ID: 1178780206

View in Genome Browser
Species Human (GRCh38)
Location 21:35595650-35595672
Sequence CCTTATATGAAGATAAAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 351}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178780202_1178780206 -6 Left 1178780202 21:35595633-35595655 CCAGTCTAGGCCCTAAACCTTAT 0: 1
1: 0
2: 2
3: 2
4: 61
Right 1178780206 21:35595650-35595672 CCTTATATGAAGATAAAGAAAGG 0: 1
1: 0
2: 0
3: 27
4: 351
1178780200_1178780206 17 Left 1178780200 21:35595610-35595632 CCTAAAACAAACAAACAAAAAAA 0: 154
1: 865
2: 1266
3: 16335
4: 28710
Right 1178780206 21:35595650-35595672 CCTTATATGAAGATAAAGAAAGG 0: 1
1: 0
2: 0
3: 27
4: 351

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178780206 Original CRISPR CCTTATATGAAGATAAAGAA AGG Intronic
901165627 1:7219733-7219755 CCTTATAAGAAGAGGAAGAGGGG + Intronic
901571115 1:10161458-10161480 CCTTATCTGAAGCTAAGAAATGG + Intronic
906722134 1:48015922-48015944 TCTCATATGAAGCTAGAGAAGGG + Intergenic
908878142 1:68700935-68700957 CCTTATAAGAAGAGAAAGTTTGG - Intergenic
908961979 1:69708960-69708982 CCTTCTATGAAAATAAGGGAGGG + Intronic
909159873 1:72133400-72133422 TCTTTTATGAAGGTAAGGAAAGG + Intronic
909497989 1:76300984-76301006 CCTGATATGTGGATAAAAAAAGG + Intronic
911035198 1:93536310-93536332 GCTAATATGGAAATAAAGAAAGG - Exonic
911166048 1:94725428-94725450 GCTAATAAAAAGATAAAGAAGGG + Intergenic
911204984 1:95083277-95083299 CTTTATATGAAGAAAAAGCATGG + Intergenic
911861971 1:102963094-102963116 CCTCATATGAAAAGAAGGAATGG - Intronic
912044282 1:105435078-105435100 CCTAATATCAAGGTACAGAAGGG - Intergenic
913441204 1:118899698-118899720 ACCTACCTGAAGATAAAGAAAGG + Intronic
916496354 1:165351917-165351939 CATTACATGAAGATAATCAAAGG - Intronic
916653045 1:166848694-166848716 CCTTCTTTGCAGATGAAGAAGGG - Intronic
919213052 1:194512918-194512940 CATTATATGATATTAAAGAATGG + Intergenic
919241339 1:194920706-194920728 CTTGATATGAGAATAAAGAAAGG + Intergenic
921611017 1:217212613-217212635 CCTTATATTAGGAGAATGAAAGG - Intergenic
923048399 1:230372361-230372383 TTTTGTATGAAGATCAAGAACGG - Intronic
924271326 1:242335840-242335862 TCTAATATGATGAAAAAGAAAGG + Intronic
924390349 1:243548765-243548787 CCGCATAGGAAGATAAAGGAGGG + Intronic
924829745 1:247580603-247580625 CCTTATTTGAAGATTCAGTATGG + Intergenic
924830589 1:247590204-247590226 CCTTATTTCCAGAAAAAGAATGG - Intergenic
1065162998 10:22942978-22943000 CCTTATATGAAGTTCAAAAATGG + Intronic
1065315474 10:24459612-24459634 TCTTATTTACAGATAAAGAAAGG + Intronic
1065396345 10:25242598-25242620 CATTATCTGAAGAGAGAGAATGG - Intronic
1067494486 10:46749568-46749590 CCGTATTTGAAGGTAACGAAAGG + Intergenic
1067600172 10:47590829-47590851 CCGTATTTGAAGGTAACGAAAGG - Intergenic
1068450190 10:57176417-57176439 CATTATAAGAACATACAGAATGG - Intergenic
1069366155 10:67695999-67696021 CTTTATAGGAAGAAACAGAAAGG - Exonic
1070405887 10:76094224-76094246 ACTTATATAATGAGAAAGAAAGG - Intronic
1071070832 10:81691644-81691666 CATTATATTATAATAAAGAAAGG + Intergenic
1071651711 10:87398708-87398730 CCGTATTTGAAGGTAACGAAAGG - Intergenic
1072723236 10:97793746-97793768 CTTTATATGAAATAAAAGAAAGG - Intergenic
1073740914 10:106405959-106405981 TTTCAGATGAAGATAAAGAATGG + Intergenic
1073817070 10:107219284-107219306 CATTATATAAAAATGAAGAAAGG + Intergenic
1074935539 10:118176297-118176319 ACTTATATTAGAATAAAGAAAGG + Intergenic
1075134717 10:119773571-119773593 TCATAAATGATGATAAAGAAGGG - Intronic
1075977386 10:126707538-126707560 AATTATATTAAGATAAAGACCGG + Intergenic
1076032669 10:127172765-127172787 CCTTAAATCAAGACAAAGGATGG - Intronic
1076114774 10:127887815-127887837 CCTAAAAGGAAGAAAAAGAACGG - Intronic
1078407403 11:11082406-11082428 CCTTATCAGAAGATACACAACGG + Intergenic
1078437257 11:11335711-11335733 CTTTATAAGAGGAAAAAGAATGG + Intronic
1079405313 11:20140172-20140194 CTTTTTTTGAAGATAAAGAAGGG - Intergenic
1079461185 11:20679369-20679391 CCTTTTATGATGATAACAAAAGG + Intronic
1080151052 11:29052371-29052393 CCTCATATGAAGAGGAAAAATGG + Intergenic
1080549930 11:33364235-33364257 AATTACATGAATATAAAGAATGG + Intergenic
1080931452 11:36815746-36815768 CCTTATAAGAAGACAGAGAAGGG + Intergenic
1085473917 11:76776886-76776908 TCTTAGAAGAAGAGAAAGAAAGG - Intergenic
1086284901 11:85236463-85236485 CCTTATAAGAAGATACACCAGGG - Intronic
1086355597 11:85995203-85995225 CCTTATATGAAAGTTAAGACAGG + Intronic
1087235045 11:95708746-95708768 CATTTTAGGAAGATAAAGCAGGG - Intergenic
1087942700 11:104118274-104118296 CCTTATAAGAAGAGACACAAGGG + Intronic
1090551380 11:127823913-127823935 CCATATATGAAGTTAAGGATCGG - Intergenic
1090693128 11:129206619-129206641 CCATATATGATAATAAAAAATGG - Intronic
1091347015 11:134861960-134861982 CCTTGTAGGAAAATAAAAAACGG + Intergenic
1093102407 12:15043395-15043417 CATTATATGAAGAAAAAATAAGG - Intergenic
1093239076 12:16646809-16646831 CTGTGTATGAAGAGAAAGAAAGG + Intergenic
1093540653 12:20280276-20280298 CCTTATATGAAGAGAAAATTTGG - Intergenic
1094044149 12:26148463-26148485 GCTTGTGTGATGATAAAGAACGG + Intronic
1094658652 12:32444769-32444791 CCTGAGGTGAAGATAAAGGATGG + Intronic
1095283035 12:40379081-40379103 CCTTATAAGAAGAGAAAGTCTGG - Intergenic
1097238857 12:57559766-57559788 CTTCATATGAAGTTCAAGAATGG - Intronic
1097933257 12:65214339-65214361 TCTTATGTGAAGATAAGGACTGG + Intronic
1098111917 12:67131889-67131911 TCATATATGAAAATATAGAATGG - Intergenic
1098127402 12:67313544-67313566 CATTATCTGGAGAGAAAGAAAGG + Exonic
1098128533 12:67323876-67323898 ACTTGTATGCAGATGAAGAAGGG - Intergenic
1098398275 12:70045490-70045512 CCTAAGATCAAAATAAAGAAGGG + Intergenic
1099731306 12:86507364-86507386 CCTTACATGAAGCCAAATAAAGG - Intronic
1100606310 12:96154681-96154703 CCTTATAAGAAGAAAGAGAGAGG + Intergenic
1100915819 12:99420836-99420858 ATTGATATGAAGATGAAGAAAGG - Intronic
1101003126 12:100376035-100376057 CCTTATATGAAGAAAAAATTGGG + Intronic
1101122745 12:101599985-101600007 CCTGTTAGGAAGATAAATAAAGG + Intronic
1101151400 12:101885837-101885859 CCTTACATATAGATTAAGAATGG - Intronic
1102678182 12:114672562-114672584 CCTTATAGGAAGAAAAAACAGGG + Intronic
1102812762 12:115838622-115838644 CCTTAAAAGAAGACAGAGAAAGG + Intergenic
1103234801 12:119362482-119362504 CATTACATGAAGATCAAGAATGG - Intronic
1104381732 12:128313368-128313390 CCTTGAATGAAGATAGAGACTGG - Intronic
1105567300 13:21563086-21563108 CCTTATCTGTAGAAAAACAATGG - Intronic
1106764161 13:32897287-32897309 CCTTATAGGAAGATAAAACAGGG + Intergenic
1107523835 13:41210701-41210723 GGTTATATAATGATAAAGAAAGG - Intergenic
1107790586 13:43998334-43998356 CCTTATTTGAAGAGATAAAAAGG - Intergenic
1108426216 13:50304022-50304044 GTTTATATGAACACAAAGAAAGG - Intronic
1109712165 13:66176128-66176150 CTTTATATGTATATAAAGGAGGG + Intergenic
1109738166 13:66514401-66514423 CCTTTTATGTAGACAGAGAATGG + Intronic
1109843210 13:67948539-67948561 CCATATGTTCAGATAAAGAAAGG - Intergenic
1110420186 13:75298839-75298861 TCTTACATGAAGATAAAGGAGGG + Intronic
1111279546 13:86002856-86002878 CTTGCTTTGAAGATAAAGAAAGG - Intergenic
1111495391 13:89042339-89042361 CCATATATGAAGATAAGAGAAGG - Intergenic
1111989962 13:95106700-95106722 TTTTATATTAAGATAAAGGAGGG + Intronic
1112687351 13:101845671-101845693 GCTTATAAGCAAATAAAGAATGG + Intronic
1112809465 13:103200799-103200821 CCTTTGCTGAAGTTAAAGAATGG + Intergenic
1114449812 14:22818103-22818125 CCTAATATGACGTAAAAGAAAGG + Intronic
1115172451 14:30524789-30524811 CCTCACAGGAAGATAAAGATGGG + Intergenic
1116072627 14:40068150-40068172 CCTGCTTTGAAGATAGAGAAAGG - Intergenic
1116402253 14:44522234-44522256 CCTTATAAGAAGAAAAATATTGG + Intergenic
1117089234 14:52233514-52233536 CTTAATATGAATGTAAAGAAGGG + Intergenic
1119533590 14:75381404-75381426 CCTTATAACAAGAAAAAAAACGG + Intergenic
1119777358 14:77257396-77257418 CCTTGTAAGAATAGAAAGAAGGG - Exonic
1122250356 14:100434846-100434868 CTTTTTATGAAGAAAAAGAGCGG - Intronic
1122512356 14:102279831-102279853 GTTAATATGAAGTTAAAGAAAGG - Intronic
1123632786 15:22273537-22273559 CCTTAAATGAAAAGAAAAAAAGG - Intergenic
1123671372 15:22662503-22662525 ATTTATATGAAGACAAAGATAGG - Intergenic
1123672545 15:22674025-22674047 CCTTATTAGAAGAGAAAGACAGG - Intergenic
1124323410 15:28735730-28735752 ATTTATATGAAGACAAAGATAGG - Intronic
1124324595 15:28747314-28747336 CCTTATTAGAAGAGAAAGACAGG - Intergenic
1124527297 15:30468897-30468919 ATTTATATGAAGACAAAGATAGG - Intergenic
1124722740 15:32124822-32124844 CCTTATAAGAAGAGACACAAGGG + Intronic
1124771356 15:32538786-32538808 ATTTATATGAAGACAAAGATAGG + Intergenic
1124992462 15:34689438-34689460 CCTTATATGAAGAAAAAATTTGG + Intergenic
1125648688 15:41295148-41295170 CCTAATATTAAGATATAGATTGG + Intergenic
1126729455 15:51667565-51667587 GTTTATATGAAGTTCAAGAATGG - Intergenic
1127394293 15:58531257-58531279 CCTTAAAAGAAGATACACAAAGG - Intronic
1127907467 15:63386733-63386755 CTTTATATGGAGCTAAAGAAAGG + Intergenic
1128923158 15:71630544-71630566 CCTTCTCTGAAGACAGAGAAAGG + Intronic
1131357012 15:91754143-91754165 CCTGAAAAGAAGATGAAGAAGGG + Intergenic
1132511772 16:346285-346307 CCTTAAATGAAGATGAGGAATGG - Exonic
1133843581 16:9433179-9433201 CATTATATAATGATAAAGGAAGG - Intergenic
1135103020 16:19623383-19623405 CCTTATAGGAAGAGACAGCAAGG - Intronic
1139223837 16:65214668-65214690 CATTATATGAACATATAGCAAGG + Intergenic
1139961053 16:70717508-70717530 CCTTACAGGAAGAAAAACAAAGG - Intronic
1140071992 16:71658563-71658585 CCTTTTATAAAGAAGAAGAAAGG - Intronic
1140233443 16:73137459-73137481 CCTTCTAAGGAGATTAAGAACGG + Intronic
1140300714 16:73754747-73754769 CTTTACATGAAGAAAAAAAAAGG + Intergenic
1143680366 17:8471717-8471739 TCTTATATGAAGCTATTGAAAGG - Intronic
1144226538 17:13154454-13154476 AATAATATGCAGATAAAGAAGGG + Intergenic
1147014704 17:37482284-37482306 CCCTAAATGATGATAATGAAAGG - Intergenic
1147858553 17:43501901-43501923 GCTTTTATGAAGAGAGAGAATGG + Intronic
1149177085 17:53885788-53885810 ACTTATATGAAGGTGAAGAGAGG - Intergenic
1150584132 17:66502124-66502146 CCTGCTATGAAGAGGAAGAATGG + Intronic
1151114797 17:71723878-71723900 CCTTATAAGAAGATAAGAGATGG + Intergenic
1153812181 18:8761904-8761926 CCTTATATGAAGATATGGTTTGG - Intronic
1154204641 18:12326500-12326522 CCTTATATGAATATGCAGTATGG + Exonic
1155191162 18:23432116-23432138 TCTTATATGGAGAAAAGGAAAGG + Intronic
1155444226 18:25893992-25894014 TCTGATATGATGAAAAAGAATGG + Intergenic
1155938365 18:31777623-31777645 CCTTTTTTGAAGATAATGACAGG - Intergenic
1156014483 18:32532691-32532713 TCTTATGGGAAGATAAAGTAGGG - Intergenic
1156114448 18:33770420-33770442 ATTTATCTGAAGATAAACAAGGG + Intergenic
1156253177 18:35371611-35371633 CTTTATAAGAAGAGGAAGAAAGG - Intronic
1158806967 18:60985486-60985508 CCTTATCAGGAGTTAAAGAAGGG - Intergenic
1159140206 18:64385172-64385194 CCTTTTCTCAAGATACAGAATGG - Intergenic
1159321080 18:66849719-66849741 CCTATGTTGAAGATAAAGAATGG + Intergenic
1159428629 18:68322127-68322149 CTTATTATGAAGATAAAGAAAGG - Intergenic
1159548193 18:69867136-69867158 TTTTATATGAATATAAATAAAGG - Intronic
1161308537 19:3580692-3580714 CCTTATAAGAAGATAAAATCTGG + Intergenic
1164286893 19:23824864-23824886 GGTTATTTGAAGATAAAAAAGGG - Intronic
1165562452 19:36691538-36691560 GCTTATATTAAAATAATGAAAGG - Intronic
1165971204 19:39631834-39631856 CTTAACATGAAGATAAAGAAAGG - Intergenic
1166972168 19:46576314-46576336 CCTTATAGGAAGAGGAAGAGAGG - Intronic
1167521354 19:49958019-49958041 CATTAAATAAAGACAAAGAAGGG - Intronic
1168677320 19:58288193-58288215 CCTCATAAGAGAATAAAGAAGGG - Intronic
924971318 2:130083-130105 CCTTTTATCAAGAAAATGAAAGG + Intergenic
925467529 2:4121299-4121321 GATTAAATGAAGATAATGAAAGG + Intergenic
925467821 2:4125323-4125345 GATTAAATGAAGATAACGAAAGG - Intergenic
925769131 2:7265363-7265385 CCTTGTTTGAAGAGAAACAAAGG - Intergenic
927947680 2:27146952-27146974 GCTTATGTGAACATATAGAAAGG - Intergenic
928700713 2:33895967-33895989 CCTTATAAGAGGATAATGGAAGG + Intergenic
929190051 2:39131429-39131451 CTTTATTTGAAGATTAAGTATGG + Intergenic
929373028 2:41249934-41249956 CCTTATAAGAAGAAAAAATATGG + Intergenic
930242238 2:48947965-48947987 TCTAATAAGAAGATATAGAATGG - Intergenic
930348341 2:50215996-50216018 GCTTATAAGTAGATAAAGAATGG + Intronic
930394608 2:50805300-50805322 ACTTCTATGAAGAAACAGAATGG + Intronic
930764841 2:55074593-55074615 CCTAATATCAAAATGAAGAAAGG + Intronic
931826169 2:66003388-66003410 CCTTGTATGTACATAAATAAAGG + Intergenic
934014310 2:87862730-87862752 CCTTATAAGAAGATAAACCACGG + Intergenic
934018158 2:87912567-87912589 TCCTATCTGAAGATAAAGAAAGG - Intergenic
934511060 2:94944321-94944343 CATAAAATGAAGAGAAAGAAAGG + Intergenic
934569849 2:95362404-95362426 CCTTATATGAAGAGTAAGAGAGG - Intronic
935556954 2:104520285-104520307 CCATATATCAAGATAAGGAGGGG + Intergenic
935915769 2:107947808-107947830 CATTATTTGAAGAAAAAGAGTGG - Intergenic
936610232 2:113995395-113995417 CTTTATTTGAAGATTAAGTATGG - Intergenic
938148232 2:128856333-128856355 CCTTATCAGAAGATAGAGATAGG + Intergenic
939093497 2:137805651-137805673 CCTATTATGAAGATAAATAACGG + Intergenic
939295370 2:140256765-140256787 CCTTACAAAAAGAAAAAGAAGGG - Intronic
940792371 2:158042693-158042715 CCTTATAGGAAGAGAGAGGAAGG + Intronic
941982022 2:171468971-171468993 CCTAATAAGAAGAAACAGAAAGG + Exonic
942999284 2:182304254-182304276 AATTATATGAAGATAGAGAGAGG - Intronic
943119897 2:183722801-183722823 CCTAAAATGAAGATAAAATAAGG + Intergenic
943980636 2:194545275-194545297 TCTTATATGATGACAAAGGAGGG - Intergenic
944120291 2:196233415-196233437 TCTTAGTTGAAAATAAAGAATGG - Intronic
944318732 2:198311336-198311358 CCATATGTGGAGATAAAGCAGGG - Intronic
944914971 2:204350341-204350363 CCTTATATGAAGAGGAAGGCAGG - Intergenic
945279149 2:208018884-208018906 CTTTATATGTAGATATAGAGTGG - Intronic
945508844 2:210675244-210675266 CCTCATATGAAAACAAAAAAAGG - Intronic
945686578 2:212978137-212978159 CCTTATATGACTATAAAGCAAGG - Intergenic
946148381 2:217747955-217747977 CCTTACAGGAAGCCAAAGAAAGG + Intronic
947010824 2:225564486-225564508 CCTCATCTGAATATAGAGAAAGG + Intronic
947844272 2:233231693-233231715 CTTTATAAGAAGAGGAAGAAAGG - Intronic
947943933 2:234083568-234083590 CCTTATAAGAAGAGGAAGAGGGG - Intergenic
1168917039 20:1498491-1498513 CTTTATCTAAAGGTAAAGAAAGG - Intergenic
1169585395 20:7077455-7077477 TTTTAAATGTAGATAAAGAAAGG + Intergenic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1170105812 20:12753587-12753609 CCTTATATGAGGAGCAAGGAGGG - Intergenic
1170380778 20:15757779-15757801 CCTTATAAGAAGAGGAAGAGAGG - Intronic
1171370240 20:24657805-24657827 CATTAGATGATGATAAATAATGG + Intronic
1172060141 20:32181851-32181873 CCTTATATGAATATTCAGAGGGG - Intergenic
1173382132 20:42555234-42555256 TTTTACATGAAGATAAACAATGG - Intronic
1175556441 20:59861938-59861960 TCTTTGATGAAGAGAAAGAATGG + Intergenic
1175664874 20:60849972-60849994 CTTGATTAGAAGATAAAGAATGG - Intergenic
1177592910 21:23195549-23195571 CCTTATTTGAAAATAAATTAAGG - Intergenic
1177696004 21:24571932-24571954 CCTTATAAGAAGAGAAAAATAGG + Intergenic
1177716753 21:24848662-24848684 GCTTCTATGAAAATAAGGAAAGG - Intergenic
1178780206 21:35595650-35595672 CCTTATATGAAGATAAAGAAAGG + Intronic
1179392883 21:41010091-41010113 CCTTATTATAAGAAAAAGAAGGG + Intergenic
1180608519 22:17080145-17080167 CTTTATATGAAGAGGAAGATAGG - Intergenic
1182814142 22:33143978-33144000 AATTAAATCAAGATAAAGAAAGG - Intergenic
1184796722 22:46737518-46737540 CCTGTTAAGAAGTTAAAGAAGGG - Intronic
949323566 3:2839330-2839352 CCTTAGATGCAGATAAAAAGCGG + Intronic
950601087 3:14036230-14036252 CCTAATAAAAAGATACAGAATGG - Intronic
951118797 3:18898574-18898596 CCTTATTTGGAGATGAAGTATGG + Intergenic
951627407 3:24680947-24680969 ACTTGGATGAAGATAAATAAAGG + Intergenic
951839005 3:27013471-27013493 CAGTAGAGGAAGATAAAGAATGG + Intergenic
952140765 3:30476477-30476499 CCTCATTTGCAGATAAGGAATGG - Intergenic
952783554 3:37129206-37129228 CCAGATTTGAAAATAAAGAATGG + Intronic
954280225 3:49571908-49571930 CCTTCTCTGAGGATAAAGCAGGG - Intronic
956932749 3:74064042-74064064 CCTTATAAGAAGAGGAAGATTGG - Intergenic
957131563 3:76229626-76229648 CCTGATGTGAATATAGAGAAAGG - Intronic
957733373 3:84174144-84174166 ATTTATATGAAGATACAGCAGGG + Intergenic
961839722 3:129698875-129698897 GCTTATATTAAAATAAAGCAGGG - Intronic
962453516 3:135542715-135542737 CATTATATTATGATACAGAATGG + Intergenic
963016904 3:140833016-140833038 CCACATAGGAAGAAAAAGAAAGG + Intergenic
963907246 3:150782785-150782807 CCTTATAAGAAGAGAAAGAGAGG + Intergenic
966038646 3:175452405-175452427 CCTTAAAAGAAAAAAAAGAAAGG + Intronic
966433305 3:179855370-179855392 CTTTATTTCAAGACAAAGAATGG - Intronic
966998500 3:185309013-185309035 CCTTATAAGAAGAGAAAACACGG - Intronic
967144272 3:186592984-186593006 GCTTTTATGAAGAGAAAGAGAGG + Intronic
967745015 3:193045648-193045670 CCATCTATGAAGATGAAGCATGG + Intergenic
969855183 4:9993518-9993540 GATGACATGAAGATAAAGAATGG - Intronic
970181231 4:13397598-13397620 TCTTACATGATCATAAAGAAAGG + Intronic
970296340 4:14634898-14634920 ATTTATATGAAGTTCAAGAATGG - Intergenic
970831047 4:20340242-20340264 ACTTAGATTAAGAGAAAGAAAGG - Intronic
971090550 4:23338742-23338764 ACTTAGATTAACATAAAGAAAGG + Intergenic
972687847 4:41368455-41368477 CATACTATGAAGACAAAGAATGG + Intronic
972745705 4:41930529-41930551 CATTATAAGAAGAGAAAGAGAGG + Intergenic
974356167 4:60815476-60815498 ACTCAGAGGAAGATAAAGAAAGG + Intergenic
974455867 4:62128715-62128737 GTATATATGAAGATAAAGACTGG - Intergenic
975708238 4:77132388-77132410 GCTTATTTAAAGATAAAGACAGG + Intergenic
975795477 4:78002445-78002467 CTTAACATGAAGATAGAGAAAGG + Intergenic
975915438 4:79319729-79319751 CACTCTATGAAGATAAAGAGGGG - Intronic
976123745 4:81810918-81810940 CATTATCTGAAAATAAAGATGGG + Intronic
976455743 4:85245374-85245396 CCTTAAAGGAAGTTACAGAAAGG - Intergenic
976978757 4:91197236-91197258 CCTTATATGGGGAGAAAGCAAGG - Intronic
977611555 4:99039425-99039447 TCTCATCTGAAGATATAGAAGGG + Exonic
978096017 4:104779245-104779267 CCTTATAGGAAGGAAGAGAATGG - Intergenic
978291167 4:107142512-107142534 CTTTATAAGAAGAGGAAGAAAGG + Intronic
978540598 4:109812832-109812854 AATTCTTTGAAGATAAAGAATGG + Intergenic
978807950 4:112820195-112820217 CCTAATGTGATGATAAAGACAGG - Intronic
979021917 4:115512637-115512659 CTTTCTTTGAAGATGAAGAAAGG - Intergenic
979510763 4:121550822-121550844 GCTTATATTAAGATGAAGAAAGG - Intergenic
979716384 4:123844004-123844026 TCTTATTTGTAGATAAAGAAGGG + Intergenic
979903761 4:126257450-126257472 CCTTCTATTAGGATAAGGAAAGG - Intergenic
980490523 4:133520548-133520570 AATTATTTGAAGAGAAAGAAAGG + Intergenic
980548600 4:134303199-134303221 CCTGCTATGTAGAGAAAGAATGG - Intergenic
980952196 4:139392010-139392032 CCTTTTATGAAGATAGGGAGAGG + Intronic
981611261 4:146596367-146596389 CATTATATCAATATAAAGGAGGG - Intergenic
983637571 4:169913922-169913944 CAGTAAATGAAAATAAAGAAGGG + Intergenic
983803813 4:171968472-171968494 CCTTACAGGAAGAGGAAGAAAGG - Intronic
983898731 4:173110006-173110028 ATTTATATTAAGAGAAAGAAGGG - Intergenic
984192174 4:176619288-176619310 CTTTATATAAAGAAGAAGAAAGG + Intergenic
984488556 4:180402670-180402692 CCATTTACCAAGATAAAGAAGGG - Intergenic
985275633 4:188234796-188234818 AGTTATAAGAAGATACAGAATGG - Intergenic
986175780 5:5350789-5350811 CCTTATATTAAGCCAGAGAAAGG + Intergenic
986201891 5:5586693-5586715 CCTTATAAAAAGAAAAAAAAAGG - Intergenic
986306811 5:6522411-6522433 CCTTATGGCAAGATAACGAAGGG + Intergenic
988088183 5:26498810-26498832 CCTTATAAGAAGAGACACAAAGG + Intergenic
988130582 5:27098832-27098854 CCTTAGATTAAGATATAGCAAGG + Intronic
988166890 5:27604299-27604321 ACCTATTTGAAGTTAAAGAACGG + Intergenic
988350007 5:30090788-30090810 CCATAGATGCAAATAAAGAAAGG - Intergenic
988365035 5:30287595-30287617 CCTTATATGCAAGAAAAGAATGG - Intergenic
988667539 5:33346032-33346054 TGTTATATGAAGACAAAAAAAGG - Intergenic
989273861 5:39564112-39564134 CCTTAGCTGAAGATGAAGACTGG + Intergenic
991070005 5:62466728-62466750 CAATATATGAAGATATACAAAGG - Intronic
992027605 5:72685984-72686006 TCTTATAAGAAGAGAAAGAGAGG + Intergenic
992628169 5:78653298-78653320 CCTTATTTGTAGAGAAAAAATGG - Intronic
992675497 5:79101954-79101976 TCTGATAGGAAGATAAGGAAAGG + Intronic
993558240 5:89368381-89368403 CTTTATATGAAAATAAAAAAAGG - Intergenic
994184440 5:96802819-96802841 CCTTATAAGAAGATGGAGACTGG + Intronic
995050512 5:107697820-107697842 CCTTATCTGACGAAAGAGAAAGG - Intergenic
995413840 5:111887585-111887607 ACTTCAATGAATATAAAGAATGG + Intronic
996352172 5:122556787-122556809 CCTTCTAGGAAAATGAAGAAAGG - Intergenic
996642875 5:125778253-125778275 CATTATATTACAATAAAGAATGG - Intergenic
999019506 5:148148049-148148071 TCTTATATGAAGATGTTGAAGGG - Intergenic
1000316134 5:160093591-160093613 CTAAATATGAAGATAAAAAACGG - Exonic
1002815927 6:680377-680399 GCTTATATGAATACAGAGAAAGG + Intronic
1003237612 6:4310803-4310825 CCTTATAGGCAGAGAGAGAATGG + Intergenic
1003484233 6:6561981-6562003 CCTGAGATGAAGTTAAAGCAGGG - Intergenic
1005165106 6:22910441-22910463 CGTGATATGAAGACAAAGATTGG + Intergenic
1007642042 6:43349099-43349121 GCTTCTATGAAGGTAAAGAATGG + Intronic
1007906640 6:45467871-45467893 CCCTATATTAAGGTAAGGAAAGG - Intronic
1008735276 6:54535783-54535805 CCTTATATGTTCATAATGAAGGG - Intergenic
1008900580 6:56610700-56610722 CTGTATATGAAAATTAAGAATGG + Intronic
1009518332 6:64649027-64649049 CCTTATATATACAGAAAGAAAGG + Intronic
1009909511 6:69907964-69907986 CCTTCTATGAAGGCAAAGCAAGG - Intronic
1012271810 6:97222289-97222311 CCTTATAGGGAGAGAAAAAAAGG + Intronic
1014193812 6:118528773-118528795 CATTAAATGAAGTTATAGAATGG + Intronic
1014503538 6:122224610-122224632 CTTTAAAAGAAGAGAAAGAAAGG - Intergenic
1014794545 6:125709551-125709573 CTTTATATGAAGACACAGATAGG - Intergenic
1015029803 6:128580816-128580838 TCAAATATGAAGATACAGAAAGG - Intergenic
1015122781 6:129719117-129719139 ACTTATATGAAAAAAAATAATGG - Intergenic
1015278721 6:131409293-131409315 ACTTGTAAGAAGACAAAGAAAGG - Intergenic
1015590789 6:134821110-134821132 CTTGAGAAGAAGATAAAGAATGG - Intergenic
1017645221 6:156533970-156533992 CCTTATAAGAAGAGAAACCAGGG - Intergenic
1020625375 7:10571740-10571762 CATTAGATGAAGAAAAATAATGG + Intergenic
1021310718 7:19092714-19092736 ACTTAAATGAAGCTAAAGCATGG - Intronic
1022484710 7:30769561-30769583 TCTTATATGTAGAGAGAGAAGGG - Intronic
1023486371 7:40691633-40691655 TCTAGTATGAAGATAAAGATAGG - Intronic
1023576304 7:41631257-41631279 CCTTATAAGAAGAGGAAGAGAGG - Intergenic
1023701932 7:42900843-42900865 CCTCTTATGAAGAAAAGGAATGG + Intergenic
1024712537 7:52033288-52033310 CCTTTCAGGAAGAAAAAGAATGG + Intergenic
1024815235 7:53261420-53261442 GTTCATATGAACATAAAGAATGG + Intergenic
1027856780 7:83521770-83521792 CCTTATATGAAGAGACAGGAGGG - Intronic
1028308132 7:89291951-89291973 CCTTACATGACGAGAAAGACAGG + Intronic
1028350048 7:89835077-89835099 ACTTATATGAAAATAAAAATTGG - Intergenic
1028569195 7:92267441-92267463 CCTTATATGAAGAACCACAATGG - Intronic
1029867796 7:103654092-103654114 CCTTATATGAGGAATAGGAAAGG + Exonic
1029928102 7:104339644-104339666 CCTTGCATGATGATACAGAATGG - Intronic
1031403894 7:121360122-121360144 CCACATCTGAAGAAAAAGAAAGG + Exonic
1033083855 7:138324006-138324028 AATTTTATGAAGAGAAAGAAAGG - Intergenic
1036031861 8:4982457-4982479 CCTCATTTGGAGACAAAGAACGG + Intronic
1037427231 8:18769234-18769256 CTTTAAATGAAAATAAAGGAAGG + Intronic
1038062158 8:23925555-23925577 CCTTATTTGAAAAAAATGAAAGG - Intergenic
1038986303 8:32814959-32814981 CATTAAATGAAGAAAAAAAATGG + Intergenic
1039225718 8:35385995-35386017 CCTGAGATGTAGATTAAGAAGGG - Intronic
1039260091 8:35762065-35762087 CCTGATTTGAAGTTAGAGAAAGG - Intronic
1039633210 8:39134852-39134874 CCTTAAAAAAAGATAAAGATGGG + Intronic
1040816879 8:51517990-51518012 TATTATATGAAGATAAATTAAGG - Intronic
1041354905 8:56990192-56990214 ACTTATTTGAAGGTAAAGCATGG - Intronic
1041808757 8:61884845-61884867 CCTGATATCAGGATGAAGAAAGG - Intergenic
1043664634 8:82793267-82793289 CTTTAAAGGAACATAAAGAAAGG - Intergenic
1044297427 8:90545195-90545217 CTTTATAGGATGACAAAGAAGGG - Intergenic
1044528739 8:93283270-93283292 CCTTATTTGAAAATACAGTAAGG + Intergenic
1045216479 8:100154109-100154131 CATTATATGAAAATACAGAAAGG - Intergenic
1045925851 8:107578297-107578319 CCTAATATCAAGATGAGGAAAGG + Intergenic
1047979809 8:130169126-130169148 CCTTATGTGGAAATAAAAAAAGG + Intronic
1048403458 8:134094725-134094747 TCTTTCATGAAGATGAAGAAGGG - Intergenic
1048439858 8:134451865-134451887 CCTTATATGATGATAGATGAAGG - Intergenic
1048827946 8:138447839-138447861 GGTTATATGAAGACAAAGAAGGG + Intronic
1051539777 9:18202697-18202719 GCATATATGCAGATAAATAAGGG - Intergenic
1051570783 9:18556450-18556472 ACTTAGATAAAGGTAAAGAAGGG - Intronic
1052009633 9:23390563-23390585 ACTTATAAGAAGTTCAAGAATGG + Intergenic
1052168865 9:25368937-25368959 CAGTATAAGAAGATAAAAAATGG + Intergenic
1052659323 9:31407895-31407917 AGTTATATGAAGAAAAGGAAGGG - Intergenic
1054887665 9:70216446-70216468 CCTTATAAGAAGAGACAGCAGGG - Intronic
1055093659 9:72388306-72388328 CTTTATAAGAAGAGAAAGAGAGG - Intergenic
1055141304 9:72880250-72880272 CCTTAGAAGAAGGTAAAGATTGG + Intergenic
1055473432 9:76637045-76637067 CCTGGTAGGAAGATATAGAATGG + Intronic
1056525714 9:87441208-87441230 CCTTACTTGAAGATTAAGTATGG - Intergenic
1057551175 9:96051771-96051793 CCTTATAAGAAGAGAGAGGAGGG + Intergenic
1057614117 9:96572925-96572947 GCTGATATCAAGATACAGAAAGG + Intronic
1059118894 9:111623808-111623830 CCTTATATGAAGAAATTCAATGG + Intergenic
1060466486 9:123911630-123911652 ATTTATATGAAGTTCAAGAATGG + Intronic
1187505103 X:19873031-19873053 GCATCTATGGAGATAAAGAATGG + Intronic
1188005095 X:25011580-25011602 CCTTTTTTAAAGATAAGGAAAGG + Intronic
1189076736 X:37923521-37923543 CTTTATATATATATAAAGAATGG + Intronic
1189107057 X:38247692-38247714 TCTTATATAAAGTTAAAGCATGG - Intronic
1189277358 X:39796790-39796812 CCTTATAGGAAAATCAATAATGG + Intergenic
1191872233 X:65757521-65757543 CTTTATATGAAGTTCAAAAAAGG - Intergenic
1191967367 X:66774547-66774569 CACTATAGGAAGAGAAAGAAAGG - Intergenic
1192886397 X:75339072-75339094 CCTTATATGAAGAGAAAATTTGG - Intergenic
1193852074 X:86550534-86550556 CCTAGTATGAAGAAAAATAAAGG - Intronic
1193945944 X:87734694-87734716 CCTAATATAAAATTAAAGAAAGG - Intergenic
1194325837 X:92515310-92515332 TCTTATGTGAATTTAAAGAAAGG + Intronic
1196089823 X:111727721-111727743 CTTTTTATGAAGTTGAAGAAGGG + Exonic
1197534575 X:127671991-127672013 CCTTAAATGAAGAAAAAGCTTGG + Intergenic
1197602894 X:128551162-128551184 CCTTAAATTAAGATAAAACAAGG - Intergenic
1197800455 X:130342192-130342214 CCTGAGATTAAGATATAGAAGGG + Intronic
1199034964 X:143039466-143039488 CCATATAAGAAGAAAGAGAAAGG - Intergenic
1199126370 X:144126439-144126461 TCCTATCTGAAGATAAAGAAAGG + Intergenic
1199130163 X:144175743-144175765 CCTTATAAGAAGATAAACCACGG - Intergenic
1199133023 X:144216809-144216831 CATTACATAATGATAAAGAATGG - Intergenic
1199615741 X:149653468-149653490 GCTTAACTGAACATAAAGAATGG - Intergenic
1199621833 X:149708468-149708490 AATTCTATGAAGAAAAAGAAAGG + Intronic
1199622082 X:149711179-149711201 TTTTAATTGAAGATAAAGAATGG + Intronic
1199626895 X:149749770-149749792 GCTTAACTGAACATAAAGAATGG + Intergenic
1199627531 X:149754228-149754250 GCTTAATTGAACATAAAGAATGG + Intergenic
1200634559 Y:5634468-5634490 TCTTATGTGAATTTAAAGAAAGG + Intronic
1201605968 Y:15785584-15785606 CATTATGTGTAAATAAAGAAGGG - Intergenic
1201758589 Y:17515442-17515464 CATTCAATGAAGAAAAAGAAAGG + Intergenic
1201842966 Y:18390548-18390570 CATTCAATGAAGAAAAAGAAAGG - Intergenic