ID: 1178774834

View in Genome Browser
Species Human (GRCh38)
Location 21:35539929-35539951
Sequence GGCTGGAAATGCCACACAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 181}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178774834 Original CRISPR GGCTGGAAATGCCACACAGC AGG (reversed) Intronic
900482148 1:2904593-2904615 GGGTGGAAACGCCACACAGAGGG + Intergenic
900525232 1:3125285-3125307 GGCTGGAGAGGCCTCAGAGCTGG + Intronic
901055580 1:6447426-6447448 TGCAGGAAATGCGACACCGCAGG - Intronic
901204494 1:7486198-7486220 TGCTGGAAATGCCTAACAGTTGG + Intronic
904106389 1:28088529-28088551 GGCTGTAAAAGCCCCACAACAGG + Exonic
904674673 1:32191619-32191641 GGCTGTAAATGCAAAGCAGCAGG - Intronic
905866283 1:41378491-41378513 GGCTGGATATGGGACAGAGCAGG + Intronic
907063028 1:51450223-51450245 GGATGGAAAGGCCACACTGGGGG + Intronic
911037501 1:93566248-93566270 GGCTGGGAATTCCACTCAGATGG - Intronic
911632782 1:100200968-100200990 GGCTGAAAATGCCAAAAACCAGG + Intronic
912380845 1:109247476-109247498 GGGTGGAAAGGCCACCCACCTGG + Intergenic
913372457 1:118116084-118116106 GGCTGTCAGTGCCACACATCTGG - Intronic
914384453 1:147154327-147154349 GAGTGGAAATGCAAGACAGCAGG - Intergenic
916241823 1:162647936-162647958 TCCTGGGAATGCCACCCAGCAGG + Intronic
917406876 1:174716441-174716463 GGTTAAAAATGCCAAACAGCTGG - Intronic
922062388 1:222104831-222104853 GGCTGGTAATGCCACCCCGGGGG - Intergenic
922159685 1:223069931-223069953 GGCTAGGAATGCCACACAGCAGG - Intergenic
923499849 1:234555497-234555519 GAATGGGAATGACACACAGCTGG + Intergenic
1064000694 10:11661627-11661649 GCCTCGAAAACCCACACAGCGGG + Intergenic
1065664529 10:28043382-28043404 GGCAGGAAATGGCAGCCAGCTGG + Intergenic
1067234775 10:44438287-44438309 AGCATGAAAGGCCACACAGCAGG - Intergenic
1067757436 10:49015685-49015707 GGCTCCAAATGACACAGAGCTGG + Exonic
1070523738 10:77276989-77277011 GCCAGTAAATGACACACAGCGGG + Intronic
1070528766 10:77317845-77317867 GGCTGGAAATGGCTCACTGCTGG - Intronic
1071694265 10:87855294-87855316 GGCGGGGAATGTCACACACCAGG - Intergenic
1072271221 10:93779288-93779310 GGCTGGAGAGGAGACACAGCTGG - Intronic
1072765373 10:98090570-98090592 GGCTCAGAATGTCACACAGCTGG - Intergenic
1074602206 10:114926176-114926198 GGCTGGCAAAGTCACACTGCAGG + Intergenic
1075279435 10:121127101-121127123 TGCTGGAAATGCCCTACAGCTGG + Intergenic
1075383189 10:122035338-122035360 GGCTGTAAGTTCCAGACAGCAGG - Intronic
1076338785 10:129728565-129728587 AGCAGCACATGCCACACAGCGGG - Intronic
1076618465 10:131771889-131771911 GGCTGGAAATGGTGCCCAGCAGG + Intergenic
1076671344 10:132122471-132122493 GACTGGAGGGGCCACACAGCAGG + Intronic
1079248898 11:18773051-18773073 GCCTGGAATTGACACAAAGCAGG + Intronic
1081426668 11:42933212-42933234 GGCTTGAAATGCCAAACTGTAGG - Intergenic
1084550011 11:69835492-69835514 GGCTGTAAACACCACTCAGCAGG - Intergenic
1086123471 11:83326156-83326178 GGCTGGACAGGCCACTCTGCAGG + Intergenic
1091044570 11:132314231-132314253 TGCTCTGAATGCCACACAGCTGG + Intronic
1091649510 12:2299407-2299429 AGCAGGAAATGGTACACAGCTGG - Intronic
1094594466 12:31852079-31852101 GTCTGGGAATGCCACCCAGTAGG - Intergenic
1095918350 12:47503509-47503531 GGAGGGGAATGGCACACAGCAGG + Intergenic
1097911767 12:64977957-64977979 GGCTGGAAATGTCACACACCAGG - Intergenic
1100516339 12:95331745-95331767 GTCTGGGAATGCCACCCAGGAGG - Intergenic
1102206831 12:111096595-111096617 GGCTGGAGGTGCCACTGAGCTGG - Intronic
1102504086 12:113372880-113372902 AGCTGGACATGCCACAAGGCTGG - Intronic
1103979949 12:124730549-124730571 GCCTGGAACTCACACACAGCTGG - Intergenic
1104397176 12:128444317-128444339 GGCTGGAAATGAAGCACAGAGGG - Intronic
1107455500 13:40550902-40550924 GACTGGGAAGGGCACACAGCAGG - Intergenic
1107540916 13:41388335-41388357 GGCTGGGAATGCAGCCCAGCAGG + Intergenic
1110374780 13:74780652-74780674 GGCAGGAAATGTCACACAGTCGG + Intergenic
1112979161 13:105359924-105359946 CGCAGGACATGACACACAGCAGG + Intergenic
1113782127 13:112982801-112982823 GGCTGGAGCTGACACCCAGCTGG + Intronic
1115919872 14:38360551-38360573 CACTGGAAAGACCACACAGCAGG - Intergenic
1118319935 14:64747157-64747179 TGCTGGAAATGCCTCACTTCAGG + Exonic
1118438180 14:65790071-65790093 AGCCTGAAATGCCACACAGTTGG - Intergenic
1119034017 14:71215000-71215022 TGTTGGATCTGCCACACAGCAGG - Intergenic
1122713170 14:103675777-103675799 GGCTGGAAAAACCAAAAAGCAGG + Intronic
1123044325 14:105504015-105504037 GGCTGGAGAGGACACCCAGCTGG + Intergenic
1124379773 15:29155671-29155693 TGCTGGAAAGGGAACACAGCAGG - Intronic
1124390588 15:29252958-29252980 GGCTGTAAATGAAACACAGTTGG - Intronic
1125326097 15:38537415-38537437 GGGAGGAAGTGCCACACATCTGG + Intronic
1125537880 15:40453039-40453061 GGCTGGCCATTCCCCACAGCAGG - Intronic
1126851826 15:52801750-52801772 AGCTGGAGCTGCCCCACAGCAGG - Intergenic
1127512119 15:59653163-59653185 GGCAGGAAAGGTCAGACAGCTGG + Intronic
1127688810 15:61374694-61374716 GGATGGAAATGGCACAAAGACGG - Intergenic
1128710529 15:69868123-69868145 GGCTGGACATGCCATGCAGTAGG + Intergenic
1129974007 15:79805797-79805819 GGCTGGAGCTGACCCACAGCAGG - Intergenic
1130560257 15:84952491-84952513 GGCTGGAGATGCCACCACGCAGG + Intergenic
1131316625 15:91344430-91344452 GGGTTGAAATGTCACACAGGAGG + Intergenic
1132993724 16:2811803-2811825 AGCTGGAGATGGCCCACAGCAGG + Intergenic
1134193486 16:12140374-12140396 GGCAGGAAAAGTAACACAGCTGG - Intronic
1136092764 16:27932514-27932536 GGTAGGAGATGCCACACAACCGG + Intronic
1136110584 16:28062172-28062194 AGCTGGTTGTGCCACACAGCAGG - Intronic
1136276290 16:29181108-29181130 GACTGGAGCTGCCACGCAGCTGG + Intergenic
1137299363 16:47132901-47132923 AGCTGAAAAGGCCTCACAGCTGG - Intronic
1140736147 16:77899526-77899548 GTATGGAAATGCCACAGAGTGGG + Intronic
1140860340 16:79012698-79012720 GGCTGGAAGTTCCACAAAGCAGG + Intronic
1141751587 16:85961915-85961937 GTCTGGAAGAGCAACACAGCTGG - Intergenic
1141970121 16:87475847-87475869 GGCTGAAAATTTCCCACAGCTGG + Intronic
1142080671 16:88147167-88147189 GACTGGAGCTGCCACGCAGCTGG + Intergenic
1142945545 17:3423375-3423397 AGGTGGCAATGCCACACAGGAGG - Intergenic
1143262284 17:5608406-5608428 GGCTGGAAGTGTCACACTCCAGG - Intronic
1149692912 17:58593124-58593146 GGCTGGAAATCACACACCCCAGG + Intronic
1152686716 17:81697332-81697354 GGGGGCAAATGCCACGCAGCAGG - Intronic
1152922747 17:83073947-83073969 GGCTGGAGTAGCCACACTGCAGG - Intergenic
1155239406 18:23851228-23851250 GGCTGTAACAGCCACACAGAAGG + Intronic
1155691517 18:28630562-28630584 GGCTGGGAACACCACACACCAGG + Intergenic
1157223078 18:45840825-45840847 GGCTGGAGGTGCCACACTGCTGG + Intronic
1157543964 18:48534904-48534926 GACAGGAAACGTCACACAGCAGG + Intergenic
1158679249 18:59552007-59552029 GGCTGTAACTGGCTCACAGCTGG + Intronic
1161482550 19:4518165-4518187 GCCTGGAGATGCCCCAGAGCCGG - Intergenic
1161492561 19:4570272-4570294 GGCTGGAAATGCCTGATAGTAGG - Intergenic
1162771825 19:12953792-12953814 GCCTGGAAATGACACACTGGGGG - Exonic
1165314149 19:35044714-35044736 GGCTGGAAATGCCAGGCTGAGGG + Intronic
1166742656 19:45123623-45123645 GGCTGGAAATTCTACTCTGCAGG + Intronic
1167593618 19:50416805-50416827 GGCTGGCACTGCCACCCAGTGGG + Intronic
925939449 2:8802033-8802055 TGCTGCAAAGGCCCCACAGCAGG + Intronic
927147717 2:20177932-20177954 GGCTGGGAGGGCCACACAGGAGG + Intergenic
927682176 2:25146896-25146918 GGCTGGGAATGCCAGGCACCAGG - Intronic
929112696 2:38418796-38418818 GGCTGCAAAGGGCTCACAGCTGG + Intergenic
930032050 2:47064360-47064382 AGCTGGAAATCCCACTCAGCTGG + Intronic
930637975 2:53826760-53826782 GGGTGGATATGCCACAGAGGAGG - Intergenic
931170966 2:59803330-59803352 GCCTGGCAAGGACACACAGCAGG + Intergenic
932413723 2:71561622-71561644 GGCTGGAGAAGGCACCCAGCAGG + Intronic
932430907 2:71673012-71673034 GGCTGGGGTGGCCACACAGCAGG + Intronic
932764756 2:74462541-74462563 GGCTGGTATTGCCAGACATCGGG - Exonic
937685367 2:124690598-124690620 GGCTGGAGATCCCAGCCAGCAGG - Intronic
938663026 2:133506597-133506619 GGCGGGAAATGCCACTTAGGTGG - Intronic
938971567 2:136437788-136437810 AGCTGGAAAGAGCACACAGCTGG - Intergenic
939194587 2:138956296-138956318 GGCTGAAATTGCCAACCAGCTGG - Intergenic
940849722 2:158676620-158676642 AACTAGAAATGACACACAGCTGG - Intronic
942078547 2:172379611-172379633 GACTCGAAGTTCCACACAGCTGG + Intergenic
944170904 2:196776426-196776448 GGATGCAAATGCTGCACAGCAGG - Exonic
945372521 2:209036947-209036969 TGCTGGAAATGACAAAAAGCAGG + Intergenic
945493396 2:210481629-210481651 ATTTGGAATTGCCACACAGCAGG + Intronic
945774711 2:214091360-214091382 AGCTGGGAAAGTCACACAGCTGG + Intronic
946252311 2:218421206-218421228 CTCTAGAAATGCCACACTGCTGG - Intronic
947978941 2:234392413-234392435 GGCTTAAAATCACACACAGCAGG + Intergenic
1172513136 20:35514418-35514440 GGCTGGAAAGGCCTGAAAGCAGG + Exonic
1172858347 20:38025994-38026016 GGCTGAAAACGCCACAAAGTTGG + Intronic
1173076810 20:39827191-39827213 TTCTGGAAATGCAACTCAGCAGG - Intergenic
1173579976 20:44140346-44140368 GGTGGGAAATGCCACAGAGCAGG - Intronic
1174330017 20:49810666-49810688 AGCTGGAAACTCCACATAGCTGG - Intergenic
1175247264 20:57589694-57589716 GGGTGGCCATGGCACACAGCAGG - Intergenic
1178774834 21:35539929-35539951 GGCTGGAAATGCCACACAGCAGG - Intronic
1179306281 21:40156215-40156237 GGCTGGAAGGGACACACAGATGG + Intronic
1180599618 22:17007657-17007679 GGCGGGAAAGGGGACACAGCAGG - Intronic
1181013209 22:20054189-20054211 GGCTGGGCATGCCACACACAAGG - Intronic
1183606128 22:38867591-38867613 GGCTGGATCTGCCACAGAGCAGG - Intronic
1184720381 22:46309191-46309213 TGCTGGATATACCACACAGTAGG + Intronic
950499897 3:13357094-13357116 GGGTGGAGAAGCCACACTGCTGG - Intronic
951043473 3:18013302-18013324 GGCTGGACATCCCTCACAGGGGG - Intronic
951312416 3:21144549-21144571 GGCTGACAATGCCAATCAGCAGG - Intergenic
953531262 3:43741571-43741593 GGGTGGCAGTGACACACAGCAGG + Intergenic
953749070 3:45595732-45595754 GGCTGAACAGGCCCCACAGCTGG - Exonic
956690991 3:71877496-71877518 GTCTGGGAATGCAGCACAGCAGG + Intergenic
958260727 3:91377906-91377928 GGAGGGAAATGTCACACACCAGG - Intergenic
959037344 3:101383363-101383385 GACTGCAAATTCCACAGAGCTGG + Intronic
963230980 3:142908688-142908710 GGCTGGGGTTTCCACACAGCAGG - Intergenic
963504131 3:146163074-146163096 GGCTGGAAATGTAAGAAAGCAGG - Intronic
968477573 4:819559-819581 GGCTGGGAAGGACACACTGCTGG + Intronic
969583530 4:8079105-8079127 GCCTGGAAGTGGCCCACAGCTGG + Intronic
976130914 4:81883029-81883051 GGTTGGAAATGCCACAAACCTGG - Intronic
976585815 4:86795858-86795880 GGCGGGGAATGTCACACACCAGG + Intronic
978564709 4:110069758-110069780 GGCTGGAAATGACAATCACCTGG + Intronic
982054046 4:151529679-151529701 GGCAGGGAATGCATCACAGCTGG + Intronic
982210166 4:153028329-153028351 GGTTGGAGACCCCACACAGCTGG - Intergenic
986146148 5:5079726-5079748 GGCTGGGAATGCCAGACTCCTGG + Intergenic
986608961 5:9547726-9547748 GCCTGCAGCTGCCACACAGCAGG - Intergenic
991230750 5:64330784-64330806 GGCTGCACATTCCACAGAGCTGG + Intronic
991527483 5:67577445-67577467 AATTGGAAATGGCACACAGCAGG + Intergenic
994066822 5:95553072-95553094 GGCTGGACAATCCACTCAGCAGG + Intronic
998379387 5:141713195-141713217 GGCTGGAAATTCCCAACAGCAGG + Intergenic
1000194645 5:158946265-158946287 GGCTGAAAATGCCAAAAACCGGG - Intronic
1001698957 5:173692769-173692791 GGGTGGAGAAGCCACAAAGCTGG - Intergenic
1002877303 6:1222653-1222675 GGCTGGAGATGACAGACAGCCGG + Intergenic
1004539291 6:16534501-16534523 GTCTGCAAATGCTACACATCAGG - Intronic
1006688825 6:35861940-35861962 GGCTGCAACTGCCACCCAGCTGG + Intronic
1007189618 6:40002543-40002565 GTGTGGAAAACCCACACAGCTGG + Intergenic
1013299923 6:108795255-108795277 GGCTGGGAAGGCCACAGAGTAGG - Intergenic
1018980492 6:168598384-168598406 GGCTGGAGATTCCTCAGAGCGGG - Intronic
1021103241 7:16607766-16607788 TGCTGGAAATCCCACATAACAGG + Intronic
1021590503 7:22255895-22255917 GGCTGGAAATGCCAGAGACCAGG + Intronic
1022102444 7:27176510-27176532 ACCTGGAAATGCCACAGAGCTGG + Intronic
1023889920 7:44384714-44384736 GCATGGATAAGCCACACAGCAGG - Exonic
1024262151 7:47581276-47581298 GGAGGCACATGCCACACAGCTGG + Intronic
1024637986 7:51306179-51306201 GCTTGGAAGTGCCACACACCAGG + Intronic
1030561479 7:111092218-111092240 AGCTGGAACTGCCACACACTAGG + Intronic
1030960674 7:115917288-115917310 GGCTTGAAGTGCCACAGGGCAGG + Intergenic
1034507620 7:151506852-151506874 GGCTGGTGGTGCTACACAGCTGG + Intronic
1035330526 7:158094172-158094194 GACTGGTCATGCCACCCAGCAGG - Intronic
1035473326 7:159125454-159125476 GACTGGAAAGGCCACAGAGCTGG + Intronic
1036403494 8:8432141-8432163 CGCTGGAGATACCACAGAGCAGG - Intergenic
1036587001 8:10133560-10133582 CACTGGAAGGGCCACACAGCTGG - Intronic
1037169984 8:15879341-15879363 GGCAGGAAACATCACACAGCGGG + Intergenic
1037220199 8:16509822-16509844 CTATGGAAAGGCCACACAGCAGG + Intronic
1037697319 8:21235861-21235883 GGCTAGAAGAGCCACTCAGCTGG - Intergenic
1037718138 8:21417313-21417335 GGCTGCACATGGCACACAGGCGG + Intergenic
1039032356 8:33324243-33324265 GGCTGGAAATGTCACCTAACTGG + Intergenic
1039710901 8:40055189-40055211 GGCTGGAACTGGCACCGAGCAGG - Intergenic
1042178112 8:66057525-66057547 GGCTGGAAATTCCCCACATTTGG + Intronic
1042196944 8:66238761-66238783 GGCTGCACATTCCACAGAGCTGG - Intergenic
1049245882 8:141562324-141562346 GGCTGGAAATGTCACATTGGAGG - Intergenic
1049953977 9:674338-674360 AGCTGGAAAAGCCACGCAGCGGG + Intronic
1055474007 9:76643516-76643538 TGCTGCAAGTGACACACAGCTGG - Intronic
1057291514 9:93810180-93810202 GGCTGGAACTGCCACTGACCTGG + Intergenic
1059170444 9:112119749-112119771 GACTGGAAACTCCAGACAGCTGG - Intronic
1060723799 9:125994703-125994725 GGCAGGAGATGCCACCCTGCTGG + Intergenic
1062110352 9:134778862-134778884 GGCTGGAAGTGCCTTGCAGCTGG + Intronic
1062280467 9:135749498-135749520 GGCTGGAGGGGCCCCACAGCTGG + Intronic
1062510508 9:136902704-136902726 GGCTGTAAATGTCACACATGGGG + Intronic
1186616776 X:11196585-11196607 GTCTGGATTTGCCAGACAGCTGG + Intronic
1189149828 X:38695024-38695046 CCCTGGAAATGCCACACACTAGG - Intergenic
1189247568 X:39575609-39575631 TGCTGGAGCTGCCACACGGCTGG - Intergenic
1189936495 X:46074726-46074748 GGCGGGAAATATCACACACCGGG - Intergenic
1192062003 X:67837692-67837714 GGCGGGAAATATCACACACCGGG + Intergenic
1193637917 X:83975842-83975864 AGCTGTAAATTCCATACAGCTGG + Intergenic
1198043493 X:132877136-132877158 GGCTGGAAAAGCCTCACATCAGG + Intronic
1199078956 X:143555394-143555416 GGCAAGAACTGCCACTCAGCTGG + Intergenic
1199213978 X:145246117-145246139 GGCAAGAACTGCCACTCAGCTGG - Intergenic
1199757225 X:150875865-150875887 GGCTGGAGAGGCCTCACATCAGG - Intronic
1200001435 X:153063179-153063201 GCCTAGAAATGCCACACCTCGGG - Intergenic