ID: 1178778437

View in Genome Browser
Species Human (GRCh38)
Location 21:35575428-35575450
Sequence CTGCATGTTGGAATAGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 175}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178778437_1178778445 28 Left 1178778437 21:35575428-35575450 CCGGCCTCTATTCCAACATGCAG 0: 1
1: 0
2: 1
3: 10
4: 175
Right 1178778445 21:35575479-35575501 AGTAACCAATTCCATAGAGGAGG 0: 1
1: 0
2: 1
3: 10
4: 112
1178778437_1178778444 25 Left 1178778437 21:35575428-35575450 CCGGCCTCTATTCCAACATGCAG 0: 1
1: 0
2: 1
3: 10
4: 175
Right 1178778444 21:35575476-35575498 ATGAGTAACCAATTCCATAGAGG 0: 1
1: 0
2: 0
3: 3
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178778437 Original CRISPR CTGCATGTTGGAATAGAGGC CGG (reversed) Intronic
903212282 1:21824852-21824874 CTGCATGTTGGCGTGGAGGTGGG - Exonic
904163691 1:28539248-28539270 CTGCATAGTACAATAGAGGCAGG + Intronic
904334676 1:29789222-29789244 CTGCTGGTGGGAATATAGGCAGG + Intergenic
910409851 1:86930443-86930465 CTTCATGTGGGGATAGAGGAAGG - Intronic
911705551 1:101008098-101008120 CTAAATGTTGGAAAAGAGGCTGG + Intronic
912369711 1:109164628-109164650 CTCCATGTTGGCTGAGAGGCTGG - Exonic
914408615 1:147402797-147402819 CTGCAAGGTGGCAGAGAGGCTGG + Intergenic
915776566 1:158495018-158495040 CTGAGTGTTGGGAAAGAGGCTGG - Intergenic
917842516 1:178993191-178993213 CTGCAAGTTGGCAGCGAGGCTGG - Intergenic
920781092 1:208991849-208991871 CTGCAAGGTGGCATCGAGGCTGG + Intergenic
924098455 1:240578897-240578919 CTGCATTTTGGAACAGCTGCAGG + Intronic
1063204076 10:3814035-3814057 CTGCATTTTGGAGTAGACACAGG + Intergenic
1065305270 10:24362504-24362526 CTTCATGTTGGAAGATATGCTGG + Intronic
1066387803 10:34955529-34955551 CTGGATGTTGCACTAGAGGTAGG - Intergenic
1070330286 10:75411481-75411503 ATGTATGATGGATTAGAGGCAGG - Intergenic
1070367901 10:75753765-75753787 CTGCAGGTTAGAAATGAGGCAGG + Intronic
1070526168 10:77297850-77297872 CTCCATCTTGGAATCCAGGCAGG - Intronic
1070716066 10:78722196-78722218 CTCAATGTTGGAAGTGAGGCTGG + Intergenic
1071211139 10:83343093-83343115 CTGCAAGGTGGCAGAGAGGCTGG - Intergenic
1072384905 10:94914703-94914725 CTGCAAGGTGGCATCGAGGCTGG + Intergenic
1072802819 10:98405139-98405161 CTGGATGATGGAATCCAGGCTGG - Intronic
1074236735 10:111592267-111592289 ATGTATGTAGGAAGAGAGGCAGG + Intergenic
1077411958 11:2407833-2407855 CAGCCAGTTGGCATAGAGGCTGG + Exonic
1077539479 11:3139772-3139794 CTGCCTGAAGGAAGAGAGGCCGG - Intronic
1078222733 11:9364865-9364887 CTGCATTTTGGAACTGAGTCAGG - Intergenic
1079454595 11:20625587-20625609 CTGGATGCTGGAAAAGAGGGAGG - Intronic
1079744934 11:24113938-24113960 ATGAATGTTGGAAAAGAGACAGG + Intergenic
1081430481 11:42971403-42971425 CTGGTTCTTGGACTAGAGGCTGG + Intergenic
1084673919 11:70623434-70623456 CTGCATGATGGGACAGAGGCAGG - Intronic
1086078647 11:82880255-82880277 CTGCAAGGTGGCAAAGAGGCTGG - Intronic
1087101639 11:94370784-94370806 CTGCAAGTTGGCAGTGAGGCTGG + Intergenic
1088654386 11:111985516-111985538 CAGCATGTTGAAATAGGGTCTGG - Intronic
1089862746 11:121604495-121604517 CTGCATGTTGTATCAGAGTCTGG - Intronic
1093776143 12:23076221-23076243 CTGCAAGTTGGCAGCGAGGCTGG - Intergenic
1097304273 12:58052226-58052248 CTGCAAGGTGGCAGAGAGGCTGG + Intergenic
1097943814 12:65344202-65344224 CTGCTTGTTGGAATAGAGACTGG + Intronic
1098019946 12:66144123-66144145 CTGCTTGGTGGAAAAGAGGCTGG + Intronic
1099512458 12:83554823-83554845 CTGCAAGGTGGCATTGAGGCTGG - Intergenic
1099999115 12:89812170-89812192 CTGCAAGGTGGAAGCGAGGCTGG - Intergenic
1100801643 12:98237858-98237880 CTGCCTGTGGGAAGACAGGCGGG - Intergenic
1101391761 12:104307465-104307487 ATGCATGTTAGCATAGTGGCTGG - Intronic
1102996107 12:117351852-117351874 CTGGATGATGGAGAAGAGGCAGG - Intronic
1103834352 12:123807262-123807284 CTGCCTGTTGGATTAGACTCTGG + Intronic
1106037040 13:26052185-26052207 CTGCCTGCTGGAATAGGCGCGGG + Intergenic
1107355043 13:39557542-39557564 CTGCAGGTGGGACTAGAGGGCGG - Intronic
1109745318 13:66616895-66616917 CTGAAGCTTGGAATTGAGGCTGG - Intronic
1109764714 13:66879361-66879383 ATACATTTTGGAGTAGAGGCTGG - Intronic
1110086829 13:71390283-71390305 CTGCAAGGTGGCAGAGAGGCTGG - Intergenic
1110095270 13:71510775-71510797 CTGAACGTTGCAATAGAGGAAGG - Intronic
1114923485 14:27363231-27363253 CTGCAAGGTGGCAGAGAGGCTGG - Intergenic
1118483362 14:66189443-66189465 CTGCAAGGTGGAAGTGAGGCTGG - Intergenic
1123899887 15:24865524-24865546 ATGGCTGTTGGAACAGAGGCTGG + Intronic
1127891521 15:63255929-63255951 CAGCATGGTGGGATAGAAGCTGG - Intronic
1133640754 16:7714995-7715017 CTTCATGCAGAAATAGAGGCTGG + Intergenic
1137253153 16:46754765-46754787 CTGGATGCTGGAAGAGAGGCTGG + Intronic
1138702495 16:58878839-58878861 CTGCAAGGTGGCAGAGAGGCTGG - Intergenic
1139105262 16:63820093-63820115 CTGCAAGTTGGCAGTGAGGCTGG + Intergenic
1141276586 16:82593948-82593970 CTGCATTTGGAAATAGGGGCAGG - Intergenic
1142521613 17:509024-509046 ATGGATGTTGGAATGAAGGCTGG + Exonic
1144157037 17:12514587-12514609 CTCCATGTGGGAATTGAGTCTGG + Intergenic
1145024170 17:19455312-19455334 ATGCATGTAGGAAAAGGGGCAGG - Intergenic
1146885711 17:36469479-36469501 CTGGATGCTGGACTAGAGCCTGG - Intergenic
1157043247 18:44063958-44063980 CTGCCTGCTGGAATAGAGACTGG + Intergenic
1157640759 18:49211656-49211678 CTGCATGTGGGAATAGTGCTGGG + Intronic
1162320034 19:9966323-9966345 CTTCTTGTCGGGATAGAGGCAGG + Exonic
1162768737 19:12936655-12936677 CTGCATGATAGAAGAGAGGAAGG - Intergenic
1163435254 19:17291777-17291799 CTGCATTTTTAAATAGAGACGGG + Intergenic
1165575510 19:36813178-36813200 CTGAAAGTTGGAAAATAGGCTGG - Intergenic
1165755952 19:38293095-38293117 CTCCTTGTTGGAATAGAGGAGGG - Intronic
925264926 2:2560387-2560409 CTGCATTTGGGAATAGAGGTGGG - Intergenic
926887292 2:17609915-17609937 CTCCATGTGGGGATAAAGGCTGG - Intronic
927871628 2:26627805-26627827 CTGGGTCTTGAAATAGAGGCAGG - Intronic
929454225 2:42054867-42054889 CCCCAGGTTGGAATAGAGGAAGG + Intronic
935261577 2:101360219-101360241 AGGCATGTAGGAAGAGAGGCAGG - Intronic
936238673 2:110768431-110768453 CTGCACGTTTTAACAGAGGCAGG - Exonic
936369926 2:111895322-111895344 CTACATGGTAGACTAGAGGCAGG + Intergenic
937239865 2:120453089-120453111 CTGCCTGCTGGGATAGGGGCTGG + Intergenic
937456253 2:122044215-122044237 CTGCATGTCTGAATAGGGTCTGG - Intergenic
937677537 2:124608429-124608451 CTGCATGCTCAGATAGAGGCAGG - Intronic
938987793 2:136596464-136596486 CTGCAAGGTGGCAGAGAGGCTGG + Intergenic
939594982 2:144111715-144111737 CTTAATGTTGGAAGAGAGTCAGG - Intronic
940245585 2:151611973-151611995 GTGCATGTGGGAACAGAGCCTGG - Intronic
941054047 2:160766912-160766934 CTGCAAGGTGGCAGAGAGGCTGG + Intergenic
944026076 2:195169225-195169247 ATGCATGTAGGAATAAAGGTAGG + Intergenic
947308078 2:228769416-228769438 TTGCATTTTGGAATATAGACTGG + Intergenic
948025879 2:234775874-234775896 CTGCAAGGTGGCATCGAGGCTGG + Intergenic
1171880081 20:30611889-30611911 CTGAACGTTGGAATGGAGTCGGG + Intergenic
1173301400 20:41806978-41807000 CTGCAAGGTGGCAGAGAGGCTGG - Intergenic
1173632541 20:44527503-44527525 CTGCTGGTTGGAATAAAGACTGG + Intergenic
1178433060 21:32533745-32533767 GTGTATGTTTGAACAGAGGCCGG + Intergenic
1178705308 21:34868102-34868124 CTGCAGGTAGGAAGAAAGGCAGG + Intronic
1178778437 21:35575428-35575450 CTGCATGTTGGAATAGAGGCCGG - Intronic
1182332171 22:29558892-29558914 CTGCCTGGAGGAAGAGAGGCTGG - Exonic
1184386162 22:44175809-44175831 CTGCATCTGGGCATAGAGGCGGG + Intronic
951336102 3:21423918-21423940 TTCCATTTGGGAATAGAGGCTGG + Intronic
951672937 3:25205139-25205161 CTGCAAGGTGGCAGAGAGGCTGG - Intronic
952974022 3:38678967-38678989 CTAGCTGTTGGCATAGAGGCCGG + Intergenic
955350798 3:58191792-58191814 GTGGATGTTGCAATAGAGGTAGG + Intergenic
955428428 3:58816687-58816709 CTGCAAGGTGGAAGCGAGGCTGG + Intronic
955438582 3:58931193-58931215 CTGCAAGGTGGAAGCGAGGCTGG + Intronic
956840855 3:73138549-73138571 CTGCATGTCTGACTACAGGCTGG + Intergenic
957871311 3:86093377-86093399 CTGCAAGGTGGCAGAGAGGCTGG + Intergenic
957880460 3:86205557-86205579 CTGCTTATTAGAAAAGAGGCAGG - Intergenic
958498666 3:94877222-94877244 TTTCATGTTAGAATAGAGACTGG + Intergenic
958806769 3:98820828-98820850 TTGTATGTTGGACTAAAGGCAGG - Intronic
959070977 3:101701873-101701895 CTGCATGTTGGTCCAGTGGCTGG - Intergenic
960563616 3:119112313-119112335 CTGCAAGGTGGCAGAGAGGCTGG - Intronic
960922791 3:122765014-122765036 GAGCATGTTGAAATTGAGGCAGG + Intronic
963855270 3:150247055-150247077 CTGTATTTTTGAATAGAGACGGG + Intergenic
963971554 3:151435639-151435661 GTGAATGTTTGAATAGATGCTGG + Exonic
964243189 3:154619781-154619803 CTGCAAGTTGGCAGCGAGGCTGG + Intergenic
967128893 3:186452410-186452432 GTGGATGTTGGTACAGAGGCAGG + Intergenic
967499702 3:190183682-190183704 CTTCATGTTGAAATGAAGGCAGG - Intergenic
967915195 3:194573342-194573364 CTGCATGTTGGAATCATGCCTGG + Intergenic
968411144 4:391364-391386 CTGTATGTTGTAATATAGACAGG + Intergenic
969511770 4:7622167-7622189 CTACAGGTTGGAGTAGGGGCTGG - Intronic
970566781 4:17339358-17339380 CTGCATGTAGCAATAGATGCTGG + Intergenic
970947620 4:21713733-21713755 GGGCATGTAGGAAGAGAGGCTGG - Intronic
975341464 4:73245978-73246000 CTACCTGTTGGTATAGATGCAGG - Intronic
976165726 4:82252514-82252536 CTGCATCTTTGAATAAAAGCTGG - Intergenic
977172161 4:93776554-93776576 CTGCATGTTGATATGGAGCCAGG - Intergenic
980723174 4:136723360-136723382 CTGCATGTTCAAATCTAGGCAGG - Intergenic
982268165 4:153559471-153559493 CTAAATATTGGAATAGAGACAGG + Intronic
985222980 4:187727744-187727766 CTGGATGATGGGAAAGAGGCAGG + Intergenic
987047246 5:14119646-14119668 CTGCATGTTGGCATCAAGGATGG + Intergenic
987134096 5:14884904-14884926 CTGCTTGGTGGAGAAGAGGCTGG + Intergenic
989807836 5:45632814-45632836 CTCCATGCTGAAATAGAAGCTGG + Intronic
991648666 5:68828959-68828981 GTGCATTTTGGAAAAGATGCTGG - Intergenic
994048174 5:95332334-95332356 ATGCATGTGGGAATGGAGGAGGG + Intergenic
995690372 5:114818997-114819019 CTGCAAGTTGGCAGTGAGGCTGG - Intergenic
995933041 5:117473874-117473896 CTGCATATTGGAATTAAGGGGGG + Intergenic
996779539 5:127170954-127170976 CTGCATGTTGGAATGTTGGAAGG + Intergenic
997744767 5:136289570-136289592 CTGCAAGGTGGAAGTGAGGCTGG + Intronic
998714618 5:144868664-144868686 CTGGAGGTTAGAGTAGAGGCAGG + Intergenic
999027004 5:148244458-148244480 CCGATTGTTGGAAGAGAGGCAGG - Intergenic
1003169216 6:3708011-3708033 CTGGATGATGGAATGGAGGTTGG + Intergenic
1004968157 6:20878371-20878393 CCGCATGTAGGAAAAAAGGCAGG - Intronic
1005224632 6:23627188-23627210 CTCCATGTTTAAACAGAGGCAGG + Intergenic
1005263172 6:24083254-24083276 CTGCAAGGTGGCAGAGAGGCTGG + Intergenic
1010370986 6:75107074-75107096 TTGTATTTTGTAATAGAGGCGGG + Intronic
1016078675 6:139829242-139829264 CTGCATGTTCTGAAAGAGGCTGG - Intergenic
1016426463 6:143941432-143941454 ATGCATGATGGAAATGAGGCAGG + Exonic
1018100647 6:160436150-160436172 CCGCATGTTAGACTGGAGGCAGG + Intronic
1018783084 6:167086650-167086672 CTGCAAGTTGGCAGCGAGGCTGG - Intergenic
1021058052 7:16075193-16075215 GTTCATGTTTGAATAGAGACAGG - Intergenic
1021428066 7:20525849-20525871 CTGCATTTTAGAATCAAGGCTGG - Intergenic
1021757939 7:23873567-23873589 CAGCATGGTGCAATAGAGGATGG - Intergenic
1022705303 7:32796481-32796503 CGGCATGTATGAATAGAGGAAGG - Intergenic
1026903385 7:74049223-74049245 CTGCATGGAGGAATGGAGGATGG - Intronic
1027964977 7:84993159-84993181 CTGCAAGTTGGCAGTGAGGCTGG - Intergenic
1028831630 7:95334267-95334289 CAGCATGCTGCAACAGAGGCTGG + Intergenic
1029175695 7:98662847-98662869 CTGGGGGTTGGAACAGAGGCTGG - Intergenic
1029951665 7:104592818-104592840 CTGCAAGGTGGCAGAGAGGCTGG - Intronic
1031383513 7:121117612-121117634 ATGCATTTTGGAGTGGAGGCAGG + Intronic
1033578953 7:142714092-142714114 CTGGATGGTGGAATAGAAGGAGG - Intergenic
1037205399 8:16312097-16312119 ATCCATGTTGGCATAGGGGCAGG - Intronic
1037353945 8:17997851-17997873 TTGTATGTTGTAGTAGAGGCGGG - Intronic
1041813035 8:61933220-61933242 CTGCATGTAGAAAAAGAGTCTGG + Intergenic
1043213874 8:77560522-77560544 TTGCATGTTGGATTAGAAACTGG - Intergenic
1043612102 8:82077704-82077726 TTGTATTTTGAAATAGAGGCGGG + Intergenic
1045413688 8:101945205-101945227 ATGCTTGTTGGAAAAGTGGCTGG - Intronic
1046896542 8:119479463-119479485 CTGCAAGTCGGCATGGAGGCCGG - Intergenic
1048861846 8:138729636-138729658 CTGTAAATTGGAAAAGAGGCTGG - Intronic
1048930729 8:139313686-139313708 CTGCATTTTAGGATAGAAGCAGG - Intergenic
1050259492 9:3826619-3826641 CTGCATGTTGGAATGAACTCTGG + Intronic
1055770015 9:79706840-79706862 CTGGAAGATGCAATAGAGGCTGG - Exonic
1055806070 9:80095199-80095221 CTCCACTTTGGCATAGAGGCAGG - Intergenic
1055970340 9:81905633-81905655 CTGTCTGTTGGAATAGGGGAAGG + Intergenic
1055972531 9:81926078-81926100 CTGTCTGTTGGAATAGGGGAAGG + Intergenic
1055974284 9:81941150-81941172 CTGTCTGTTGGAATAGGGGAAGG + Intergenic
1057520898 9:95759462-95759484 CTCCAGGTCGGAATAGAGGTCGG + Intergenic
1057599485 9:96445006-96445028 CAGCAGGTAGGAATAGATGCTGG - Intergenic
1058348527 9:103993531-103993553 ATGCATGATGGAATGGAGGTGGG + Intergenic
1058451210 9:105098201-105098223 CCCCTTGTTGGAGTAGAGGCTGG - Intergenic
1058651390 9:107178262-107178284 CTGCATGTTGTAATGAAAGCAGG + Intergenic
1059614256 9:115931794-115931816 CTGCATCTGGAAATAGAGGAAGG + Intergenic
1060454728 9:123781133-123781155 CTGCAAGTTGGAAGTGAGGTTGG - Intronic
1060515891 9:124265613-124265635 CTGCATGTGGGACCTGAGGCTGG - Intronic
1061371831 9:130201736-130201758 CTGCAGCTTGGACTTGAGGCAGG - Intronic
1061528962 9:131194883-131194905 GTGCATGTGGGAATGGTGGCCGG - Intronic
1187125535 X:16451160-16451182 CAGCATGGTGGAATACAGGCTGG - Intergenic
1187440162 X:19311007-19311029 CTGCAGCTTGGAAGACAGGCAGG + Intergenic
1191032658 X:55991219-55991241 CTGCAAGGTGGCAGAGAGGCTGG - Intergenic
1191048256 X:56162483-56162505 CTGCAAGGTGGCAGAGAGGCTGG - Intergenic
1191092321 X:56636421-56636443 CTGCAAGTCGGAAATGAGGCTGG + Intergenic
1199720293 X:150538627-150538649 CAGCATGTTGGAATAGAAAGTGG + Intergenic
1199856488 X:151763033-151763055 TCACATGCTGGAATAGAGGCAGG - Intergenic