5:151507201-151507223 GAGTGGGAAGGGACCGCAGCTGG + Exonic
999452866 5:151691506-151691528 GAGTGGTTGGAGAGGGCAGTGGG - Intergenic
999869172 5:155731339-155731361 GAATGGGTGGGGAAGTCAGATGG + Intergenic
1000820648 5:165979047-165979069 GGGTTGGGAGGGAGGACAGAAGG - Intergenic
1000849098 5:166318007-166318029 GAGTTGGAAAGGAGGGGAGAGGG - Intergenic
1001231672 5:169994086-169994108 GTGGGTGTAGGGAGGGCAGGTGG + Intronic
1001388007 5:171355891-171355913 GAGGGGGGAGGGAGAGCAGTGGG - Intergenic
1001545365 5:172567716-172567738 GAGGGGGAAGGGAGGGGAGGTGG - Intergenic
1001643944 5:173266061-173266083 GAGTGGGTAGGAAGACGAGAAGG - Intergenic
1002255430 5:177954769-177954791 GAGGGGGGAGGGAGGGAGGAGGG + Intergenic
1002869204 6:1150706-1150728 GAGTGCTTGGGGAGGGCAGAGGG - Intergenic
1002870675 6:1164878-1164900 TAGTGTGGAGGGAAGGCAGATGG + Intergenic
1002902618 6:1422870-1422892 AAGCGGGGAGGGAGTGCAGAGGG + Intergenic
1003362318 6:5439826-5439848 GAGAAGGAAGGGAGGGCAGGAGG - Intronic
1003773641 6:9335745-9335767 GGGAGGGTAGGGAGGGAAGCAGG - Intergenic
1003869431 6:10390379-10390401 GAGCGGGCAGGGAGGGGAGTAGG + Intergenic
1003872204 6:10412419-10412441 GAGAGGGGAGGGAGGGAAGGAGG + Intronic
1004119053 6:12801548-12801570 GACGGGGTATGGATGGCAGAAGG + Intronic
1004250784 6:14021726-14021748 GAGGGGGAGGGGAGGGAAGAAGG - Intergenic
1004510050 6:16277884-16277906 CAGTGGGGAGGGAGGGGAGCAGG + Intronic
1005582190 6:27245978-27246000 GAGTGAGTGGGGAGGGAGGAAGG - Intergenic
1005824552 6:29624925-29624947 CAGTGGGGAGCCAGGGCAGAGGG + Intronic
1005955331 6:30659630-30659652 TAGAGGGTAGGGAGAGCAGCAGG + Intronic
1005957914 6:30677336-30677358 GGGGGGGAAGGGTGGGCAGAAGG - Intronic
1006021209 6:31118656-31118678 GAGGGGCTAGGGAAGGCAGAAGG - Intronic
1006093949 6:31644379-31644401 CAGGGGGCAGGGAGGGCAGCTGG + Intronic
1006259366 6:32854870-32854892 GAGTGGGCAGGGAAGACACAGGG - Intronic
1006510297 6:34517729-34517751 GAGGGGACAGGGAGGGAAGATGG - Intronic
1006796391 6:36734995-36735017 GAGTGAGAAGGGAGGGCATGGGG + Intergenic
1006797061 6:36738596-36738618 GATTGAGTAGGGGGAGCAGAGGG + Intergenic
1007171698 6:39868700-39868722 GATTGGGTGGAGAGAGCAGATGG + Intronic
1007347848 6:41246920-41246942 GAGTGGGGAGGGATGGCATTAGG + Intergenic
1007714561 6:43848226-43848248 GGGTGGCTAGGGAGGTGAGAGGG + Intergenic
1007760979 6:44133646-44133668 GAGTGGATGGGGTGGGCAGGAGG - Intronic
1007880367 6:45158703-45158725 GAGTGAGTAGGGTGGGCAATAGG - Intronic
1008527064 6:52417932-52417954 GAGTGGGTAGGGAGGGATCATGG + Intergenic
1009340646 6:62550710-62550732 GAGTGGGGAGGGAGAGCATTAGG - Intergenic
1009560828 6:65240427-65240449 GAGAGGGTTGGGAGGGAAGGAGG - Intronic
1011238665 6:85246814-85246836 GAGGGGGAAGGGAGGGAAGGGGG - Intergenic
1011629497 6:89310492-89310514 GAGAGGGTAGAGAGAGAAGATGG - Intronic
1011967779 6:93181150-93181172 GAGTGGGGAGGGAGAGCATTAGG - Intergenic
1012425190 6:99106282-99106304 GAGTGGGTGGTAAGGGCAGGGGG + Intergenic
1012555386 6:100505339-100505361 CAGAGGGTAGTGAGGGGAGAAGG + Intergenic
1012827024 6:104159248-104159270 CTTTGGGTAGGGAGGGTAGAGGG + Intergenic
1013544229 6:111140004-111140026 GAGTGGGAAGAGTGGGAAGAGGG + Intronic
1013739111 6:113262718-113262740 GAGAGGGTAGGAAGGGAAGGGGG + Intergenic
1014513462 6:122353966-122353988 GGGGGGGTGGGGAGGGCAGGGGG + Intergenic
1014548857 6:122764399-122764421 GAGTGGGGAGGGATGGCATTAGG + Intergenic
1014877977 6:126684737-126684759 GAAGGGGGAGGGAGGGAAGAGGG + Intergenic
1015567453 6:134588074-134588096 GAGAGGGAAGGGAGGGAGGAAGG + Intergenic
1015584671 6:134763350-134763372 CAATGGGTAGAAAGGGCAGATGG + Intergenic
1016402353 6:143694162-143694184 GAGTGGGGAGGGAAGGAAGGAGG + Intronic
1016830102 6:148425698-148425720 GAGGGGGATGGGAGGGGAGAAGG - Intronic
1016863722 6:148746892-148746914 GAGCGGAGAGGGAGGGGAGAGGG + Intergenic
1017081490 6:150673651-150673673 GAGAGGGAGGGGAGGGAAGAGGG - Intronic
1017359181 6:153545973-153545995 GGGGTGGTGGGGAGGGCAGAAGG - Intergenic
1017637362 6:156456196-156456218 GAGGGGGGAGGAAGGGGAGAGGG - Intergenic
1017835499 6:158173794-158173816 GAGTGGGGAGGGTGGGAAGCAGG + Intronic
1018140070 6:160822712-160822734 GAGTGGGTAGGGATAGCATTAGG + Intergenic
1018328556 6:162702482-162702504 TAGTAGGTAGGGAGGGCTGAGGG - Intronic
1018637147 6:165872588-165872610 GATTGCTTAGGGTGGGCAGAAGG + Intronic
1019475112 7:1240675-1240697 GAGTGGGGAGTGAGGAGAGAAGG + Intergenic
1019588268 7:1816281-1816303 GTGTAGGGAGGGAGGGGAGAGGG - Intronic
1019730651 7:2627621-2627643 GAGAAGGGAGGGAGGACAGAAGG + Intergenic
1019798714 7:3072000-3072022 CAGTGGGTTGGGAGGGTAGGTGG + Intergenic
1019920035 7:4157514-4157536 GAGCGGGGAGGGAGGGAGGAAGG + Intronic
1019982246 7:4630155-4630177 GAGTGGGTGGGCAAGGCTGATGG - Intergenic
1020011346 7:4807519-4807541 GAGAGAGGAGGGAGGGGAGACGG - Intronic
1020440848 7:8215125-8215147 GAGGGTGTAGGGAAGGCAGGAGG - Intronic
1021052837 7:16010663-16010685 GAGTAGGTCGTAAGGGCAGAAGG + Intergenic
1021123147 7:16819717-16819739 GAGTGGGGAGGGAGGGAAGAGGG - Intronic
1021717259 7:23471129-23471151 GAGTGGGTGAGGGGGGCAGGGGG + Intergenic
1021734149 7:23626649-23626671 GAGTGGGGAGGGTGGGAGGAGGG - Intronic
1021868432 7:24980405-24980427 GGATGGGTTGGGAGGGCGGAGGG + Intronic
1021874579 7:25036636-25036658 GAGAGGGCAAGGAGAGCAGAGGG + Intergenic
1021971184 7:25967363-25967385 GAGAGGGAAGGAAGGGAAGAAGG + Intergenic
1022396472 7:29991470-29991492 GTGTGGGTAGGGAGAGCATTAGG + Intergenic
1022528107 7:31051353-31051375 GGCTGGGTGGGGTGGGCAGAGGG + Intergenic
1023607476 7:41943351-41943373 GAGTGTGGAGGGAGGGAAGGAGG + Intergenic
1023815201 7:43944034-43944056 GAGTTGGGAAGGAGGCCAGAGGG + Intronic
1023976213 7:45032082-45032104 GAATGGGTAGGAGTGGCAGAGGG + Intronic
1024368569 7:48552947-48552969 GGGTGTGTAGGGAGGGAAGTGGG - Intronic
1024512176 7:50212885-50212907 GGGAGGGTGGGTAGGGCAGATGG + Intergenic
1024565222 7:50674950-50674972 GAGGGGGTGGGGAGGAGAGAAGG - Intronic
1025002742 7:55331123-55331145 GAGTGGGAGGGGAGGGAAGTTGG - Intergenic
1026294838 7:69042222-69042244 GAGGGAGTTGGGAGGGCAGGAGG - Intergenic
1026307541 7:69154908-69154930 GAGGGGGAAGGGAGGGGAGCAGG - Intergenic
1027310045 7:76946204-76946226 GATTGAGTAGGAAGGGTAGAGGG - Intergenic
1027605567 7:80294307-80294329 GAGTGGGGAGGGAGGAAGGAAGG - Intergenic
1027638057 7:80700920-80700942 GAGGTGGGAGGGAGGGCAGCAGG - Intergenic
1028600301 7:92593512-92593534 GAGTGGGAAGGGAGGGAAGTGGG - Intergenic
1028752388 7:94395129-94395151 GACTGGGTAGAGAGGTTAGATGG + Intronic
1029159384 7:98540931-98540953 CAGGGAGTAGGGAGGGCAGGAGG + Intergenic
1029177378 7:98674661-98674683 AAGTGGGTGGGGTGGGGAGAGGG - Intergenic
1029472019 7:100760603-100760625 GAGTGGGCAGGGTGGGCAGCAGG - Intronic
1029478359 7:100798629-100798651 GAAGGAGCAGGGAGGGCAGAAGG + Intergenic
1029813139 7:103069140-103069162 CAGTGGGGCGGCAGGGCAGAGGG - Intronic
1029930533 7:104365843-104365865 GTGTGGGCGGGGAGGGGAGATGG + Intronic
1030104188 7:105973055-105973077 GAGTGGGTAGGGACAGTAGAAGG - Intronic
1030331866 7:108279625-108279647 GGGTGGGTGGGGAGGGCAGGGGG - Intronic
1030994495 7:116342086-116342108 GAGTGAGTAGGGAAAACAGAGGG - Intronic
1031071506 7:117167201-117167223 GAGGGGGGAGGGATAGCAGAGGG - Intronic
1031320668 7:120323428-120323450 GAGTGGGGAGGGATAGCAGTGGG - Intronic
1031966377 7:128031027-128031049 GTGGGGGCGGGGAGGGCAGAGGG + Exonic
1032425634 7:131820207-131820229 GAGTGGGAGGGGCAGGCAGAGGG - Intergenic
1032525338 7:132575571-132575593 GGGAGGGTAGGGAGGTGAGAGGG + Intronic
1032901327 7:136312280-136312302 GTGTGGGTGGGAAGGGGAGAAGG - Intergenic
1033306938 7:140231639-140231661 GAGGGGGAAGGGAGGACAGGGGG + Intergenic
1033478693 7:141716467-141716489 GATGGGGAAGAGAGGGCAGAAGG - Intronic
1033514010 7:142088108-142088130 GATAGGGTAGGGAGAACAGATGG + Intronic
1033599656 7:142879829-142879851 GAGTGGGTGGGACGTGCAGAGGG - Intronic
1033718135 7:144024513-144024535 GAGTGGCTTGGGTGGGAAGAGGG - Intergenic
1034204948 7:149307255-149307277 GAGGGTGGAGGGAGGGAAGAGGG + Intergenic
1034355163 7:150445440-150445462 GAGTGGGTGGGGAGGGGAGAGGG + Intergenic
1034381978 7:150705150-150705172 GAGTGGGGAGGGTGGGAAGGGGG + Intergenic
1034598475 7:152223281-152223303 AATTACGTAGGGAGGGCAGAAGG + Intronic
1034726319 7:153339521-153339543 GAGTGGAGAGGGATGGCAAAAGG + Intergenic
1034757391 7:153635534-153635556 GAGGGGGGAGGGAGGGGGGAGGG - Intergenic
1034889756 7:154829462-154829484 GAGGGAGGAGGGAGGGAAGAAGG + Intronic
1035277345 7:157755728-157755750 GAGGGGGTAGGAAGGGGAGAGGG + Intronic
1035282676 7:157787472-157787494 CAGTGGGCAGGGCGGGCAGGGGG + Intronic
1035299480 7:157887725-157887747 GAGTGGGTATGGTGGGGAGTGGG - Intronic
1035311933 7:157975001-157975023 GAGGGGCTGGGGAGAGCAGAGGG + Intronic
1035404308 7:158587943-158587965 GAGTGGGGAGGGAAGGGAGCCGG - Intergenic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413814 7:158667454-158667476 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413824 7:158667483-158667505 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413834 7:158667512-158667534 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413864 7:158667598-158667620 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413883 7:158667654-158667676 TAGTGGGTAAGGAAGGCGGAGGG - Intronic
1035413892 7:158667683-158667705 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413902 7:158667712-158667734 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413975 7:158667917-158667939 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413994 7:158667973-158667995 TAGTGGGTAAGGAAGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414044 7:158668119-158668141 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035414086 7:158668233-158668255 TAGTGGGTAAGGAGGGCAGAGGG - Intronic
1035414095 7:158668262-158668284 AGGTAGGTAAGGAGGGCAGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1036275313 8:7346302-7346324 GAGTGGGGAGGGAGTGCATCAGG + Intergenic
1036293721 8:7518136-7518158 CACTGGGTGGGGAGGGGAGAGGG - Intergenic
1036328840 8:7802859-7802881 CACTGGGTGGGGAGGGGAGAGGG + Intergenic
1036346045 8:7964047-7964069 GAGTGGGGAGGGAGTGCATCAGG - Intergenic
1036408445 8:8476738-8476760 GAGTGGGGAGGGATAGCAGTGGG + Intergenic
1036588860 8:10149449-10149471 GCCTGGGCAGGGAGGGCAGCAGG - Intronic
1036635527 8:10547654-10547676 GAGTGGGAAGGGAAGGGAAAAGG - Intronic
1036775816 8:11612539-11612561 GAGTGGGTAGAGATGGTAGGAGG + Intergenic
1036841368 8:12124802-12124824 GAGTGGGGAGGGAGTGCATCAGG - Intergenic
1036863177 8:12371052-12371074 GAGTGGGGAGGGAGTGCATCAGG - Intergenic
1036950691 8:13136325-13136347 GAGTGGGGAGAGAGGGAGGAAGG - Intronic
1037169413 8:15873908-15873930 GAGTGGGGAGGGAGGAAGGAAGG - Intergenic
1037750941 8:21682023-21682045 GAGTGGGTGGAGAGGGCAGCTGG + Intergenic
1037775315 8:21831591-21831613 GAGTGGGGAGGGATGGCATTGGG + Intergenic
1037815073 8:22107815-22107837 GAGTGGGCAGGGAGGTCCGTGGG + Exonic
1037833151 8:22200979-22201001 GGGTGGGGCGGGAGGGCAGGCGG - Intronic
1037886586 8:22599213-22599235 GAGGGGAGAGGGAGGGGAGAGGG - Intronic
1037886591 8:22599224-22599246 GAGAGGGTGGGGAGGGGAGAGGG - Intronic
1037907907 8:22726271-22726293 GCTTAGGTATGGAGGGCAGATGG + Intronic
1038240528 8:25803682-25803704 GAGCAGGTAGGGAGGGATGAGGG + Intergenic
1038259375 8:25979708-25979730 GAGTGGCTAAGGACGTCAGAAGG - Intronic
1038296052 8:26291721-26291743 GGGGGGGTAGAGAGGGCGGATGG - Intronic
1038311539 8:26449430-26449452 GAATGGGGAGGCGGGGCAGAGGG + Intronic
1038529458 8:28306147-28306169 GAGCGGGGAGTGGGGGCAGAGGG - Intergenic
1038568167 8:28637005-28637027 GAGGGGGTGGGGCGGGGAGAGGG + Intronic
1039452331 8:37685404-37685426 GAGAGGGTGGGAAGGGGAGAAGG + Intergenic
1039790390 8:40871364-40871386 GAGTGGGTAGGGATGGAGTAGGG - Intronic
1039977677 8:42381191-42381213 GAGTGGGGAGGGAGGGGAGGAGG + Intergenic
1040336595 8:46419188-46419210 GAGTGGAGTGGGAGGGCAGCAGG + Intergenic
1040479311 8:47809139-47809161 GAGGGGGAGGGGAGGGGAGAAGG + Intronic
1040629260 8:49190797-49190819 GAGTGGGGAGGGAGGGAGGGAGG - Intergenic
1040869278 8:52083622-52083644 AAGTTGGTAGGGAGGGATGATGG + Intergenic
1041719588 8:60964138-60964160 GAGGGGGTGGGGAGGGAAGAAGG + Intergenic
1041749702 8:61246949-61246971 GAGTGGGGAGGGTGGGAAGAGGG - Intronic
1042040349 8:64582131-64582153 GGGTGGGGAGGGAGGGAGGAGGG + Exonic
1042130498 8:65582779-65582801 GAGGGGGAGGGGAGGGGAGAGGG + Intergenic
1042490095 8:69387394-69387416 TGGTGGGTAGGGAGAGCAGCAGG + Intergenic
1042901500 8:73732808-73732830 TGGTGGGAAAGGAGGGCAGACGG - Intronic
1043322664 8:79009389-79009411 GAGAAGGGAGGGAGGGAAGAGGG - Intergenic
1043960094 8:86407797-86407819 GAGTGGGATGGGAGGACATATGG - Intronic
1043961799 8:86424856-86424878 GAGGGGGAGGGGAGGGGAGAGGG + Intronic
1044462053 8:92457191-92457213 GGGTGGGAAGGGAGGGGAAAAGG + Intergenic
1044483370 8:92719651-92719673 TAGAGGGTAGGGTGGGTAGAGGG - Intergenic
1044591769 8:93919482-93919504 GGGGGGGGAGGGAGGGCAGCGGG - Intronic
1044601694 8:94011676-94011698 GAGTGGGGAGGTGGGGAAGAGGG + Intergenic
1044964571 8:97562642-97562664 GAATTGGGAGGGAGGTCAGAGGG - Intergenic
1045026035 8:98087606-98087628 GGGAGGGGAGGGAGGGCAAAAGG - Intronic
1045056065 8:98369462-98369484 GAGTGTGAAGGCTGGGCAGAAGG + Intergenic
1045244584 8:100431827-100431849 GAGAGGGGAGGAAGGGAAGAAGG - Intergenic
1045444665 8:102248204-102248226 GAGTGGGCAGTAAGGTCAGAGGG + Intergenic
1045541879 8:103094425-103094447 GAGGGGGAAGGGAGGGAAGGTGG - Intergenic
1046166405 8:110442145-110442167 GAGTGGGGAGGGTGGGAGGAGGG + Intergenic
1046659542 8:116934309-116934331 AACTGGGTAGGGTTGGCAGAAGG + Intergenic
1046873024 8:119224686-119224708 GAGTGGGTGGGGAGAGGAGAAGG - Intronic
1047203110 8:122782513-122782535 GAGAGGGGAGCGAGGGGAGAGGG - Intronic
1047206935 8:122809938-122809960 GATTGGGTAGGGGGGGTGGAGGG + Intronic
1047306603 8:123657879-123657901 GAGTGGGTTGAGAGGACTGAGGG - Intergenic
1047364726 8:124201464-124201486 GAGGGGGTGGGGAGGGACGATGG - Intergenic
1047676633 8:127209562-127209584 GGGAGGGTGGGGAGGGAAGATGG + Intergenic
1047846697 8:128813960-128813982 GAGTGTGAAGGGAGGACAGAGGG - Intergenic
1048100139 8:131342194-131342216 AAGAGGGTAGGGAGAGTAGAGGG - Intergenic
1048222264 8:132552759-132552781 GACTGAGGCGGGAGGGCAGAGGG + Intergenic
1048278849 8:133089802-133089824 GAGTGGGCAGGGATGGCAGTGGG - Intronic
1048395053 8:134006386-134006408 GAGAGGGTAGGGGGGGCACTGGG + Intergenic
1048690385 8:136955955-136955977 GAGAGGGGAGGGAGGGAGGAAGG - Intergenic
1048798407 8:138172865-138172887 GAGTGGGCAGGGAGGGGAATGGG - Intronic
1049037143 8:140085654-140085676 AAGTGAGTAGGCAGAGCAGAAGG - Intronic
1049150989 8:141035446-141035468 CAGTGGGGAGCGAGGGCAGGAGG - Intergenic
1049184731 8:141244075-141244097 GAGTTGATTGGGAGGGCAGTTGG - Intronic
1049216960 8:141412701-141412723 GAGAGGGCAGGGTGGGCAGTGGG - Intronic
1049227888 8:141466378-141466400 GAGTGGGCAGTGAGGCAAGAGGG + Intergenic
1049452634 8:142670189-142670211 GCGCGGGCAGGGAGGGGAGAGGG + Intronic
1049453662 8:142676147-142676169 CAGTGGGGTGGGTGGGCAGAAGG + Intronic
1049578808 8:143401557-143401579 GGAGGGGAAGGGAGGGCAGAGGG + Intergenic
1049890326 9:63236-63258 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1049940921 9:545268-545290 GGGAGGTTTGGGAGGGCAGATGG + Intronic
1050513052 9:6413983-6414005 CAGAGGGCGGGGAGGGCAGAGGG + Intronic
1050933796 9:11366903-11366925 GCGTGGGCAGAGAGGGGAGAGGG + Intergenic
1050961834 9:11743669-11743691 GACTAGGTATGGAGGGCAGGGGG + Intergenic
1051729756 9:20128155-20128177 GAAAGGGTAGGAAAGGCAGATGG + Intergenic
1052039268 9:23719745-23719767 CACTGGGTAGGGAAGGAAGAGGG + Intronic
1052151906 9:25127424-25127446 GAGTGGGGAGGATGGGAAGAGGG + Intergenic
1052518917 9:29518177-29518199 GAGTGGGAAGGGAGGGGAGATGG - Intergenic
1053495777 9:38547051-38547073 GGGTGGGTAGGGTGGGAAGTAGG - Intronic
1053731791 9:41064421-41064443 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1053799758 9:41756995-41757017 GAGGGGGGAGGGAGGACAGAGGG - Intergenic
1053886837 9:42650027-42650049 GGGTGGGGAGGGGGTGCAGAAGG - Intergenic
1054145453 9:61557939-61557961 GAGGGGGGAGGGAGGACAGAGGG + Intergenic
1054188168 9:61969050-61969072 GAGGGAGGAGGGAGGACAGAGGG - Intergenic
1054225856 9:62457477-62457499 GGGTGGGGAGGGGGTGCAGAAGG - Intergenic
1054465192 9:65489047-65489069 GAGCGGGGAGGGAGGACAGAGGG + Intergenic
1054650348 9:67619526-67619548 GAGGGGGGAGGGAGGACAGAGGG + Intergenic
1054758363 9:68981476-68981498 GTGGGGGTGGGGAGGGCAGGAGG + Intronic
1055272194 9:74573781-74573803 GAAAGGGTAGGGAAGGGAGACGG + Intronic
1055354740 9:75426342-75426364 GAGAAGGGAGGGAGGGAAGAAGG - Intergenic
1055907691 9:81313242-81313264 TAGTGGGTAGTGAAGGCTGAAGG - Intergenic
1055965217 9:81859332-81859354 AAGTGGGGAGGGAGGGGAGGGGG + Intergenic
1055979536 9:81988605-81988627 GAGTGGCAAGGTAGGGCAGAGGG + Intergenic
1056084642 9:83134173-83134195 GAGTAGGGAGGGAGAGAAGAGGG - Intergenic
1056136269 9:83632189-83632211 GAGTGGGAATGGCGGGGAGATGG - Intronic
1056204742 9:84309164-84309186 TGTTGGGTAGGGAGGGTAGATGG + Intronic
1056458658 9:86788124-86788146 GAGAGGGTAGGTAAGGCAGCCGG + Intergenic
1056840796 9:89996662-89996684 GAGTGGGATGGGAGGGTGGAGGG + Intergenic
1057196581 9:93119013-93119035 GAATGGGCAGGGAGGTCAGTAGG - Intergenic
1057512990 9:95696551-95696573 GAGTGAATAGGATGGGCAGATGG - Intergenic
1057611724 9:96550207-96550229 AGGTGGGTAGGAAGGGAAGAGGG - Intronic
1057675711 9:97134566-97134588 GGGTGGGTAGGGTGGGAAGTAGG - Intergenic
1057912794 9:99033389-99033411 GGGTGGGAGGGGAGGGGAGATGG + Intronic
1058087170 9:100760905-100760927 GGGTGGGTTGGGATGGCTGATGG + Intergenic
1058499245 9:105593508-105593530 GAGTGGGTTGGGAGTACAAATGG + Intronic
1058525064 9:105849661-105849683 GAGTGGGCAAGGAGAGCACAGGG - Intergenic
1058923592 9:109640733-109640755 GTGCGGGTGGGGAGGGGAGACGG + Intergenic
1058988255 9:110229549-110229571 GAGGGGGTAGGGATAGCATAAGG - Intergenic
1059029247 9:110672448-110672470 CATAGGGTAGGGAGGACAGATGG + Intronic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059427713 9:114231469-114231491 GAGTGGGAAGGGCGTGCAGCAGG + Intronic
1059450873 9:114370782-114370804 GAATGGGGAGGGAGGGGAGGAGG + Intronic
1059490972 9:114667094-114667116 GGGGGGGTGGGAAGGGCAGAAGG + Intergenic
1059661952 9:116410342-116410364 GAGTGGGTAGGGAGTGGATGGGG - Intergenic
1059669336 9:116478109-116478131 GAGGGGGTAGGGAGGGAGAAAGG + Intronic
1059754161 9:117276673-117276695 GAGGAGGAAGGGAGGGCTGAGGG + Intronic
1060050857 9:120377134-120377156 GAGTGGAGAAGGAGGGGAGAAGG + Intergenic
1060200474 9:121649392-121649414 GAGTGTGTGTGGAGGGGAGAGGG - Intronic
1060338732 9:122753131-122753153 GAGTGGGGAGGGAGAGCATCAGG - Intergenic
1060481459 9:124018776-124018798 GAGGGGGTAGGGACGGAAGATGG - Intronic
1060849349 9:126861124-126861146 GTACGGGGAGGGAGGGCAGATGG + Intronic
1060879466 9:127107951-127107973 GAGTGGGCATAGTGGGCAGAGGG + Exonic
1061237660 9:129351937-129351959 GAGGGGGAAGGGACTGCAGAAGG - Intergenic
1061251455 9:129428821-129428843 GACGGGGGAGGGTGGGCAGAGGG - Intergenic
1061422445 9:130479690-130479712 GGGTGGGAAGAGAGGGCAGTGGG - Intronic
1061485134 9:130916701-130916723 CAGTGGGATGGGAGGACAGAGGG + Intronic
1061621783 9:131815177-131815199 GACAGGGAAGGGTGGGCAGAGGG + Intergenic
1061874214 9:133535850-133535872 GAGGGGGTGGGGAGAGCTGAGGG + Intronic
1061938289 9:133870831-133870853 GAGTGGATGGGATGGGCAGATGG + Intronic
1062194130 9:135263876-135263898 GAGAGGGGAAGGAGGGGAGAGGG - Intergenic
1062238532 9:135524026-135524048 GAGGGAGGAGGGAGGGCAGGTGG - Intronic
1062308812 9:135924835-135924857 GAATGGGGAGTGAGGGCTGATGG - Intergenic
1062345212 9:136111285-136111307 GTGTGGGCAGGGAGGGCCGCTGG - Intergenic
1062399773 9:136367280-136367302 GGGTGGGCTGTGAGGGCAGAGGG + Intronic
1062493921 9:136822639-136822661 GATGGGGGAGGGAGGGCAGCTGG - Intronic
1203535026 Un_KI270743v1:27444-27466 GAGTGGGTAGGGATAGCATTAGG - Intergenic
1185537298 X:872774-872796 GAGAGGGAGGGGAGGGGAGAGGG - Intergenic
1185621734 X:1454084-1454106 GGGTGGGAAGGGCGGGGAGATGG + Intergenic
1185680008 X:1880799-1880821 GAGGGGGTAGGGAGGGAAGGAGG + Intergenic
1186020644 X:5251309-5251331 GGGAGGGGAGGGAGGGAAGAAGG + Intergenic
1186137003 X:6532715-6532737 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186297707 X:8169068-8169090 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186325152 X:8467403-8467425 GTGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186502197 X:10060428-10060450 GAGGGGGTGGGGGGTGCAGAGGG + Intronic
1186572840 X:10734387-10734409 GAGGGGGAAGGGTGGGAAGAGGG + Intronic
1186603698 X:11066233-11066255 GAGAGGGGAGGGAGGGAATAGGG - Intergenic
1187636544 X:21235474-21235496 GAGGGGGTAGGGTGGGAGGATGG + Intergenic
1187956459 X:24523535-24523557 GAATGGGAAGGGAAGGCAGAGGG + Intronic
1188305042 X:28551295-28551317 GAATGAATAGGGAGAGCAGAAGG + Intergenic
1188574903 X:31636190-31636212 GAGTGGGGAGGGTGGGAGGAGGG + Intronic
1189036183 X:37495709-37495731 GAGTGTGGAGGGTGGGAAGAGGG - Intronic
1189037691 X:37509251-37509273 GAGTGTGGAGGGTGGGAAGAGGG - Intronic
1189097393 X:38154988-38155010 GATTGGGTGTGGAGGGCATAGGG - Intronic
1189129765 X:38485553-38485575 GAGTGCGGAGGGTGGGGAGAGGG + Intronic
1189412856 X:40789449-40789471 GAGTGGGGAGGTAGGGGAAAGGG - Intergenic
1189519534 X:41751570-41751592 GAGGGGGTGGGGTGGTCAGATGG + Intronic
1190368305 X:49718182-49718204 GACTGGGTGGGGAGGGCACGAGG + Intergenic
1190640736 X:52481427-52481449 CATTGGGTAGGGACTGCAGAGGG + Intergenic
1190646936 X:52531438-52531460 CATTGGGTAGGGACTGCAGAGGG - Intergenic
1190730217 X:53220919-53220941 GAGAGGGTAGAGAGGGGAAAGGG + Intronic
1190741471 X:53291728-53291750 GAGTGGGGTGAGAGGGCAGTTGG - Intronic
1190766671 X:53480965-53480987 AGGTGGATAGGGAGGCCAGAAGG - Intergenic
1191817324 X:65260415-65260437 GAGGGTGTAGGGTGGGAAGAAGG + Intergenic
1191834465 X:65449152-65449174 GAGAGGGTAGGGTGAGGAGAGGG + Intronic
1192149223 X:68701635-68701657 GGGTGGGGAGGGAGTGCAGGAGG + Intronic
1192180711 X:68914068-68914090 GGGTGGGTAGGGAGGTCAGTAGG - Intergenic
1192194897 X:69021527-69021549 GAGGGGCCAGGGAGGGAAGATGG + Intergenic
1192264984 X:69531762-69531784 GAGTGTGTAGGCAGGGCACAGGG - Exonic
1192334912 X:70210533-70210555 GAGTGGGGAGGGATAGCAGTAGG - Intergenic
1192585749 X:72316983-72317005 GAATAGGTAGGGAGGGGAAAAGG + Intergenic
1193456621 X:81739061-81739083 GAGTGTGTAGGGTGGGAGGAGGG + Intergenic
1193570442 X:83134963-83134985 GAGTGTGGAGGGAGGGAGGAGGG + Intergenic
1194134681 X:90126274-90126296 GAGTGGGAAGGAAGAGCAAACGG - Intergenic
1194266449 X:91758676-91758698 GAGTGGGGAGGGAGAGCATTGGG + Intergenic
1194320433 X:92440300-92440322 GAGTGGGGAGGGAGGGAGGGAGG - Intronic
1194682616 X:96872242-96872264 AAGTGGGTGGGGAGGGGAAATGG - Intronic
1194902483 X:99530212-99530234 GAGTGGGGAGGGAGAGCATCAGG + Intergenic
1195173553 X:102293128-102293150 GAGGGGGCAGGGAGGGGATATGG - Intergenic
1195185312 X:102393968-102393990 GAGGGGGCAGGGAGGGGATATGG + Intronic
1195563467 X:106313216-106313238 AAGTGGGGAGGGTGGGAAGAGGG - Intergenic
1195876435 X:109547034-109547056 GAGTGGGGAGGGATGGCATTAGG + Intergenic
1197279509 X:124518419-124518441 GGGCGGGCAGGGAGGGCAAATGG + Intronic
1197634916 X:128904059-128904081 GAGTGGGTAGAGAGGGGATCTGG - Intergenic
1197816006 X:130499427-130499449 GAGAGGGTAGGAAGGGAGGAAGG - Intergenic
1197825808 X:130589137-130589159 GTGGGGGTGGGGAGAGCAGAAGG - Intergenic
1197925766 X:131645497-131645519 GAGAGGGAAGAGAGGGCATATGG + Intergenic
1198146171 X:133859517-133859539 GTGTGGGTAGGGAGAGATGAAGG + Intronic
1198311141 X:135426374-135426396 GGCGGGGGAGGGAGGGCAGAGGG + Intergenic
1198934758 X:141894866-141894888 GAGTGGGGAGGTAGGCAAGAAGG + Intronic
1199288368 X:146078563-146078585 GAGTGGGTAGGGAGAGAATAGGG + Intergenic
1199758741 X:150889247-150889269 GAGTGGATCTGAAGGGCAGATGG - Intronic
1199874631 X:151920571-151920593 GATGGGGTAGGGAGTGCAGATGG - Intronic
1200067647 X:153511873-153511895 GAGTGGCTGTGGAGGGCACAGGG + Intergenic
1200181765 X:154155212-154155234 GAGTGGGTCAGGGGGGCAAATGG - Intronic
1200187414 X:154192326-154192348 GAGTGGGTCAGGGGGGCAAATGG - Intergenic
1200193063 X:154229466-154229488 GAGTGGGTCAGGGGGGCAAATGG - Intronic
1200198818 X:154267270-154267292 GAGTGGGTCAGGGGGGCAAATGG - Intronic
1200226168 X:154419075-154419097 GGCTGGGGAGGGAGGGCAGGTGG + Intronic
1200480462 Y:3696385-3696407 GAGTGGGAAGGAAGAGCAAAGGG - Intergenic
1200583601 Y:4979245-4979267 GAGTGGGGAGGGAGAGCATTGGG + Intergenic
1200695775 Y:6357891-6357913 GAGAAGGGAGGGAGGGAAGAAGG - Intergenic
1201039502 Y:9816819-9816841 GAGAAGGGAGGGAGGGAAGAAGG + Intergenic
1201573836 Y:15440950-15440972 GTGTGGGTAGGGATGGCAAGGGG + Intergenic