ID: 1178783209

View in Genome Browser
Species Human (GRCh38)
Location 21:35626166-35626188
Sequence AATACCTTATGCTCTGGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178783204_1178783209 -3 Left 1178783204 21:35626146-35626168 CCAATCTATTCCTGCCCTTAAAT 0: 1
1: 0
2: 1
3: 23
4: 337
Right 1178783209 21:35626166-35626188 AATACCTTATGCTCTGGTTCTGG 0: 1
1: 0
2: 0
3: 5
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178783209 Original CRISPR AATACCTTATGCTCTGGTTC TGG Intronic
907331705 1:53676126-53676148 AACACCGTTTGCTCTGGTTTGGG + Intronic
907575957 1:55525919-55525941 AAAAGCTTATGCTTTGGGTCAGG - Intergenic
908534250 1:65064361-65064383 AACATCTTTTACTCTGGTTCGGG - Intergenic
913657261 1:120973086-120973108 AAAACTTTTTGCTCTGCTTCAGG + Intergenic
915633374 1:157169365-157169387 ACTTCCTTACGTTCTGGTTCTGG + Intergenic
918873411 1:190006785-190006807 TATACCTGATTCTCTGGTTCTGG - Intergenic
919347902 1:196409908-196409930 AAAACCTTGTGCACTGGTTGTGG - Intronic
922168871 1:223138454-223138476 AAGACCTTGTTCTCTGCTTCAGG + Intronic
923636809 1:235706271-235706293 AAAATCTTATGATCTGCTTCAGG - Intronic
923985446 1:239376897-239376919 AAAACCTTATGCTCAAATTCTGG - Intergenic
1065434223 10:25690663-25690685 AATAACATATGCACAGGTTCTGG + Intergenic
1068771629 10:60828076-60828098 AATACCTTCTGTTTTGCTTCTGG - Intergenic
1073808696 10:107128620-107128642 AGTTCCCTATGCTGTGGTTCAGG - Intronic
1074329302 10:112488495-112488517 AATACCTTTGGGTCTGGTTCTGG - Intronic
1074912803 10:117927025-117927047 AATATCTTCTCTTCTGGTTCTGG + Intergenic
1075235151 10:120721272-120721294 ATTCCCTTATGCTCTGGAACTGG + Intergenic
1076102002 10:127789926-127789948 AACTCCTTGTGCTCTGGGTCTGG - Intergenic
1085989640 11:81826676-81826698 AATAACTGATGATGTGGTTCTGG + Intergenic
1086676399 11:89612399-89612421 AATAACTTATGTCCTGGTCCTGG + Intergenic
1095485134 12:42676838-42676860 AGTAGCTCATGCTCTGGTTGGGG + Intergenic
1097125788 12:56773887-56773909 ACTACCTTCTGCACTGGTACCGG + Exonic
1097148351 12:56957406-56957428 ACTACCTTCTGCACTGGTACCGG - Exonic
1097151978 12:56985904-56985926 ACTACCTTCTGCACTGGTACTGG - Intergenic
1097593724 12:61602452-61602474 ACTACCTTCTGCTTTGCTTCTGG + Intergenic
1098361456 12:69658295-69658317 AAAACCTTATGCCCTGGTATAGG + Intronic
1099542643 12:83932281-83932303 AGCACCTTATGCTCTCTTTCAGG + Intergenic
1106236567 13:27866334-27866356 AATACCTAATGCACTGCTCCAGG + Intergenic
1106803956 13:33286785-33286807 TAAACCATATACTCTGGTTCTGG - Intronic
1106898426 13:34330210-34330232 AAGACCTGATGCTCTGACTCAGG - Intergenic
1109638239 13:65151274-65151296 AATACCTTAACATCTGGTCCAGG + Intergenic
1110338075 13:74355450-74355472 AATGCATTATGCTCTGTTTTGGG + Intergenic
1111013509 13:82344890-82344912 AATAACCTATGCTCAGGTGCAGG + Intergenic
1112795990 13:103057363-103057385 AAAACCTTATTTTCTGTTTCTGG - Intronic
1116713191 14:48396063-48396085 AATAACATATGATATGGTTCAGG + Intergenic
1117000886 14:51370066-51370088 ATTACCTTATTCTCTGATTATGG - Intergenic
1118711855 14:68525991-68526013 AATTCCTGAGGCTCTGGTTCAGG + Intronic
1119692390 14:76685742-76685764 AATACCTTTTGCTTTGTTTCAGG + Intergenic
1123579128 15:21700487-21700509 AATTCCTTATGCTGTGGCTGGGG - Intergenic
1123615755 15:22142998-22143020 AATTCCTTATGCTGTGGCTGGGG - Intergenic
1128285892 15:66436775-66436797 GCTCCCTTATGATCTGGTTCCGG - Exonic
1202987998 15_KI270727v1_random:434732-434754 AATTCCTTATGCTGTGGCTGGGG - Intergenic
1136119833 16:28125584-28125606 AATAGCTTCTGCTCTGGCCCCGG - Intronic
1139023717 16:62786081-62786103 AATACACTATGCTATGGATCAGG - Intergenic
1146565793 17:33911736-33911758 AATACATTAAGCTCTGGTCCAGG - Intronic
1148878674 17:50708108-50708130 AAAGCCTTATCCTCTGGTGCAGG + Intergenic
1152977107 18:231917-231939 AATACATGTTGCTCTAGTTCAGG + Intronic
1153741295 18:8131467-8131489 AATAGGTTATGCTCTGTTTTGGG - Intronic
1157778722 18:50418781-50418803 AATACAATATGCTCTGGTATAGG + Intergenic
1158119013 18:54027700-54027722 CATACCTTATACTTTGGTTTTGG + Intergenic
1158231775 18:55264417-55264439 AATGCCTTTTGTTCTGGTCCAGG + Intronic
1159524668 18:69572549-69572571 AGTACCTTATTCTATAGTTCTGG + Intronic
1160162731 18:76487284-76487306 CATTCCTTATGCTCTGCATCTGG - Intronic
925590397 2:5503434-5503456 TATATCTTATGTTCTGCTTCAGG - Intergenic
925654486 2:6131306-6131328 ATTACCTTCTGCTCAGATTCTGG + Intergenic
930409177 2:51001886-51001908 AATATCTTATGACCTGCTTCAGG - Intronic
936614232 2:114032594-114032616 AATACCCCATGTTCTGATTCTGG + Intergenic
938171554 2:129081811-129081833 ATTTCCTTATACTCTGGTTTGGG + Intergenic
941825830 2:169895294-169895316 GATACCTTATACTCTTGATCTGG - Exonic
941902427 2:170691306-170691328 TATACCTTAGGCACAGGTTCTGG - Intergenic
943940157 2:193983309-193983331 AATGCCTTATTCTCTGGATTAGG + Intergenic
944606140 2:201353103-201353125 ACTCCCAAATGCTCTGGTTCTGG - Intronic
1169001150 20:2168923-2168945 CATACCTTGGGCTCTGGTTTGGG - Intronic
1170263785 20:14442652-14442674 AATTCCTAATGCTCTTCTTCTGG + Intronic
1173095782 20:40026797-40026819 AATACCTTCAGCTATGGCTCCGG - Intergenic
1177244211 21:18501826-18501848 AATCCCTTATTCTTTGGCTCTGG - Intergenic
1178783209 21:35626166-35626188 AATACCTTATGCTCTGGTTCTGG + Intronic
1179592796 21:42421309-42421331 AAAACCCTATGTTGTGGTTCTGG + Intronic
1181332468 22:22104052-22104074 AATACCTTATGCTTGGGCTGTGG + Intergenic
952888166 3:38024506-38024528 AACACCCTCTGCTCTGGTCCGGG + Exonic
954882971 3:53848037-53848059 AATAATTTGTGCTTTGGTTCTGG - Intronic
956683683 3:71804861-71804883 ATTACCTGATGCTTTGCTTCTGG - Intergenic
957292420 3:78294714-78294736 ATTACCTTATGATGTGATTCAGG - Intergenic
957892002 3:86371624-86371646 AATATATAATCCTCTGGTTCTGG - Intergenic
959487393 3:106942772-106942794 AATACCTAATGCTGTATTTCTGG + Intergenic
959803952 3:110528735-110528757 AGGAACTTATGTTCTGGTTCAGG - Intergenic
963080236 3:141384966-141384988 AATCACTTATGCTCTGGGGCAGG + Intronic
971223622 4:24731986-24732008 ACTACCTTAAGCTCTGGATGTGG - Intergenic
971560604 4:28075390-28075412 AAGACCTTTTGATCTGGTTTGGG + Intergenic
972104528 4:35465241-35465263 AAAACTTTATGCTCTGCTTGGGG - Intergenic
973530610 4:51833783-51833805 ATTCCCTTTTGTTCTGGTTCTGG + Intergenic
973750207 4:54009546-54009568 AATTCCTAATGCTCTGTTTATGG - Intronic
974642682 4:64652099-64652121 CACACCTTCTGGTCTGGTTCAGG + Intergenic
975508632 4:75167854-75167876 AAGACCTTCTGCTCTCCTTCCGG - Intergenic
977160048 4:93622664-93622686 AATACCTCATGGTTTGGTTGGGG + Intronic
978525639 4:109662185-109662207 AAAACCTTATTCTCTGATCCAGG - Intronic
985205949 4:187537130-187537152 AACATGTTCTGCTCTGGTTCAGG - Intergenic
987702625 5:21421339-21421361 AAGAACTTACACTCTGGTTCTGG + Intergenic
988019726 5:25607665-25607687 AATACCTAAAGCTCTGGACCTGG - Intergenic
988698766 5:33651181-33651203 AGTACCTCATGCTCTGGGTGGGG - Intronic
995816807 5:116178943-116178965 AATCCCTAAGCCTCTGGTTCAGG - Intronic
998739127 5:145178741-145178763 AATAACTTATGTTCTGGGTTGGG + Intergenic
998765925 5:145487297-145487319 AATCCCGTATGCTCTGTTTGGGG - Intronic
1005501958 6:26436536-26436558 AATTCCTTAGGCTTTGGTCCTGG + Intergenic
1008974313 6:57406845-57406867 AAGTACTTATGCTCTGGTTGCGG + Intronic
1009163202 6:60308359-60308381 AAGTACTTATGCTCTGGTTGCGG + Intergenic
1010578846 6:77568400-77568422 AATACCATATGCTGTGGACCAGG + Intergenic
1023472249 7:40536329-40536351 GATACCTTATGCTCTGAGACAGG + Intronic
1028432657 7:90765329-90765351 AATCCTTTATGCTCTGCTTTGGG - Intronic
1028927227 7:96371599-96371621 AAGACCTTATAATCTGGTTTAGG + Intergenic
1031521290 7:122769691-122769713 AATACCTTCACCTCTTGTTCAGG + Intronic
1033220763 7:139524999-139525021 GATACGTCATGCTCTGGGTCTGG - Intronic
1033355787 7:140599045-140599067 AATACATTATGGTCTGGGTGTGG + Intronic
1037067599 8:14601822-14601844 AAAACCTTATGATGTGGTGCCGG + Intronic
1037862463 8:22415608-22415630 AATAGCTTTTGCTATGTTTCTGG + Intronic
1038720171 8:30028037-30028059 GCTCCCTTATGATCTGGTTCCGG - Intergenic
1039343432 8:36676010-36676032 TTTACCTAATGCACTGGTTCTGG + Intergenic
1040309158 8:46227704-46227726 AATACCCCATGCTTTGGTGCAGG + Intergenic
1041624625 8:60011405-60011427 AATACCATATGCTCAAGTCCTGG + Intergenic
1042240591 8:66660253-66660275 AATACCTTATTTCCTAGTTCAGG - Intronic
1050755789 9:9001545-9001567 AATACTTAAAGCTCTGGATCGGG + Intronic
1052676729 9:31635469-31635491 AATACATTATGGTCTGTATCTGG + Intergenic
1057961236 9:99459337-99459359 AATACCATGTGTTCTGATTCTGG + Intergenic
1058029022 9:100175568-100175590 TATATTTTATTCTCTGGTTCTGG - Intronic
1203545815 Un_KI270743v1:127353-127375 AATACCCTGTGCTCTGGATGTGG - Intergenic
1188888507 X:35581241-35581263 ACTACCATATGCTCAGCTTCTGG - Intergenic
1189243192 X:39541417-39541439 AATGCCTGGTGCTCTGCTTCTGG - Intergenic
1189725634 X:43965721-43965743 AATCTCTGATACTCTGGTTCAGG + Intronic
1193192112 X:78583085-78583107 AATAGCTTATGCTCAGCTTTGGG + Intergenic
1194329381 X:92562054-92562076 ACTACTATATGCTCAGGTTCTGG + Intronic
1195162614 X:102185317-102185339 AGTACCTGATGCCCTGATTCTGG - Intergenic
1197452539 X:126637924-126637946 AATACCTTATGTGCTAGTTGAGG - Intergenic
1198296228 X:135290032-135290054 AATGGCTTATTCTCTGGTTTGGG - Intronic
1198767587 X:140094521-140094543 AATATTTTATGCACTGGTTTTGG - Intergenic
1200638080 Y:5681244-5681266 ACTACTATATGCTCAGGTTCTGG + Intronic
1201334950 Y:12870585-12870607 AATACCTCATAACCTGGTTCAGG + Intergenic