ID: 1178778721

View in Genome Browser
Species Human (GRCh38)
Location 21:35578486-35578508
Sequence ATTCAGAAGACAAATGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 541
Summary {0: 1, 1: 0, 2: 5, 3: 34, 4: 501}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178778718_1178778721 1 Left 1178778718 21:35578462-35578484 CCCAGAACGTGGGCGATTCAAAT 0: 1
1: 0
2: 0
3: 6
4: 21
Right 1178778721 21:35578486-35578508 ATTCAGAAGACAAATGAGGCAGG 0: 1
1: 0
2: 5
3: 34
4: 501
1178778719_1178778721 0 Left 1178778719 21:35578463-35578485 CCAGAACGTGGGCGATTCAAATG 0: 1
1: 0
2: 1
3: 1
4: 20
Right 1178778721 21:35578486-35578508 ATTCAGAAGACAAATGAGGCAGG 0: 1
1: 0
2: 5
3: 34
4: 501

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178778721 Original CRISPR ATTCAGAAGACAAATGAGGC AGG Intronic
901096258 1:6682629-6682651 ATTCAGAAAAGAAACAAGGCTGG + Intronic
902711604 1:18243703-18243725 TTACAGAACCCAAATGAGGCTGG - Intronic
902979120 1:20110372-20110394 ATTAAAAAGACAGAGGAGGCCGG + Intergenic
903425220 1:23248659-23248681 TTTAAAAAGACTAATGAGGCCGG + Intergenic
903527432 1:24002513-24002535 ATGAAGAAGATAAAAGAGGCCGG + Intergenic
903854134 1:26326239-26326261 ATTAAGAAAAAAAATCAGGCTGG + Intronic
904165495 1:28552226-28552248 ATTTAGAAAACAAACAAGGCCGG - Intergenic
904431880 1:30469595-30469617 ATCCAGAACTCAAATGGGGCTGG - Intergenic
905520156 1:38591972-38591994 ATTCATAAGTGAAATGAGTCTGG + Intergenic
906255140 1:44343003-44343025 ATTTAGAAGGCAACTGGGGCTGG - Intronic
906259389 1:44375224-44375246 ACCCAGCAGACCAATGAGGCTGG + Intergenic
907684007 1:56591987-56592009 ATTCAGGTGAAAAATGAGGAAGG + Intronic
907983488 1:59507829-59507851 TTTAAGAAGATAAATGTGGCCGG - Intronic
908518218 1:64915104-64915126 ATTGTGAAGGTAAATGAGGCAGG + Intronic
908583466 1:65543114-65543136 ATTCAGGAAACAAAAGATGCTGG - Intronic
909215531 1:72882997-72883019 ACTCCTAAGACCAATGAGGCTGG - Intergenic
910495613 1:87824208-87824230 AATCTGAAGACAAATAAAGCAGG + Intergenic
910715025 1:90221387-90221409 ATTCAGAAGAGAAGGGATGCTGG + Intergenic
911185899 1:94904794-94904816 AATGAGAAGACAAATGATACTGG - Intronic
911223317 1:95276002-95276024 ATTCACAAAACTAATGAGTCAGG - Intergenic
911670988 1:100607405-100607427 AGTCAGGAGAAAAATGAGGAGGG - Intergenic
911804309 1:102186178-102186200 ATTTAGATGTCAAAGGAGGCAGG + Intergenic
912229008 1:107770311-107770333 TTTCTGAAGAAAAATAAGGCAGG - Intronic
912771577 1:112468960-112468982 ATACAGAAGACAACTGAAGATGG - Intronic
912781234 1:112550297-112550319 ACTCAGAAAATAAATGAGGAAGG - Intronic
912789222 1:112635303-112635325 ATTCAGTAGACTAATGAAGGAGG + Intronic
913016523 1:114742292-114742314 ACAAATAAGACAAATGAGGCCGG + Intronic
913037260 1:114982269-114982291 ACTCCCAAGACAAGTGAGGCAGG - Intronic
913089680 1:115468050-115468072 ATTCAGAAGAAAATTGGGCCAGG + Intergenic
913392982 1:118334831-118334853 GTTCAGAAAACAAAGGAAGCTGG - Intergenic
913546752 1:119876505-119876527 CTTCAGAAAACAGATGAGGAAGG + Intergenic
914942222 1:152033323-152033345 ACTCAGCAGACACATGTGGCTGG + Intronic
915678865 1:157559966-157559988 ATTCATAAGACAAAGGTGGTTGG + Intergenic
916253144 1:162758116-162758138 ATTCAGTAGAGAAATAAGGAAGG + Intronic
917495205 1:175534240-175534262 ATTCAGGACACAAGGGAGGCAGG - Intronic
917939363 1:179902598-179902620 ATTCATAGGAAAAATGAGGAAGG - Intronic
918337737 1:183537153-183537175 ATTCAGAAGAGAAATCAACCAGG - Exonic
918627177 1:186669644-186669666 AGTCAGAAAACAACTGATGCTGG + Intergenic
920355698 1:205370622-205370644 ATTCAGAAGTCAGATGAGGCCGG - Intergenic
922938671 1:229441184-229441206 ATTCTGAAAATACATGAGGCTGG + Intergenic
923582154 1:235228134-235228156 ATTTAAAAGAAAAATCAGGCCGG - Intronic
924256118 1:242184662-242184684 AGTCAGAAGACAACTGAGGCTGG - Intronic
924715495 1:246569028-246569050 ATTTAAAAGCCAAAAGAGGCTGG - Intronic
924736472 1:246761369-246761391 AATAAGAAGAAAAAAGAGGCCGG - Intronic
1063302975 10:4869074-4869096 CTTCAGAAAACAAAAGAGGAGGG - Intergenic
1063859001 10:10288477-10288499 AGTCAGAAAACAAACGATGCTGG + Intergenic
1063861439 10:10312138-10312160 ATTCAGAGCACAAGTGAGTCTGG + Intergenic
1064180398 10:13109527-13109549 ATTCAAAAGGAAAAAGAGGCTGG + Intronic
1064597418 10:16960193-16960215 ATTCAAAATACATATGAGGCCGG + Intronic
1065007835 10:21395916-21395938 ATTTAAAAAATAAATGAGGCTGG + Intergenic
1065119807 10:22517255-22517277 ATTAAAAAGACCAATCAGGCTGG + Intergenic
1065491539 10:26287226-26287248 CTACAGGAGACAAATGAAGCCGG - Intronic
1066072501 10:31834042-31834064 ATTCAGAAGACAAAATTGACAGG + Intronic
1066305266 10:34134219-34134241 CTTCATAAGACAAAAGAGACAGG + Intronic
1067730570 10:48807938-48807960 ACTCAGAGGACAGATGAAGCTGG - Exonic
1068177463 10:53479567-53479589 ATTCAGAGGACAAAGAAGGCAGG - Intergenic
1068516047 10:58026849-58026871 TATCAGAAAACACATGAGGCCGG + Intergenic
1068938616 10:62659090-62659112 AGGCAGAAGACAAAAGAGCCTGG + Intronic
1069549930 10:69356586-69356608 ACATAAAAGACAAATGAGGCCGG + Intronic
1069985371 10:72279388-72279410 ATTCAAAAGAAAAATAAGGCTGG + Intergenic
1071492556 10:86145760-86145782 ATAAAGAACACAAATGAGGAAGG - Intronic
1072002376 10:91209458-91209480 ATTAAAAAGAAAAAGGAGGCCGG + Intronic
1073563281 10:104515269-104515291 TTTAAGAAGCCAAATGTGGCTGG + Intergenic
1074088264 10:110225226-110225248 ATACATAAGGAAAATGAGGCTGG + Intronic
1074449855 10:113550192-113550214 ATTTAGAAGGAAAAAGAGGCTGG - Intergenic
1074979272 10:118606618-118606640 ACTCAGATGCCAAATGAGGGTGG - Intergenic
1075033232 10:119041269-119041291 ACTAAGAAAAAAAATGAGGCTGG + Intronic
1075151307 10:119935162-119935184 TTTTAAAAGACAAAAGAGGCTGG + Intronic
1075882488 10:125865823-125865845 ATTCAGAAAACCCATGGGGCTGG - Intronic
1076392164 10:130111136-130111158 AATCATAAGACAGAGGAGGCGGG - Intergenic
1078127680 11:8584484-8584506 ATTAATAACACAAATAAGGCAGG + Intronic
1078236315 11:9488037-9488059 ACTGAAAAGACAAATGAGGTAGG - Intronic
1078244178 11:9558393-9558415 TTTGAAAAGACAAATAAGGCCGG - Intergenic
1078296690 11:10078126-10078148 ATTCAGGAAACAAAAGATGCTGG + Intronic
1078712557 11:13808777-13808799 ATTCAGAAGATATTTCAGGCAGG - Intergenic
1079154109 11:17928217-17928239 AGTCAGGAGACAGGTGAGGCCGG - Intronic
1080023687 11:27591523-27591545 GTTCAGAAGATAAGTGAGGGAGG + Intergenic
1080134631 11:28840439-28840461 ATTTAGAGGGCAAATGAGTCAGG - Intergenic
1080311445 11:30897781-30897803 ATTCAGAGAACAAATGAGAAGGG + Intronic
1080791288 11:35524787-35524809 CTTCTGGGGACAAATGAGGCTGG - Intronic
1081310156 11:41560859-41560881 ATTTAAAAGAGAGATGAGGCTGG - Intergenic
1082108488 11:48245654-48245676 AATCAGCAGACCAATGAGGAAGG - Exonic
1082926502 11:58553037-58553059 ATTCAAAAGATAAATGGGGCCGG + Intronic
1083240680 11:61385897-61385919 ATTCAGAAATTAAATAAGGCTGG + Intergenic
1083403339 11:62439962-62439984 ACTTAAAAGACAAATGCGGCCGG - Intronic
1083547086 11:63556871-63556893 AAGCAGCAGACAGATGAGGCAGG - Intronic
1083648724 11:64187842-64187864 ATACAGAAGAAAAATTAGCCGGG + Intronic
1083852661 11:65377138-65377160 ATTCACAAGAGGAAGGAGGCAGG + Intronic
1084854975 11:71977753-71977775 ATTCAGTGGAAAGATGAGGCAGG - Intronic
1084953522 11:72679441-72679463 ACCCACAAGACAAAAGAGGCAGG - Intergenic
1085434436 11:76486979-76487001 GTTAATAAGACAGATGAGGCTGG + Intronic
1085736208 11:79041358-79041380 CTTCAAGAGACAAATGAGGCCGG - Intronic
1086094683 11:83038522-83038544 ATTAAGAAAAATAATGAGGCTGG + Intronic
1086532861 11:87806613-87806635 ATTAAGAATACAAATGAAACAGG - Intergenic
1086748241 11:90456918-90456940 ATTCAAAAGACAACAGACGCTGG + Intergenic
1086778906 11:90877883-90877905 ACTGAAAAGACAAATGAAGCTGG - Intergenic
1087386058 11:97470538-97470560 ATTTAGAATACAAATGAAGATGG + Intergenic
1088455088 11:110024913-110024935 ATTCAGAAAAAAAATGAGAGAGG + Intergenic
1090176924 11:124658376-124658398 ATTCACAGGACTTATGAGGCTGG - Intronic
1090778951 11:129989904-129989926 ATTAAGAAGAAAACTCAGGCCGG + Intronic
1091553642 12:1555309-1555331 GGTCAAAAGACATATGAGGCCGG - Intronic
1091641636 12:2241562-2241584 CTTCCGAAGACAGATGGGGCAGG + Intronic
1091880333 12:3972127-3972149 ATAAATAAGACAAAGGAGGCCGG - Intergenic
1093843052 12:23929377-23929399 ATTCAGGAAAAAAATGAGGGTGG - Intronic
1094231910 12:28115308-28115330 ATTTAAAAGACAAATCAGGAAGG - Intergenic
1095793314 12:46190588-46190610 AGTCAGAAGACAACAGACGCTGG - Intronic
1096310334 12:50515121-50515143 TTTCAGAAGCTTAATGAGGCAGG - Intronic
1096824310 12:54263062-54263084 ATTGAGATGAGAAAAGAGGCTGG + Intronic
1097644755 12:62223011-62223033 AAAAAGAAGACAAATGAAGCAGG + Intronic
1098306131 12:69104588-69104610 ATTCAGACAACAAATGTGCCTGG + Intergenic
1098845503 12:75530438-75530460 AGTCAAAAAACAAATGATGCTGG - Intergenic
1098947870 12:76608405-76608427 ATTCAGGAGGCAGATGAGGGAGG - Intergenic
1099326790 12:81226478-81226500 AATCAGAAGACAGATGAGCCTGG - Intronic
1099784381 12:87241757-87241779 AGTCACAAGACAAAGGGGGCTGG - Intergenic
1099805122 12:87508659-87508681 ATTAAGAAGACAAAGGGGGCCGG - Intergenic
1101327437 12:103728404-103728426 ATTCAAAATACAAACAAGGCTGG - Intronic
1101786688 12:107890176-107890198 ATTTATAAGAAAAATTAGGCTGG - Intergenic
1102050754 12:109860272-109860294 CTTAAGAAGATAAACGAGGCTGG - Intronic
1102613231 12:114130855-114130877 CCTCAGAAGACCAAGGAGGCTGG - Intergenic
1103432075 12:120896616-120896638 ATACAGAAAACAAATTAGCCGGG + Intronic
1104337032 12:127908849-127908871 ATTAAAAAGACAAATGGGGTCGG + Intergenic
1104863302 12:131936810-131936832 ATACAGAAGACGAAGGTGGCAGG + Intronic
1105628173 13:22134281-22134303 ATACAGAAGATAGATGAAGCTGG + Intergenic
1106112160 13:26786502-26786524 ATTCAGAAGAAAGCTGGGGCTGG + Intergenic
1106189393 13:27438088-27438110 ATTAAAATGACAAATGAGGGAGG + Intronic
1106447787 13:29851767-29851789 ATTCAGCAAACAAATGTGCCAGG + Intergenic
1107256481 13:38433538-38433560 ATTCAGAAAACAACAGATGCTGG - Intergenic
1107696242 13:43002918-43002940 ATTCAGATGAAAAATGATGGTGG + Intergenic
1108941041 13:55953118-55953140 AGTCAGAAAACAAAAGATGCTGG + Intergenic
1110600733 13:77370086-77370108 ATTCAGAAAACAACAGATGCTGG + Intergenic
1110761465 13:79235293-79235315 AGACAGAAGACAAATGAAGTGGG + Intergenic
1110992780 13:82064970-82064992 ATTCAGAAGAAAAATGCAGAGGG + Intergenic
1111109928 13:83693723-83693745 ATCCAGAATACAAAACAGGCTGG - Intergenic
1111232831 13:85365530-85365552 ATTCAGAAGAGAAATAATGTGGG - Intergenic
1111968008 13:94880651-94880673 ATCAAGAAGCCACATGAGGCAGG + Intergenic
1114894463 14:26969826-26969848 ATTCTAAAAAAAAATGAGGCTGG + Intergenic
1115334129 14:32228520-32228542 ATTCTGATGAGAGATGAGGCTGG + Intergenic
1115565167 14:34618861-34618883 ATTATGAAGAAAAATGAGGGAGG - Intronic
1115593527 14:34886994-34887016 AATCAAAAGAGAAATCAGGCCGG + Intergenic
1116596564 14:46855882-46855904 TTTTAGAAGAAAAATGAGACAGG - Intronic
1116922661 14:50596911-50596933 ATTAAGAAGAAAAAGTAGGCTGG + Intronic
1117243947 14:53864719-53864741 ATTCAGATGAGAAATGATGATGG + Intergenic
1117523630 14:56575701-56575723 GTTTTGAAGACAAATGAGGCTGG - Intronic
1118428231 14:65691020-65691042 ATACAAAAGTCAAATGTGGCTGG - Intronic
1118850861 14:69582304-69582326 ATTAAGAAGAAAAAGGAGGGGGG - Intergenic
1119617644 14:76109411-76109433 AGTCTGAAGAGAAGTGAGGCTGG - Intergenic
1121579506 14:95017088-95017110 ATTTAGAAAACAAATGCTGCAGG - Intergenic
1121723046 14:96125124-96125146 TTTAAAAAGACAGATGAGGCTGG + Intergenic
1122023971 14:98861131-98861153 CACCAGAAGACAAAAGAGGCAGG + Intergenic
1122880557 14:104688931-104688953 ATCTAGGAGACAGATGAGGCCGG + Intergenic
1125115259 15:36083559-36083581 ATACAAAAGATAAATGAGGCTGG + Intergenic
1125752858 15:42041914-42041936 AGTCAGCAGACAAATGATGGGGG + Intronic
1125864831 15:43036293-43036315 ATACAGAAGAAATATGATGCTGG - Intronic
1126040429 15:44585291-44585313 CTTAAAAAGACCAATGAGGCTGG + Intronic
1126117777 15:45224697-45224719 AGTGAGCAGACAAAAGAGGCTGG - Intergenic
1126230954 15:46323774-46323796 CATCAAAACACAAATGAGGCTGG + Intergenic
1126614018 15:50558245-50558267 ATTCACAGCACAGATGAGGCTGG + Exonic
1126730726 15:51679884-51679906 ATTGAGGAGATAAATGAGTCAGG + Intergenic
1126755865 15:51924274-51924296 ACTCAGCAGACAGAGGAGGCAGG + Intronic
1127063711 15:55215207-55215229 ATTAAGGAATCAAATGAGGCTGG - Intronic
1128733961 15:70040922-70040944 ATTTTGAAGAGAAATGAGGGAGG - Intergenic
1128902458 15:71436975-71436997 ATAAAGAAGACACCTGAGGCTGG + Intronic
1129066201 15:72906423-72906445 ATTAAGAATAAAACTGAGGCTGG + Intergenic
1129476157 15:75785788-75785810 ATACACAGAACAAATGAGGCAGG - Intergenic
1130108946 15:80949331-80949353 CTTCAGCAGACAAGTGAGGGTGG + Exonic
1130157825 15:81368227-81368249 ATACAGAACACACATGTGGCTGG - Intronic
1131029021 15:89170819-89170841 TTTTAAAAGACAAAAGAGGCCGG + Intronic
1131665322 15:94565472-94565494 ATTAAGAAAAAAAATTAGGCTGG + Intergenic
1131710908 15:95055108-95055130 ATTCAGAAGATAAATGGGTCAGG - Intergenic
1131764846 15:95664452-95664474 ATTCAGAAAACAAATGAGACAGG - Intergenic
1132985420 16:2764284-2764306 GTTCTGAAGACAAATGAGACAGG - Exonic
1134206658 16:12243691-12243713 ATTTAGAAGACATCAGAGGCTGG + Intronic
1134637389 16:15802852-15802874 ATTTATAAGAGAAAGGAGGCCGG + Intronic
1134826055 16:17285298-17285320 AATCAGAATTCAAATGAGTCTGG + Intronic
1134855178 16:17512597-17512619 ATTGAGAAGATAAATGGGGAGGG + Intergenic
1135141563 16:19926512-19926534 ATTAAGAATACAGATGGGGCCGG - Intergenic
1135224962 16:20647756-20647778 ATTGGGAAGAAAACTGAGGCAGG + Intronic
1138013312 16:53404852-53404874 ATTAAGAAGAGAAATGAGGCCGG - Intergenic
1138535160 16:57656061-57656083 ATTATAAAGACAAATGAGTCTGG - Intronic
1139831271 16:69800278-69800300 ATTCAGAAGACAAAGCAATCAGG - Intronic
1140088634 16:71818889-71818911 ATTGAAAAGAAAAATGGGGCCGG + Intergenic
1140558847 16:75953941-75953963 ATTTAGATTACAAATCAGGCTGG - Intergenic
1141489614 16:84363301-84363323 ACTAAGAAGAAAAGTGAGGCTGG - Intergenic
1141984615 16:87571746-87571768 ACTCAGAAGAAAAATGAAGCTGG - Intergenic
1142543206 17:678171-678193 TTTGAGAGGTCAAATGAGGCAGG + Intronic
1142580367 17:938174-938196 GGTCAGAGGACAAAAGAGGCCGG + Intronic
1142630429 17:1222363-1222385 ATTAAGAAGCCATTTGAGGCCGG - Intronic
1143938013 17:10507664-10507686 ATTCAGAAGACACAGGAGTCAGG - Intronic
1144284334 17:13758245-13758267 ATGAAGAAGACATCTGAGGCTGG - Intergenic
1144543998 17:16175356-16175378 TTTTAAAAGACAAATGAGTCTGG - Intronic
1144552155 17:16250191-16250213 CTTCGCAAGACAAAGGAGGCAGG - Intronic
1144939938 17:18931930-18931952 ACTCTAAAGACAGATGAGGCCGG - Intergenic
1145086609 17:19947273-19947295 ACTCAGAAAACAAATTAGGAAGG + Intronic
1145992992 17:29090328-29090350 ATACAGATGGGAAATGAGGCAGG + Intronic
1146448538 17:32952943-32952965 CTTCATAAGACAAATGGGGCTGG - Intergenic
1146561080 17:33871201-33871223 GTTCAGAAGCTGAATGAGGCTGG + Intronic
1147126971 17:38377652-38377674 CTTCAGAAGACATGAGAGGCTGG - Intronic
1147198655 17:38784530-38784552 AGTCAGAATATAGATGAGGCTGG - Intronic
1147617541 17:41838578-41838600 CTTCAGAAGGCAAAGGAGCCAGG - Intronic
1148609621 17:48955987-48956009 AATAAGAAGAAAAAAGAGGCCGG - Intergenic
1149033754 17:52111940-52111962 ATTCAGAAAACAAATCTAGCAGG + Intronic
1149070645 17:52538098-52538120 ATTTAGAAGACATATGTGGCAGG + Intergenic
1149515488 17:57277909-57277931 ATTGAGAAAACATTTGAGGCTGG + Intronic
1151304856 17:73256728-73256750 ATTAAAAGGACAAAGGAGGCCGG + Intronic
1151931774 17:77236852-77236874 AAACAGAAGAGAAAAGAGGCTGG + Intergenic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1154297383 18:13162646-13162668 AATAAGAAGACAATCGAGGCAGG + Intergenic
1158585743 18:58732723-58732745 ATGGAGGAGACAAATGAGTCAGG + Intronic
1159178912 18:64875502-64875524 ATTCAGAAGGCAAATGCAGAAGG + Intergenic
1159243162 18:65769757-65769779 ATTAAGAAGAAACATGAGACAGG - Intronic
1159470136 18:68842033-68842055 ATTAAGAAGACAAAATGGGCTGG - Intronic
1159850340 18:73519906-73519928 AAGCAGATGACAAATGAGGTAGG - Intergenic
1164172203 19:22735080-22735102 ATTCAGCACACCAAGGAGGCTGG - Intergenic
1165482631 19:36073768-36073790 CCTCTGAAGAAAAATGAGGCGGG + Intronic
1165636927 19:37348084-37348106 ACGGAGAAGACAAATGAGGAAGG - Intronic
1167204779 19:48093655-48093677 AATGAGAAGACCAGTGAGGCTGG - Intronic
1168101259 19:54142470-54142492 AGTCAGGAGACAAATGAAACTGG - Exonic
1168180560 19:54660148-54660170 ATACAAAAGCAAAATGAGGCCGG + Intronic
925021882 2:576245-576267 ATTCAGGATAGAAATGAGGACGG - Intergenic
925254514 2:2471713-2471735 ATTCAAAAGACAGATGTGGGAGG + Intergenic
925491421 2:4399519-4399541 ATTCCGAATACAAAAGTGGCAGG - Intergenic
925967463 2:9079258-9079280 GTTCAGAAGGGAATTGAGGCTGG + Intergenic
926342545 2:11915709-11915731 ATTTAGACAACAAATGGGGCGGG - Intergenic
926494721 2:13571921-13571943 ATTCAGATGAGAAATGATGATGG - Intergenic
927657965 2:24967402-24967424 TTTCAAAAGACAAAAGTGGCGGG + Intronic
927709252 2:25314817-25314839 ACTCTGCAGGCAAATGAGGCTGG - Intronic
928024435 2:27728379-27728401 TTCCAGAAAACAGATGAGGCTGG + Intergenic
928691045 2:33798972-33798994 CTTTAAAAAACAAATGAGGCCGG + Intergenic
929258871 2:39842872-39842894 ATTCAGAAGACATGTAAGCCAGG + Intergenic
930200574 2:48548794-48548816 ATAAAAAAGAAAAATGAGGCCGG - Intronic
930351558 2:50262530-50262552 ATTCACAAAACAAATCAGCCAGG - Intronic
930451971 2:51552773-51552795 ATACAGATGACAGATGAGGGAGG - Intergenic
930880473 2:56264553-56264575 ATGCAGGAGACAAATGATGGTGG - Intronic
931360241 2:61571809-61571831 CTTCAAAAGACAAAGCAGGCCGG + Intergenic
931613968 2:64136607-64136629 GTTAAAAATACAAATGAGGCTGG + Intronic
931836271 2:66101114-66101136 AGTCGGAACACAAATCAGGCTGG - Intergenic
931951279 2:67365492-67365514 ATTGAGTAGACATATGAGTCTGG + Intergenic
933141941 2:78802113-78802135 ATTTTGAAAACAAATGAGGAAGG - Intergenic
933606327 2:84388232-84388254 ACTCAGAAGACAAATGTAGTTGG - Intergenic
933784183 2:85825342-85825364 ATTAAAAAGTCAGATGAGGCCGG - Intergenic
933832731 2:86223979-86224001 AATCAGTTGACAAATGGGGCAGG + Intronic
935070361 2:99688679-99688701 CCTCAGAAGAAAACTGAGGCTGG - Intronic
935106130 2:100045230-100045252 ACTCAGAAGACAACTGAGCTAGG + Intronic
935165374 2:100564590-100564612 CATCAAAAGAAAAATGAGGCCGG - Intronic
935230803 2:101094225-101094247 TTCCAGATGACAAAGGAGGCTGG + Intronic
935402195 2:102671752-102671774 GCTCAGAAGCCACATGAGGCTGG - Intronic
935595733 2:104876012-104876034 ATTCAAAAGTTAAAAGAGGCTGG - Intergenic
935867522 2:107406638-107406660 ATGCAGAGTAGAAATGAGGCTGG - Intergenic
936549231 2:113420993-113421015 ATTCAAAAGAGAAAAGAGGCCGG + Intergenic
937915745 2:127097910-127097932 GTTCAGAGGGCAAAGGAGGCAGG - Intronic
938549769 2:132369257-132369279 AACCAGAAGACAAGTGAGCCGGG + Intergenic
940527662 2:154838121-154838143 ATTCAAAAGACAAATTAAGATGG + Intronic
941334585 2:164226790-164226812 ATTCAGAAGACAGATGACCTCGG + Intergenic
941382026 2:164805035-164805057 ATCTAGAAGACAAATGATGATGG + Intronic
942393636 2:175523306-175523328 ATTCAGAAGAAAAATCATCCTGG + Intergenic
942665036 2:178308472-178308494 ATTTAGGAGAGAAATGGGGCTGG - Intronic
942854068 2:180524969-180524991 ACTATGAAGACAAATGAGGGAGG - Intergenic
942871054 2:180734553-180734575 AATCAGTACACAAATGTGGCTGG + Intergenic
943332260 2:186573523-186573545 ATTAAGAGGAAAAATGAGGAAGG + Intergenic
943939002 2:193965770-193965792 ATTCAGAAAACGTATTAGGCAGG + Intergenic
944293744 2:198038281-198038303 GTTCTGAAGACAACTGAGCCTGG - Intronic
944769437 2:202898824-202898846 ATTCAGAAGACAAATATTGCTGG + Intronic
945824964 2:214710488-214710510 AATAAGAAGACAACTGAAGCAGG + Intergenic
946049171 2:216847395-216847417 ATTAAAAATACAAACGAGGCTGG - Intergenic
946256745 2:218447886-218447908 ATACTGAAAACAAATTAGGCAGG - Intronic
946270519 2:218588869-218588891 TTTCAGAAAAAAATTGAGGCTGG - Intronic
946901951 2:224381345-224381367 ATTCAGAAGGCAGAAGAGGGAGG + Intronic
946995675 2:225388591-225388613 ATTAAAAAAAAAAATGAGGCTGG + Intergenic
947182303 2:227422010-227422032 ATTAAGAAGCAAAATGAGGCTGG - Intergenic
947707422 2:232287686-232287708 ATTAAGAAGGAAAATGGGGCTGG - Intronic
947766648 2:232642086-232642108 ATGAAAAAGACAAATGAGGCCGG + Intronic
948090977 2:235295249-235295271 ATTCAGAAAAAAAATTCGGCCGG + Intergenic
1169433238 20:5558904-5558926 ATAAAGAAAACAAACGAGGCCGG + Intronic
1173135617 20:40436393-40436415 AATAAAAAGAAAAATGAGGCCGG + Intergenic
1174311025 20:49654808-49654830 ATTAAGAAGCCATAGGAGGCTGG + Intronic
1174621293 20:51876611-51876633 ATTCTGAATAAAAATGAGCCCGG + Intergenic
1175297373 20:57918289-57918311 CTTCAGAAGACACCTGAAGCTGG + Intergenic
1175453493 20:59091420-59091442 TTTCAACAGACAAAGGAGGCTGG + Intergenic
1176416473 21:6478370-6478392 TTTCTGATGACTAATGAGGCCGG - Intergenic
1178186882 21:30232625-30232647 AGTCAGAAGACAACAGATGCTGG + Intergenic
1178405715 21:32321562-32321584 ATTTAGAGGACAAATGACACTGG + Intronic
1178778721 21:35578486-35578508 ATTCAGAAGACAAATGAGGCAGG + Intronic
1179691973 21:43086705-43086727 TTTCTGATGACTAATGAGGCCGG - Intergenic
1180015303 21:45078460-45078482 CTTCAAAGGGCAAATGAGGCAGG + Intronic
1180022769 21:45139215-45139237 ACACAGAAGACAAACAAGGCTGG - Intronic
1180055327 21:45356031-45356053 ATTCAGAAGACAGAGGAAGAGGG + Intergenic
1181627640 22:24132488-24132510 ATTCAGAAGCCTCTTGAGGCTGG - Intronic
1181721018 22:24774482-24774504 ATTTGGAAGGCAAAAGAGGCAGG - Exonic
1182192511 22:28477442-28477464 ATTGAGAAGGCCAATGTGGCTGG - Intronic
1182587894 22:31356043-31356065 ATTAAAAAGAAAAATAAGGCTGG - Intergenic
1182658642 22:31909434-31909456 AATCAGAAGACACATGTAGCTGG + Intergenic
1182774765 22:32822723-32822745 AATCAGAAGTCAAAGGAGGTGGG + Intronic
1183788597 22:40046388-40046410 ATCCAGAATACAAATCAGACTGG + Intronic
1184642510 22:45879920-45879942 AACCAGAAGAGAAATGTGGCAGG - Intergenic
1184805157 22:46790381-46790403 ATTAAGAATACGAATGAGGTGGG - Intronic
1185265300 22:49899170-49899192 ACTCATAAGAAAAATGATGCAGG + Intergenic
949146499 3:707003-707025 TTTCAGAAGCCAAAAGATGCAGG + Intergenic
949683678 3:6543906-6543928 ATTAAGAATACCAATGAGGTTGG - Intergenic
950066534 3:10116132-10116154 ATGCAGAGTACAAAGGAGGCAGG - Intronic
950107122 3:10395261-10395283 ATGCAGGAGACCAAAGAGGCAGG + Intronic
950229988 3:11268152-11268174 ATTAAGAAAGCAAAGGAGGCTGG + Intergenic
950802602 3:15566545-15566567 ACTCAGAAGGCTAAGGAGGCAGG + Intronic
951249635 3:20380007-20380029 GTTAAGAAGACAAAATAGGCCGG - Intergenic
951808300 3:26671309-26671331 ATTTATAAGATACATGAGGCCGG - Intronic
951919390 3:27837587-27837609 ATTCAATAGACAAATGAGATTGG + Intergenic
952818926 3:37469145-37469167 ACCCAGAAGACAGAAGAGGCAGG - Intronic
952865269 3:37851085-37851107 ATTGAAAAGACAGATTAGGCTGG + Intergenic
952987484 3:38799076-38799098 ATTAAGAAGGCAAAAGGGGCTGG - Intergenic
953112815 3:39959838-39959860 ATTCAGAAGAAAAACGATTCCGG - Intronic
953525503 3:43687110-43687132 ATTGAGAAAGCAAATGTGGCAGG - Intronic
953776581 3:45822652-45822674 TTTAAAAAGACAAATGAGGCCGG + Intergenic
955103450 3:55873985-55874007 ATTCATAAAACAAATCATGCTGG - Intronic
955796443 3:62642315-62642337 ATTCAGAAGATGAATAGGGCAGG + Intronic
955853275 3:63244334-63244356 AATCAGAAGGCAACAGAGGCTGG + Intronic
956093297 3:65690619-65690641 ATTAAAAATACAAATGAGCCGGG - Intronic
956774327 3:72552306-72552328 ATTCAAAAGTGAAATGAGCCGGG - Intergenic
957522794 3:81342333-81342355 ATTAAGAAAAGAAATGTGGCCGG + Intergenic
959175203 3:102900107-102900129 ATTCCACAGACAAATGAGCCAGG - Intergenic
959524665 3:107363265-107363287 ATTCAGAAGACTGATGTGGGAGG + Intergenic
960222880 3:115136123-115136145 ATTCAGAAAAGAAATGTGTCAGG - Intronic
960304168 3:116040890-116040912 ATTAAGAAAACAAATTAGCCAGG - Intronic
960553269 3:119000644-119000666 ATTCAGATGAGAAATGATGATGG - Intronic
961730050 3:128958603-128958625 TTTCAGAAGACAAAAAGGGCTGG + Intronic
961904123 3:130244649-130244671 ATTCAGGAGATAAATGAGAGTGG - Intergenic
962039035 3:131685485-131685507 ATTAAGAAGTAAAAGGAGGCTGG + Intronic
963120141 3:141769298-141769320 ATTCAGAAGGCAAAATAGTCAGG - Intergenic
966038499 3:175449687-175449709 ATTAAGAAGAAAATTAAGGCTGG - Intronic
966344460 3:178963225-178963247 ATTAGGAAGACAATAGAGGCAGG - Intergenic
966391033 3:179452336-179452358 ACTCAGAAGAAAAATGGGGGTGG - Intergenic
966832933 3:184026331-184026353 ATTAAGAAGACCAGGGAGGCAGG + Intergenic
967037819 3:185661338-185661360 ATTCAAAAGGCATTTGAGGCTGG + Intronic
967470245 3:189852604-189852626 ATTCAGACAAGAAATGAGGAAGG - Intronic
968011129 3:195277783-195277805 AATCAAAAGGCAAATTAGGCTGG + Exonic
968759603 4:2435625-2435647 GTTCAGAAAACATATGAGGCTGG + Intronic
969754801 4:9142205-9142227 ATTAAAAATACAAATAAGGCTGG + Intergenic
970017331 4:11526579-11526601 ATGCAGAAGAAAGATGATGCAGG - Intergenic
970430099 4:15981273-15981295 ATTAAGATGACAAATTAGCCAGG + Intronic
970741583 4:19246010-19246032 ATTCCTAAGACAAATGAGAATGG - Intergenic
970970593 4:21979120-21979142 AATCAGAAGTCAGATAAGGCTGG + Intergenic
971055471 4:22908217-22908239 ATTCAGAAGTCAAACCAGGTTGG + Intergenic
971412186 4:26385315-26385337 ATACAGAAAACACATAAGGCTGG - Intronic
972189771 4:36575732-36575754 AGTCAGAAAACAAGAGAGGCTGG - Intergenic
972210550 4:36831472-36831494 ATTAAGATGGCAAAAGAGGCTGG + Intergenic
972794868 4:42405347-42405369 ATCCAGAAGAAGAGTGAGGCTGG + Intergenic
973102033 4:46284053-46284075 ATTAAGAACTCAAATCAGGCCGG - Intronic
973255315 4:48105756-48105778 ACTCAGGAGAGAGATGAGGCGGG - Intronic
974305766 4:60137576-60137598 ATACAGAAAGCAAATCAGGCCGG - Intergenic
975077297 4:70226992-70227014 ATTTAGAAGAAGAAAGAGGCAGG - Intronic
976018118 4:80585141-80585163 ATTTAGAAGGCAAATTTGGCAGG + Intronic
976020633 4:80620704-80620726 TTTAAGCAGACAAAAGAGGCAGG - Intronic
976267676 4:83200357-83200379 ATTAAGAAGGCAAAACAGGCTGG + Intergenic
976921041 4:90443281-90443303 ATGCAGAAGAATAATGATGCTGG - Intronic
977903814 4:102453580-102453602 ATTCAGACCACAAGTGAGGGAGG + Intergenic
978560507 4:110028973-110028995 ATTCAAGTGAAAAATGAGGCAGG + Intergenic
980755377 4:137151840-137151862 TTTCAGAAGTTAAATGAGGTTGG - Intergenic
981037244 4:140184833-140184855 ATTCAGAAAACAAATATGTCAGG - Intergenic
982847350 4:160270781-160270803 AGTCAGAATACAAAGCAGGCAGG + Intergenic
982990727 4:162270423-162270445 ATTCAGAATAGAAATCAAGCAGG - Intergenic
983585062 4:169345581-169345603 ATTCAGAAGAACAATGACTCTGG - Intergenic
984004307 4:174290148-174290170 ATTAAGAAGAAGAAAGAGGCAGG - Intronic
984341863 4:178467331-178467353 AAAAAGAAGACAAATTAGGCTGG - Intergenic
984475658 4:180231143-180231165 ATTCAGAAGGCAAAGGAGAAGGG + Intergenic
984557541 4:181233514-181233536 ATTCAGAAGACAAAGCAAGTAGG + Intergenic
984648498 4:182244247-182244269 ATAGAAAACACAAATGAGGCCGG - Intronic
985814020 5:2112897-2112919 GTTCAGCAGAAAAATGAGGTTGG + Intergenic
986198233 5:5557662-5557684 ATTCACAAGTCAATTGAGACAGG - Intergenic
986416482 5:7534044-7534066 ATTCAGGAGACTCAGGAGGCTGG - Intronic
986857881 5:11892290-11892312 ATCGAGAAGACAAATAAGGTAGG - Intronic
986902324 5:12451644-12451666 ATTCAGCATACTAATCAGGCGGG - Intergenic
988485810 5:31667435-31667457 TTCCGGAAGAAAAATGAGGCAGG + Intronic
989759812 5:45000136-45000158 ATTAAGAAAACAAATCAGGCTGG + Intergenic
989796710 5:45483262-45483284 AGTCAGAAAACAAAAGATGCTGG - Intronic
990428322 5:55710994-55711016 ATTAAAAAGAAAAAAGAGGCTGG + Intronic
990636292 5:57731670-57731692 GTTAAGAAGATAAGTGAGGCAGG + Intergenic
990802293 5:59618676-59618698 TTTCAGAAGACAGATGATGGTGG + Intronic
990834096 5:59995613-59995635 ATTGAAAAGAAAAATGCGGCCGG - Intronic
991264934 5:64706539-64706561 TTTTAGAAGAAAAATGAGTCTGG + Intronic
991454456 5:66787670-66787692 ATTCTGGAGAGGAATGAGGCTGG + Intronic
992701927 5:79349536-79349558 AATCATAAGCCACATGAGGCAGG - Intergenic
993661833 5:90647066-90647088 GTTAAGAATACAAATCAGGCTGG - Intronic
994102493 5:95909115-95909137 ATGGAGAAGACAAATAAGGGAGG + Intronic
994220588 5:97190544-97190566 ATACAAAAGATAAATAAGGCTGG - Intergenic
994816094 5:104590727-104590749 ATAAAGAAAACACATGAGGCAGG + Intergenic
996113338 5:119591389-119591411 GTTAAAAAGCCAAATGAGGCCGG + Intronic
996598576 5:125233838-125233860 TTTCAGAGGACAAATCAGTCAGG - Intergenic
996627818 5:125590750-125590772 ATGCAGAAGACACATGGGTCTGG - Intergenic
996811716 5:127522930-127522952 ATTTAAAATAAAAATGAGGCTGG - Intronic
997010231 5:129868296-129868318 ATTCAAAAGACCAACAAGGCCGG + Intergenic
997094294 5:130893331-130893353 ATCCAAAAGACAAATGATGGTGG + Intergenic
997125046 5:131217876-131217898 ATACATTAGAAAAATGAGGCTGG + Intergenic
999094524 5:148966135-148966157 AAGCAGAAGACTAGTGAGGCAGG - Intronic
999148511 5:149411451-149411473 ACTCAGTAGACCAATGAGACAGG - Intergenic
999213980 5:149916132-149916154 ATAAAAAAGAGAAATGAGGCCGG - Intronic
999551762 5:152695265-152695287 GCTGAGAAGAAAAATGAGGCTGG - Intergenic
999562424 5:152819223-152819245 ATTCAGTACACAAATCAGTCTGG + Intergenic
999769603 5:154765361-154765383 ACTAAGAAGAAAAATGAAGCAGG - Intronic
1000156843 5:158560599-158560621 ATTCAGAGGACACATGTGCCAGG + Intergenic
1000765530 5:165284753-165284775 AATGAAAAGAAAAATGAGGCTGG + Intergenic
1001840971 5:174876435-174876457 ATTCAGAAGAGGAAGCAGGCAGG + Intergenic
1002708011 5:181175943-181175965 ATTAAGAAAATAAAGGAGGCCGG + Intergenic
1003145740 6:3508847-3508869 AAACAGAAGAAAAATGAGGAGGG - Intergenic
1003714461 6:8630869-8630891 ATTCAAAAGAAACATCAGGCTGG + Intergenic
1003923686 6:10856891-10856913 ATTCATAAGCCCAATGATGCAGG - Intronic
1004528447 6:16430912-16430934 TTACAGAAGAAAAAAGAGGCGGG + Intronic
1004766716 6:18737314-18737336 CTTCAATAGAAAAATGAGGCCGG + Intergenic
1004789081 6:19004420-19004442 ATTCATAAGAGTAATAAGGCAGG - Intergenic
1004809468 6:19243939-19243961 AGTCAGAAAACAACAGAGGCTGG + Intergenic
1006054119 6:31368226-31368248 ATTCAGATAATAAATGAGGAAGG - Intergenic
1007933821 6:45715683-45715705 ACTCAGAAGTCACATGTGGCTGG - Intergenic
1009029456 6:58038882-58038904 ATCCAGGAGAGAAATGAGGGAGG - Intergenic
1009768332 6:68111304-68111326 AGTCAAAAGAGAAATGAGCCGGG - Intergenic
1010139788 6:72601098-72601120 ATTCAAAAGACAGACAAGGCTGG - Intergenic
1010544234 6:77130178-77130200 AGTCAAAAAACAAATGATGCTGG + Intergenic
1011208129 6:84923539-84923561 ATTCAGAACACAAAGGCAGCTGG + Intergenic
1011596935 6:89025293-89025315 ATTCAAAATATAAAAGAGGCTGG - Intergenic
1012299449 6:97566589-97566611 ATTCTAAAGTCCAATGAGGCAGG - Intergenic
1012515367 6:100053153-100053175 ATCCTGAAGAAAAGTGAGGCTGG + Intergenic
1013322142 6:109004086-109004108 ATTCAGAAAAAAAGTGAAGCTGG + Intronic
1013696632 6:112710126-112710148 ATTCACTAGTCAAGTGAGGCAGG - Intergenic
1014676807 6:124377899-124377921 ATACATAAGAGAAAGGAGGCTGG - Intronic
1014865846 6:126529192-126529214 ATTAAGAAGACAAAATAGGCTGG + Intergenic
1014991011 6:128076348-128076370 ATTCAGAGGGTAAAGGAGGCAGG + Intronic
1015933254 6:138383508-138383530 AATCAGAAGACAAATAAGCAAGG - Intergenic
1015957210 6:138611138-138611160 TTTCTGAAGAAAAAGGAGGCAGG + Intronic
1017270988 6:152505042-152505064 ATCCAGAAGAAAATTGATGCAGG + Intronic
1017516625 6:155161872-155161894 ATTAAAAAGACAAAAAAGGCCGG - Intronic
1017680974 6:156863297-156863319 ATTTAGAGGACTAACGAGGCAGG + Intronic
1018468966 6:164079879-164079901 AGACAGAAGACAGAAGAGGCTGG - Intergenic
1018549234 6:164975955-164975977 ATTGAGAAAGCAAATGAAGCTGG - Intergenic
1018772223 6:166981007-166981029 ACTCTGAAGACATATGAGGAGGG - Intergenic
1020661893 7:10993626-10993648 ATTCTGAAGAAAAATGAAGTAGG + Intronic
1021113666 7:16724435-16724457 CCTCAGAACATAAATGAGGCTGG + Intergenic
1021146368 7:17094086-17094108 ATTCAGAGCATAAATGAGGTGGG + Intergenic
1022521680 7:31012332-31012354 ATTAAAAATTCAAATGAGGCAGG - Intergenic
1023446035 7:40232572-40232594 ATTAAGAAGAAAAATGGGGTAGG + Intronic
1024118247 7:46212904-46212926 TTTCAAAAGGCAAATGATGCAGG + Intergenic
1024241386 7:47439090-47439112 ATTAGGAAGACAAATTAGGTGGG - Intronic
1024895387 7:54254721-54254743 ATTCAGAAGACTAATGCGATTGG + Intergenic
1026156604 7:67831507-67831529 ATTAAGAAGAGACATTAGGCTGG - Intergenic
1026248570 7:68646225-68646247 CTTCTGAATAAAAATGAGGCTGG - Intergenic
1026480878 7:70778382-70778404 ATACAGGAGACCAATGAGCCAGG + Intronic
1026671735 7:72396750-72396772 ATTCTTAAGACAAGTGAGTCGGG + Intronic
1027780316 7:82512333-82512355 ATACAGAAGACAAGTGAGTTGGG + Intergenic
1028840191 7:95421206-95421228 GTTCAGAATACAAATGTTGCTGG + Intronic
1028894193 7:96022564-96022586 TTTTAGAAGAAAAAAGAGGCTGG + Intronic
1029018099 7:97335537-97335559 AGTCAGAAAACAACTGATGCTGG + Intergenic
1029887369 7:103887544-103887566 ATTCAAAAGAAAAATGAGGTGGG + Intronic
1030740326 7:113101698-113101720 CTACAGAAGACAAAAGAAGCAGG + Intergenic
1030855494 7:114550410-114550432 CTTCAAAAGAAAGATGAGGCCGG - Intronic
1031834189 7:126662522-126662544 ATTCAGAAAACAAAAAAGGTGGG + Intronic
1031837491 7:126695875-126695897 ATTCAGGAAAGAAATGAGGAGGG + Intronic
1031989385 7:128187509-128187531 AGTCAAAAGAAAAATAAGGCCGG - Intergenic
1032356460 7:131215624-131215646 ATTAAAAAGACAATTCAGGCTGG - Intronic
1034247578 7:149659595-149659617 ATACAAAAGATAAATGAAGCTGG - Intergenic
1034394107 7:150807119-150807141 ATACAAAAGACTAAGGAGGCTGG + Intergenic
1034915927 7:155038986-155039008 ATTAACAAGAAAAATGATGCAGG - Intergenic
1036197186 8:6729595-6729617 ATTCAGGAGACAAATGATACAGG - Intronic
1036680005 8:10865058-10865080 ATTCAGAAGGCAAGTAAGGTGGG - Intergenic
1037105675 8:15104280-15104302 ATACAGGAGACAATTGAGGGTGG + Intronic
1038040999 8:23724167-23724189 ATTCAGAAGACTGAGGAGGGAGG - Intergenic
1039571035 8:38586408-38586430 TTTCAGCAGAAAAAGGAGGCTGG + Intergenic
1039618390 8:38974829-38974851 ATCCAGGAGGCAAATGACGCAGG - Intronic
1039775053 8:40727356-40727378 ATGCAGAAGCCAACTGAGGTGGG - Intronic
1039935194 8:42036982-42037004 AGTCAGAAGACAGAAGAAGCAGG - Intronic
1039968756 8:42303801-42303823 ATGCAGAAGAAAAATGGGGCTGG - Intronic
1040604498 8:48917556-48917578 ATTCAGAAGAGACATGACGGTGG - Intergenic
1042607184 8:70557362-70557384 ATTCAAAAGAGATGTGAGGCTGG - Intergenic
1042864002 8:73340861-73340883 ACTCAGAACACAAATCATGCTGG - Intergenic
1043392648 8:79806722-79806744 ATTAAGGACACAAATGTGGCTGG + Intergenic
1043774335 8:84246015-84246037 ATTCAGAAGCCAAAGGAAGATGG + Intronic
1044261217 8:90124763-90124785 ATTCAGACTACAGATGAAGCAGG - Intergenic
1044362538 8:91305022-91305044 ATTCAGAAGCCCTATGAGGTAGG - Intronic
1044488705 8:92786257-92786279 ATTCACCAGAAAAAAGAGGCTGG - Intergenic
1044505248 8:93009311-93009333 ATCAAAAAGACAAAAGAGGCCGG + Intronic
1044662688 8:94606799-94606821 ATTAAAAAGAAAAAAGAGGCCGG + Intergenic
1044939296 8:97324317-97324339 ATTTAGAAGAAAAATGATGGTGG - Intergenic
1045028354 8:98111309-98111331 ATTTAGAAGTGAAATGTGGCAGG + Intronic
1045323609 8:101100622-101100644 ATTACGAAGACAAGTCAGGCCGG - Intergenic
1045398474 8:101785781-101785803 GTTCAGAAGACAAATGAGACTGG - Intronic
1045684519 8:104698623-104698645 ATTTAAAAGAAAGATGAGGCGGG + Intronic
1045873543 8:106952429-106952451 ATGCAGAAGAGAAAAGAGCCTGG + Intergenic
1048073524 8:131043497-131043519 ATTCAGCAGCAAAAGGAGGCGGG + Intergenic
1048127381 8:131651164-131651186 ATTCATATGAAAAATGAGGATGG + Intergenic
1048607532 8:135985080-135985102 TTCCAGCACACAAATGAGGCAGG - Intergenic
1049545320 8:143228171-143228193 ATTTAAACGACAAAGGAGGCCGG - Intergenic
1049868010 8:144951323-144951345 ATAAAGAATACAAATAAGGCTGG + Intergenic
1049903709 9:195854-195876 ATTCAAAAGAGAAAAGAGGCCGG - Intergenic
1050001136 9:1077874-1077896 ATTCACAAGTCAAAAGAGACAGG - Intergenic
1050075232 9:1856059-1856081 ACTCACAAGTCAAAAGAGGCTGG + Intergenic
1050443776 9:5695865-5695887 ATTAAGAAGACATAATAGGCCGG - Intronic
1050745676 9:8873308-8873330 ACTCAGAAGAAAAATTAAGCAGG - Intronic
1051324951 9:15955982-15956004 ATTTAGATGAAAAATGTGGCTGG + Intronic
1051564744 9:18484854-18484876 TTTCAGAAAAAAAATAAGGCTGG + Intronic
1051919490 9:22248197-22248219 AGTCAGAAAACAACAGAGGCTGG - Intergenic
1053636994 9:40019018-40019040 ATGCAGGAGACAAAGAAGGCAGG - Intergenic
1053746715 9:41206158-41206180 ATTCAAAAGAGAAAAGAGGCCGG - Intergenic
1054681630 9:68225124-68225146 ATTCAAAAGAGAAAAGAGGCCGG + Intergenic
1054817144 9:69486246-69486268 AGTCAGAATTAAAATGAGGCCGG - Intronic
1055001314 9:71452242-71452264 AATCAAAGGACAAATGAGGAGGG + Intergenic
1055023621 9:71695817-71695839 AGTCAGAACAAAAATTAGGCCGG + Intronic
1055174046 9:73296092-73296114 ATTCAGAAGACAATAGAGTCAGG - Intergenic
1055719746 9:79158771-79158793 CTTTAGAATACAAAAGAGGCTGG + Intergenic
1056305191 9:85283468-85283490 ATTCTGAAGCCAAATGAGGGCGG + Intergenic
1056395102 9:86174744-86174766 ATGAACAAGACAAATGAGGTGGG - Intergenic
1056739976 9:89246082-89246104 CATAAGAAGGCAAATGAGGCTGG + Intergenic
1057635942 9:96767029-96767051 AATCAAAAGAGAAATGAGGCTGG + Intronic
1058574123 9:106381819-106381841 TTTCTGGAGACAAATCAGGCTGG + Intergenic
1059622531 9:116023336-116023358 ATCCAGAAGACAGAAGATGCTGG + Intergenic
1060259837 9:122064760-122064782 AGTAAGAAGACAAAGGAGGAGGG + Intronic
1060723181 9:125991587-125991609 ATTCAATAGACAAATCTGGCTGG - Intergenic
1060926456 9:127458831-127458853 TTTGAGAAGGAAAATGAGGCGGG + Intronic
1060939567 9:127535719-127535741 ATTCAGGAGCCAAATGGGTCAGG + Intronic
1061563013 9:131418562-131418584 AAGAAGAAGACAAATCAGGCTGG - Intronic
1062642023 9:137523785-137523807 ATTCAAAAAACAAATTAGCCGGG - Intronic
1062676205 9:137745983-137746005 ATCCAGAAGAAAAATGAGCAGGG - Intronic
1202782845 9_KI270718v1_random:16937-16959 ATTCAAAAGAGAAAAGAGGCCGG - Intergenic
1186775958 X:12864822-12864844 AATAAAAAGACAAATGAGGTTGG + Intergenic
1186952828 X:14646405-14646427 AATCAAACAACAAATGAGGCAGG + Intronic
1188628498 X:32318947-32318969 AGTCAGAATCCACATGAGGCAGG - Intronic
1188628640 X:32321809-32321831 TTTCAGAAGACACAAGGGGCTGG + Intronic
1188840319 X:35009216-35009238 ATGCAGAGGACATATGATGCAGG + Intergenic
1189872857 X:45402792-45402814 AGTCAGAAAACAACAGAGGCTGG - Intergenic
1190523354 X:51302797-51302819 ATTAAGAAGAAAATTGAGTCAGG + Intergenic
1190618607 X:52263306-52263328 ATTAAGAAGAAAAACAAGGCAGG - Intergenic
1190625999 X:52339276-52339298 ATTAAGAAGAAAAACAAGGCAGG + Intergenic
1190936821 X:55005223-55005245 ATGCATAAGAGGAATGAGGCAGG - Intronic
1192707154 X:73538524-73538546 ATCAAAAAGACAAAAGAGGCTGG + Intergenic
1193524684 X:82574757-82574779 ATTCACAAGAAAAAAAAGGCAGG - Intergenic
1195038826 X:100994930-100994952 ATTCAAAACACAACTGGGGCTGG - Intergenic
1195965132 X:110423029-110423051 ATAAAGAAGACAGAGGAGGCCGG + Intronic
1196418569 X:115499476-115499498 TTTCAGAAGCCAAAAGAGGGAGG + Intergenic
1196703177 X:118693503-118693525 ATTAAGAAAACAAATCAGGCCGG - Intergenic
1196707617 X:118729167-118729189 AATCAGGAGACTAATGAGACGGG - Intronic
1197658014 X:129138256-129138278 ATTAAAAAGACACATCAGGCTGG - Intergenic
1198670073 X:139070466-139070488 ATTCAGGAAACAACAGAGGCTGG + Intronic
1199783277 X:151082489-151082511 GCTCAGAATACAAATGCGGCGGG + Intergenic
1200139479 X:153891937-153891959 ATTTAAAAAAGAAATGAGGCCGG - Intronic
1200755419 Y:6985862-6985884 GCTCAGAAGAGAAATGATGCTGG - Intronic
1201602057 Y:15741958-15741980 ATTAAAAAGAAAAAAGAGGCTGG + Intergenic
1201854107 Y:18521678-18521700 AGTCAGGAGACACATGAGTCAGG - Intergenic
1201879214 Y:18798706-18798728 AGTCAGGAGACACATGAGTCAGG + Intronic