ID: 1178779348

View in Genome Browser
Species Human (GRCh38)
Location 21:35586837-35586859
Sequence TCCCTGGAGTATCTGAAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 153}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178779348_1178779350 7 Left 1178779348 21:35586837-35586859 CCTGACTTCAGATACTCCAGGGA 0: 1
1: 0
2: 0
3: 11
4: 153
Right 1178779350 21:35586867-35586889 CATTTCTTAAAATTGTTTTTCGG 0: 1
1: 2
2: 9
3: 128
4: 1261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178779348 Original CRISPR TCCCTGGAGTATCTGAAGTC AGG (reversed) Intronic
901183157 1:7355667-7355689 CCACTGGAGCATCTGAAGACAGG - Intronic
902549207 1:17209355-17209377 TCCCTGGAGAATATGAAGCTGGG + Intronic
903436352 1:23352733-23352755 TCCCTGCAGAATCTGAATTGTGG - Intergenic
906535238 1:46547755-46547777 ACCCTGGAGAAGCTGAAGCCGGG - Exonic
910035119 1:82779400-82779422 TCCCTGGGTTATCTGAAAACTGG - Intergenic
915271638 1:154757829-154757851 TCCCTTGAGTATCCAAAGTCAGG - Intronic
915410626 1:155699002-155699024 TCCGTAGGGTACCTGAAGTCCGG + Intronic
918184827 1:182117597-182117619 TCCCTGAAGTATCTAAACTCAGG - Intergenic
918454335 1:184692416-184692438 TACCTGGAATATCTGAATGCAGG + Exonic
921313324 1:213867272-213867294 GCCCTGGAGTAACTTAGGTCTGG - Intergenic
1063372914 10:5533374-5533396 TTCCTAGAGGATCTGATGTCAGG - Intergenic
1063400639 10:5741498-5741520 TCGCTGGAGTACCATAAGTCAGG - Intronic
1063522125 10:6750650-6750672 ACCCTAGAGAACCTGAAGTCAGG + Intergenic
1063600848 10:7480086-7480108 TCCCTGGAGAGTCTGAATTGTGG + Intergenic
1066048422 10:31614296-31614318 TGGCTGGAGGAGCTGAAGTCCGG - Intergenic
1070718696 10:78741363-78741385 TCCCTTGAGGATCTAGAGTCAGG + Intergenic
1070804160 10:79261048-79261070 CCCCTGGAGAATCTGAAGACAGG - Intronic
1073628763 10:105126638-105126660 TGCCTGCAGTATCTGGAATCTGG + Intronic
1078443643 11:11387757-11387779 TCCATGGAGAATCTGGAGTGGGG + Intronic
1078486470 11:11727515-11727537 ACCCAGGGGTATATGAAGTCAGG - Intergenic
1080427867 11:32172911-32172933 TCCCTGGCCTGTTTGAAGTCAGG + Intergenic
1081829664 11:46097397-46097419 TGCCTGGAGGGTCTGAAGTACGG - Intronic
1082959090 11:58901990-58902012 TCCTTGGAGCCTCTGGAGTCTGG + Intronic
1082979037 11:59103369-59103391 TCCTTGGAGCCTCTGGAGTCTGG + Intergenic
1083251804 11:61472981-61473003 TCCCAGGCGAATCTGAAGGCAGG - Intronic
1083638343 11:64132309-64132331 TTCCTGGAATATCTGAAAACAGG - Intronic
1084972724 11:72780609-72780631 CACCTGGAGTAACTCAAGTCAGG + Intronic
1085643355 11:78207337-78207359 AGCCTGGGGTATCTGAGGTCAGG - Intronic
1089071599 11:115704202-115704224 TTCCTGGAGCATCTGCAGCCTGG + Intergenic
1091726281 12:2848702-2848724 TCCCTGGACCATTTGATGTCTGG - Intronic
1092565323 12:9659257-9659279 TCCCTGGAGCATCCCTAGTCAGG - Intergenic
1093661680 12:21764648-21764670 TCCCAGTAGTATCTGAATTTAGG - Intergenic
1096043436 12:48540901-48540923 TCACTGGAGCATCTGAATTTTGG + Intergenic
1099483308 12:83195876-83195898 TGCGTGGATTATCTGAGGTCAGG - Intergenic
1099772695 12:87082463-87082485 TCCTTGCAGAAACTGAAGTCTGG + Intergenic
1100279468 12:93104546-93104568 TCCCTAGTGAATCTGAAGTCAGG - Intergenic
1100756758 12:97759696-97759718 TTCTTGGACTGTCTGAAGTCAGG + Intergenic
1102873808 12:116434410-116434432 TTCCCGGAGTCTCTGAAGGCGGG + Intergenic
1102972774 12:117183485-117183507 TCCTTGGATCATCTGAGGTCAGG - Intronic
1104378786 12:128288724-128288746 CCACTGTAGTCTCTGAAGTCTGG + Intronic
1105244511 13:18636668-18636690 GCCTTGTAGTATTTGAAGTCAGG - Intergenic
1108150120 13:47524772-47524794 TCCCTGGAGGTTCTGAAGGGAGG + Intergenic
1111904847 13:94243102-94243124 TCCCTGGAAGAGATGAAGTCAGG - Intronic
1113060155 13:106314117-106314139 TCCCTGGAGGGGCTGAAGACTGG + Intergenic
1117934220 14:60883479-60883501 GCTCTGTAGTATTTGAAGTCAGG + Intronic
1120780921 14:88484659-88484681 TACCTGGATCATCTGAGGTCAGG + Intronic
1121590728 14:95105926-95105948 CCCGTGGACTATCTGAAATCAGG - Intronic
1125746522 15:42000918-42000940 ACCTTGGAGTATCTCAGGTCTGG - Intronic
1126261678 15:46700455-46700477 ACCCTGGAATTTCTGAAGACAGG + Intergenic
1128100032 15:64990913-64990935 TCCGTGGAGTATTTTAAGTTGGG + Intergenic
1128724188 15:69975618-69975640 TTCCAGGAGTCTCTGAAGGCTGG - Intergenic
1130097144 15:80864187-80864209 TGCCTGGATTATGTGAAGTGTGG - Intronic
1130403215 15:83576394-83576416 TTCCTGGAGCACCTGAAGTGAGG + Intronic
1131441623 15:92463985-92464007 TCCCTGGAGTGGCAGAAGGCAGG + Intronic
1131648923 15:94377782-94377804 TTCCTGCGGTATCTGCAGTCAGG - Intronic
1132227299 15:100152209-100152231 TCCATGCAGTGTTTGAAGTCAGG + Intronic
1136480646 16:30539524-30539546 TCCCCGGAGTACCTGAGGCCTGG + Intronic
1137979142 16:53055103-53055125 TCCCTGGAGCCTCTGAGGTCGGG + Intronic
1139450748 16:67026770-67026792 TGACTGAATTATCTGAAGTCCGG - Intergenic
1139589737 16:67927002-67927024 TCCCAGGAGTATCATAACTCAGG - Intronic
1140884912 16:79234693-79234715 TTCCTGGATGATCTAAAGTCAGG - Intergenic
1143901346 17:10176970-10176992 TGCTTGGTGTCTCTGAAGTCTGG - Intronic
1145002132 17:19312864-19312886 GCCCTGAGGTCTCTGAAGTCTGG + Intronic
1148470776 17:47891962-47891984 TCCCTGGTGTGTCTGGAGGCAGG - Intergenic
1150247913 17:63689870-63689892 GCCTTGGAGTGTCTGAAGCCTGG + Intronic
1154444423 18:14423230-14423252 GCCTTGTAGTATTTGAAGTCAGG + Intergenic
1156770360 18:40713710-40713732 TCCCCTGAATATCTGAATTCAGG - Intergenic
1158314616 18:56197428-56197450 TCACTGTAGTATGTGAATTCGGG - Intergenic
1158842367 18:61401570-61401592 TTACTGTAGAATCTGAAGTCAGG - Intronic
1163080027 19:14932375-14932397 GCCCTGGAGCATCTGAGGTGGGG + Intergenic
1164138259 19:22433778-22433800 TGGCTGGATTACCTGAAGTCAGG - Intronic
931213595 2:60221012-60221034 TACCTGAAGGATCTCAAGTCTGG + Intergenic
931542056 2:63340289-63340311 TCCCAGCAGTATGTGAAGGCTGG + Intronic
933501876 2:83123166-83123188 TCCCTGACATATCTGAAGTGTGG + Intergenic
934572910 2:95383548-95383570 TCCCTGGAGAACCTCAAGTTAGG + Intronic
936804559 2:116313305-116313327 TCCTTTAAATATCTGAAGTCAGG - Intergenic
938758496 2:134402038-134402060 TGCCTGGAGTGTCTGAAAACAGG + Intronic
939738429 2:145878590-145878612 TCCAAGAAGCATCTGAAGTCAGG - Intergenic
944141957 2:196466390-196466412 TCCCTGGATTATCTAAACCCAGG - Intronic
944928605 2:204492151-204492173 TCCCTGTGGTCTCTAAAGTCGGG - Intergenic
946806937 2:223480156-223480178 TCCCTGGAGAATCTGACATATGG - Intergenic
947032881 2:225818047-225818069 TCTCTGGAGTTTGGGAAGTCCGG - Intergenic
947526488 2:230879638-230879660 TTCCTGGAGGATCTGAAGTGAGG + Intergenic
1169964073 20:11195917-11195939 TCACTGGAGTTTCTGGAGTTTGG + Intergenic
1170732286 20:18985631-18985653 TCCCTGGAGTATCTGACCTGAGG + Intergenic
1171383977 20:24754839-24754861 TGCCTGGAGTATCCTAGGTCAGG + Intergenic
1174528178 20:51190207-51190229 TCGCTGGAGAAACTGAAGTCTGG - Intergenic
1174875322 20:54221347-54221369 TCCCTGGGCTAGCTGAAGACTGG + Intronic
1175310561 20:58008827-58008849 TCCCTGTTGTATCTGAACCCAGG + Intergenic
1175436726 20:58957525-58957547 TGCATGGATTATCTGAGGTCAGG + Intergenic
1177814450 21:25960644-25960666 TCCCTGGAGGAGCTGAGGCCTGG - Intronic
1178779348 21:35586837-35586859 TCCCTGGAGTATCTGAAGTCAGG - Intronic
1180171525 21:46061302-46061324 TCCCTGGAGCACCTGAGTTCAGG - Intergenic
954124801 3:48521911-48521933 GCCCTGGAGGATGTGCAGTCTGG + Intronic
955456739 3:59129915-59129937 CCCCTGGGGCATCTGAACTCTGG - Intergenic
956153738 3:66271609-66271631 TCACTGTAGTAGATGAAGTCAGG + Intronic
959300757 3:104597779-104597801 TTCCTGGTGTATGTGAAGTTGGG + Intergenic
960257461 3:115526219-115526241 TCCCTGGAAAATCTGAGATCAGG - Intergenic
961468286 3:127094934-127094956 TGACTGGATTATTTGAAGTCAGG - Intergenic
961502452 3:127346471-127346493 TCCCCTGAGTATCTGAGGCCTGG - Intergenic
962485018 3:135833923-135833945 TCCTTAAAGTAGCTGAAGTCGGG + Intergenic
962704977 3:138034278-138034300 TAACTGGGGTATCTGAGGTCAGG + Intergenic
962715986 3:138126596-138126618 TGGGTGGATTATCTGAAGTCAGG + Intronic
964247342 3:154668692-154668714 TCCCAGGAGTTTCTAAACTCAGG + Intergenic
964627957 3:158776978-158777000 TCTCTGGAGCTTCTGAGGTCTGG + Intronic
964699629 3:159551205-159551227 TCCCATCAGTATCTGAATTCAGG + Intronic
965033689 3:163406546-163406568 TCCCTGAACTGTCTGCAGTCTGG - Intergenic
965354290 3:167654978-167655000 TACATGCAGTATCTGAAGTTTGG - Intergenic
966934700 3:184698290-184698312 TCCTTGGAGTATCTTAATGCTGG + Intergenic
968554810 4:1241568-1241590 TCCCTGGAGTCTGTGAGTTCTGG - Intronic
969894694 4:10292567-10292589 TCTCTGAAGCATCTGAAATCTGG + Intergenic
970674750 4:18436221-18436243 TCCCTGGTGTAGCTGTAGCCAGG + Intergenic
970800527 4:19967373-19967395 TGGGTGGATTATCTGAAGTCAGG + Intergenic
972010348 4:34172042-34172064 TCACTGGGGTATGTGAAGTTGGG + Intergenic
974524787 4:63035737-63035759 TCCTTGGAGTGTCTGCACTCTGG + Intergenic
976606730 4:86990520-86990542 TCCCTGGAGTACCCCAAGTGTGG + Intronic
978200612 4:106020219-106020241 TCCCTGGAGTTTATGAAATCTGG - Intergenic
982572383 4:157066523-157066545 GCCCTGGAGTATGAGAAGTTTGG + Intergenic
984379291 4:178970063-178970085 TACCTGGAGTATATTAACTCTGG - Intergenic
985634910 5:1031141-1031163 TCCCTGGGGTTCCTGGAGTCTGG - Intronic
989774034 5:45181308-45181330 GCCCTGAAGTATGTGAAGTGGGG - Intergenic
992796977 5:80262125-80262147 TGCGTGGATCATCTGAAGTCAGG + Intergenic
995345512 5:111111649-111111671 TCCCTGGAATATCTGGTATCTGG + Intronic
995453811 5:112331479-112331501 TCCCTGGGGTATCAGAGGGCTGG + Intronic
997934433 5:138098070-138098092 TCCCTGGGATATCTGAAGACAGG - Intergenic
999082030 5:148853666-148853688 TCACTGGTATATGTGAAGTCAGG - Intergenic
999977844 5:156929604-156929626 TCCCTGGAGTACCAGAAGCTAGG + Intronic
1011625413 6:89279300-89279322 TCCATGGAGTCCCTGAAGACCGG + Intronic
1013410075 6:109876223-109876245 TCCCTGGAGTAACTCCAGCCAGG + Intergenic
1014526209 6:122504869-122504891 TCCGTAGGGTATCCGAAGTCCGG + Intronic
1019462077 7:1165374-1165396 ACCCTGGAATATCTGAGGCCAGG - Intergenic
1021526918 7:21598250-21598272 TCCCTTGGGTATCTGCCGTCTGG + Intronic
1023564751 7:41513029-41513051 TGGCTGGATTATCTGAGGTCGGG + Intergenic
1032610853 7:133411738-133411760 TCTCTGGAGTATTTGATGTTGGG - Intronic
1032862981 7:135899134-135899156 TCCCTGGAGGAATTGAAATCAGG + Intergenic
1034557196 7:151857811-151857833 TCGCTGGAGCATCAGAAGGCGGG + Intronic
1034691300 7:153016140-153016162 TCCCTGAAGTCCCTGAAGCCAGG - Intergenic
1034691533 7:153018038-153018060 TCCCTGAAGTCCCTGAAGCCAGG - Intergenic
1035226989 7:157439148-157439170 TCCCTGGAGAAGCCGAAGGCAGG - Intergenic
1038499428 8:28031130-28031152 TCCCTGGAGTATCCAGGGTCTGG - Intronic
1039057908 8:33551190-33551212 CCCCTTCAGTGTCTGAAGTCCGG - Intronic
1039242236 8:35569551-35569573 TCCCTGGCCTATCAGAACTCAGG - Intronic
1043371549 8:79599691-79599713 TCCCTTCAGTATCAGAAGTGTGG - Intergenic
1045214730 8:100136562-100136584 TCCCTTGAGGATTTGAATTCTGG - Intronic
1049400524 8:142424730-142424752 TGCCCGGAGTATCTGAAGAAGGG + Intergenic
1049782601 8:144435720-144435742 TCCCTGGAGGTTCTGAAGCCAGG + Exonic
1053024992 9:34722087-34722109 TCTCTGTATTATCTGAAGCCAGG + Intergenic
1053259348 9:36648376-36648398 TACCAGGAGCCTCTGAAGTCAGG + Intronic
1054897006 9:70325088-70325110 TCCCTGGAGTTTGGGAAGTTGGG + Intronic
1055972064 9:81921395-81921417 ACCCTGCAGTGTCTGAAGTTTGG + Intergenic
1055973817 9:81936467-81936489 ACCCTGCAGTGTCTGAAGTTTGG + Intergenic
1056506958 9:87266556-87266578 TCCCTGGTGTATCTGAAACATGG - Intergenic
1058325522 9:103692365-103692387 TCCCTAGAGTTTCTGATTTCAGG - Intergenic
1061057685 9:128233033-128233055 TTTCTGGAGGAGCTGAAGTCCGG + Intronic
1061706155 9:132454961-132454983 TCCCAGGATTACCTGAAGTGAGG + Intronic
1062136757 9:134933194-134933216 AGCCTGGACTATCTGGAGTCAGG - Intergenic
1189208502 X:39262795-39262817 TCCCTGGAGGATGGGAAGGCTGG + Intergenic
1191197539 X:57740961-57740983 TTCTTGGTGTGTCTGAAGTCTGG + Intergenic
1194895603 X:99435722-99435744 TTCCTGGAGTACCTGATGGCAGG - Intergenic
1195246914 X:103003266-103003288 TTCCTTGAGTTTCTGAAGGCTGG - Intergenic
1196196991 X:112847053-112847075 TCCCTGGAGTTCCTAAAGTGGGG - Intergenic
1197260624 X:124313270-124313292 TCCCAGCAGTATGGGAAGTCTGG - Intronic
1198887345 X:141354029-141354051 TTCCTGGATTAGCTGGAGTCTGG + Intergenic
1200071165 X:153530182-153530204 GCCCTGGAGCCTCTGAAGGCAGG + Intronic
1200597410 Y:5161613-5161635 TCCCTTTAATATCTGAAGACTGG + Intronic