ID: 1178785806

View in Genome Browser
Species Human (GRCh38)
Location 21:35652156-35652178
Sequence CTGGGGCTTCACCATGTATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178785806_1178785811 3 Left 1178785806 21:35652156-35652178 CCTAATACATGGTGAAGCCCCAG 0: 1
1: 0
2: 1
3: 19
4: 136
Right 1178785811 21:35652182-35652204 AAAAAGGCTAATGTTTCCCTAGG 0: 1
1: 0
2: 1
3: 28
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178785806 Original CRISPR CTGGGGCTTCACCATGTATT AGG (reversed) Intronic
901481702 1:9529675-9529697 CAGGGGCATCACCATGGATGTGG - Intergenic
901535298 1:9878836-9878858 CTGTGCCCTCACCATTTATTGGG - Intronic
903658555 1:24963490-24963512 CTGGGGGTGGACCATGTATAAGG - Intronic
903927512 1:26841164-26841186 ATGGGGTTTCACCATGTTTAAGG + Intronic
904113312 1:28143650-28143672 CTGGGGCTTCAACATGCATAGGG + Intergenic
906478396 1:46184968-46184990 CTGTGGCTTCACCAACTATACGG + Exonic
1064048434 10:12040230-12040252 ATGGGGTTTCACCATGTTGTTGG - Intronic
1064640447 10:17409987-17410009 CTGGGGCTTCCACATTAATTAGG - Intronic
1067947997 10:50703048-50703070 CTGGGGCCTCTCCATGGCTTGGG - Intergenic
1070687464 10:78499230-78499252 ATGGGGTTTCACCATGTTTCAGG + Intergenic
1070883308 10:79868046-79868068 CTGGGGCCTCTCCATGGCTTGGG - Intergenic
1071017685 10:81017666-81017688 TTAGGGCTTCAACATGAATTTGG + Intergenic
1071649876 10:87384353-87384375 CTGGGGCCTCTCCATGGCTTGGG - Intergenic
1073564225 10:104521485-104521507 ATGGGGTTTCACCATGTTGTTGG + Intergenic
1077445258 11:2587769-2587791 CTGGGATCTCACCATGCATTTGG + Intronic
1078519832 11:12053930-12053952 GTGGGGCTTCACCATGCAGATGG - Intergenic
1080012947 11:27476468-27476490 CTGGGCCTTCAGCATGTAGATGG - Intergenic
1080310831 11:30889862-30889884 TTAGGGCTTAACCATGAATTTGG - Intronic
1084119381 11:67060003-67060025 CTGGGGCTTCCCCCTGTCCTAGG - Intronic
1084594846 11:70110792-70110814 CTGGGCCCCCACGATGTATTTGG + Intronic
1089323181 11:117640108-117640130 CTGGGGCTTTGCTGTGTATTTGG - Intronic
1089896521 11:121935658-121935680 CTGGGGCTACACCATTCATGAGG + Intergenic
1091095178 11:132814344-132814366 CTGGGGCTCCAGCTTGTACTTGG - Intronic
1094304979 12:29008742-29008764 TTGGGGCTTCAACATGTAATGGG + Intergenic
1095211630 12:39501351-39501373 CTGTAGCTTCAGTATGTATTTGG - Intergenic
1095596637 12:43966754-43966776 CTGAGGCTTCACTATGAATATGG - Intronic
1096357550 12:50954247-50954269 CTGGGGGCTTACCATGTATTAGG - Intronic
1096886262 12:54721970-54721992 CTAGGTCTTTACCATGTTTTTGG + Intergenic
1096992275 12:55814677-55814699 ATGGGGTTTCACCATGTTATTGG - Intronic
1101971674 12:109318535-109318557 CTGTGCCTTCATCATTTATTGGG - Intergenic
1112381677 13:98896818-98896840 TTGGGACTTCACCATGCTTTTGG - Intronic
1113149230 13:107243159-107243181 CTGGGGCTCCACCATTTTCTAGG + Intronic
1116195318 14:41717450-41717472 CTGGTGCTTCACCATGTAGGTGG - Intronic
1121097648 14:91229015-91229037 CTGAGGCATAACCATGTAATGGG + Intergenic
1122132396 14:99612399-99612421 CTGGAGGTGCCCCATGTATTGGG + Intergenic
1123219614 14:106843744-106843766 CTGTGGCTTCTCCATGTAAGAGG + Intergenic
1126246978 15:46518474-46518496 CTGGGGCTTAACCAAGTCCTTGG - Intergenic
1127513506 15:59667951-59667973 CTCTGGGTTCACCCTGTATTTGG + Intronic
1129658467 15:77540096-77540118 ACGGGGTTTCACCATGTGTTAGG - Intergenic
1129831475 15:78673846-78673868 CTGGGGCTGCAGCATGGGTTGGG - Intronic
1130041323 15:80407141-80407163 CTGGTGCTTCCCCATCCATTTGG - Intronic
1130681875 15:86004060-86004082 CTGTGGCTTCACTATATATTTGG - Intergenic
1132599316 16:766980-767002 CTGGATCTTCACGAAGTATTCGG - Exonic
1132825156 16:1901054-1901076 ATGGGGTTTCACCATGTTGTTGG - Intergenic
1136268838 16:29136643-29136665 GTGGGGATGCACCATGGATTTGG + Intergenic
1136496251 16:30646750-30646772 CTGTGGCTGCTCCTTGTATTAGG - Intergenic
1141240422 16:82260437-82260459 CTGGGGTTTCACCATTGATGTGG + Intergenic
1141426891 16:83949892-83949914 CTGGGGCTGCACCCTGCATGAGG - Intronic
1141493598 16:84391397-84391419 TTAGGGCTTCAACATGTTTTTGG - Intronic
1142072149 16:88097009-88097031 GTGGGGATGCACCATGGATTTGG + Intronic
1146387674 17:32391865-32391887 GTGGGGTTTCACCATGTTGTTGG - Intergenic
1147348978 17:39825095-39825117 CTGAGGCTTCCCCATCCATTTGG + Intronic
1148150123 17:45391945-45391967 TGGGGGCATCACCATGTATAGGG + Intergenic
1155583537 18:27339166-27339188 CTGGGTCTTCACCTTCTAATGGG + Intergenic
1161053529 19:2178266-2178288 ATGGCGTTTCACCATGTCTTTGG + Intronic
1161708583 19:5834335-5834357 CTGGGGGTTCCCCATGTCTCTGG - Intronic
1166181916 19:41114653-41114675 CTGGTGCTTCACCAAGTAGGTGG + Intronic
1168036406 19:53723065-53723087 ATGGGGCTTCAGTGTGTATTGGG + Intergenic
925141671 2:1554658-1554680 ATGCGGCTTGACCATGTAATGGG - Intergenic
925742616 2:7019201-7019223 ATCTGGCTTCCCCATGTATTTGG + Intronic
926268457 2:11345979-11346001 CTGGGGCTTCACCCTATCTTCGG - Intronic
928130444 2:28645225-28645247 CTGTGGCTTCCTCAGGTATTTGG - Intergenic
928298070 2:30102574-30102596 CTGGGGCTTCAACATGTAAATGG + Intergenic
928329159 2:30344420-30344442 CTGAGAATTCACCATTTATTGGG + Intergenic
930133642 2:47878789-47878811 ATGGGGTTTCACCATGTTGTTGG - Intronic
930904473 2:56549636-56549658 GTAGGGCTTCAACATGAATTTGG - Intergenic
931976965 2:67653795-67653817 CTGGGTCTTCAGCAGGTCTTGGG - Intergenic
935637815 2:105263378-105263400 CTGGGGCTTCACCAACCATGAGG - Intergenic
936436748 2:112514190-112514212 ATGGGGTTTCAGCATGTATCAGG - Intronic
938055747 2:128213461-128213483 TTGGGGCTTCAACATATATAGGG - Intergenic
938724520 2:134095703-134095725 CTGTGGCTTCTCCATTTATTTGG - Intergenic
943677724 2:190732635-190732657 ATGGGGCTTCACCACGTTGTTGG - Intergenic
946229054 2:218280392-218280414 CTGGGGGGTCACGATGTAGTGGG + Intronic
946577090 2:221087377-221087399 CTGAGGCTTCCCCAGCTATTTGG - Intergenic
947034590 2:225837827-225837849 CTGGGTCTTCAACAACTATTAGG + Intergenic
1170328309 20:15180195-15180217 TTGGGGCTTCAACATGAATTTGG + Intronic
1173894928 20:46543516-46543538 ATGGGGTTTCACCATGTTGTTGG + Intronic
1176054936 20:63140218-63140240 CTGGGGCTTCACCTTGTGTGTGG + Intergenic
1176189579 20:63802042-63802064 TTAGGGCTTCAACATGAATTTGG - Intronic
1178785806 21:35652156-35652178 CTGGGGCTTCACCATGTATTAGG - Intronic
1180997984 22:19974938-19974960 CTGGGGCTTCAGCCTGGCTTGGG + Intronic
1181032797 22:20156391-20156413 CTGGGGCTTCCCCATGTCAGAGG + Intergenic
1181758214 22:25040108-25040130 CTGGGTCTCCACCCTGTAGTGGG - Exonic
1182465451 22:30513335-30513357 CTAGGACTTCAACATGAATTTGG - Intergenic
1183397684 22:37581828-37581850 CTGGGGTTTTACCATGCCTTTGG - Intronic
950795202 3:15504923-15504945 CTGGGGCTTCAACATGAATTTGG + Intronic
954013300 3:47662884-47662906 ATGGGGTTTCACCATGTTATTGG - Intronic
954152684 3:48665490-48665512 ATGGGGCTTCACCATGTGATGGG + Intergenic
955546921 3:60040920-60040942 CTGGGGCCTCAAGATTTATTAGG + Intronic
961716043 3:128858150-128858172 TTGGGGCTTCTCCATGTAGGAGG + Intergenic
966795357 3:183708349-183708371 ATGGGGTTTCACCATGTTGTTGG + Intronic
966932743 3:184686431-184686453 CTGGGGCTTCTCCCTGTGTCTGG + Intergenic
967731653 3:192912481-192912503 ATGGGGTTTCACCATGTTGTTGG - Intronic
968384199 4:122049-122071 ATGGGGTTTCACCATGTTGTTGG - Intergenic
971535695 4:27747889-27747911 ATGGGTCTTCACCATGTTCTAGG + Intergenic
972590857 4:40485538-40485560 CTGCTCCATCACCATGTATTTGG - Intronic
975571820 4:75825710-75825732 CTCGAGTTTCACCATTTATTTGG - Intergenic
975727796 4:77308852-77308874 GTGGGACCTCACCATGTATGAGG - Intronic
976367902 4:84250745-84250767 CTGGGTCTACACCCTGTAATGGG - Intergenic
979092125 4:116497468-116497490 CTAGGACTTCAGCATATATTGGG - Intergenic
980806018 4:137814471-137814493 CTGTAGTTTCAGCATGTATTAGG - Intergenic
989785848 5:45328489-45328511 GTGGGGCTTCAACATTTATTTGG + Intronic
990160387 5:52932420-52932442 CTGGGTCTTCAACTTGCATTCGG - Intronic
992907973 5:81365942-81365964 CTGGGGTTTCACCCTGTATATGG - Intronic
995301653 5:110591557-110591579 CTGGGCCTTTACCATGCACTAGG + Intronic
1000524858 5:162344896-162344918 TTAGGGCTTCAACATGAATTTGG + Intergenic
1000582937 5:163056110-163056132 CTTCGGCTTAACCATTTATTAGG + Intergenic
1001102840 5:168828378-168828400 CTGTGGCCTCACAATGTACTGGG - Intronic
1004503615 6:16229995-16230017 TTGGGGCTTCTCCATGTAGGAGG + Intergenic
1005396448 6:25386939-25386961 ATGGGGTTTCACCATGTTGTTGG - Intronic
1006760296 6:36454832-36454854 TTGGGGTTTCACCATGTTGTTGG + Intronic
1007582923 6:42969873-42969895 TTGGGGCCTCACCATGTACAAGG + Exonic
1009422924 6:63483557-63483579 ATGGGGTTTCACCATGTGCTGGG + Intergenic
1013173330 6:107657131-107657153 CTGGGGCTTTACCATGCAGTTGG + Intronic
1016007831 6:139107317-139107339 CTAGAGCTTCAACATGTTTTCGG + Intergenic
1017634987 6:156435042-156435064 CTGGGCCTCTTCCATGTATTTGG + Intergenic
1019418027 7:936080-936102 CTGTGGCTTCACCCTGCATGTGG + Intronic
1019586141 7:1804902-1804924 CTGGGGCTGCACCGTGGATTTGG - Intergenic
1020936652 7:14473612-14473634 CTGGGGCTTCTCCAGGTACATGG - Intronic
1021180881 7:17504398-17504420 ATGGGGTTTCACCATGTTGTTGG + Intergenic
1021976792 7:26019033-26019055 CTGGGTCTTCCTCCTGTATTAGG + Intergenic
1027594392 7:80154545-80154567 CTGGGGCTTCAGTTTTTATTTGG + Intronic
1028301911 7:89210500-89210522 CTGGGGCTTCTCCAGGGGTTGGG - Intronic
1028603099 7:92624242-92624264 GTTGGGCTTCAACATGAATTTGG - Intronic
1030869249 7:114734923-114734945 CTGGGGTAACAGCATGTATTTGG - Intergenic
1031300898 7:120060002-120060024 CTGGGGCTTCTCCATGTAGGAGG + Intergenic
1032326645 7:130935335-130935357 CTGGTGCTTGACCAAGTATCTGG + Intergenic
1032782574 7:135175986-135176008 CTGGGGCTTCTCCGTGTAGGAGG - Intergenic
1033109830 7:138564103-138564125 CTGGGTCTTCTCCATGTAGGAGG + Intronic
1033548075 7:142420739-142420761 CTGTGGCTTCACAATGCAGTGGG + Intergenic
1034720140 7:153284793-153284815 CTGGGGCTTCACCAGATCATTGG + Intergenic
1035818614 8:2567112-2567134 CTGAGGCTTCACCATGTGACCGG - Intergenic
1036007376 8:4681616-4681638 CTGTGGCTTCACTATGTGCTTGG + Intronic
1037766659 8:21776298-21776320 CTGGGGCTGCCCCATTTCTTGGG - Intronic
1038584905 8:28779623-28779645 GTGAGGCGTCACCCTGTATTGGG - Intronic
1041072570 8:54139470-54139492 CTGAGGCTTAATCTTGTATTTGG - Intronic
1044749302 8:95400894-95400916 CTGGGGCCACAGCATATATTAGG - Intergenic
1045344510 8:101282299-101282321 TGGGGGCTTCAACATATATTAGG - Intergenic
1045803206 8:106125430-106125452 CAGAGGCTTCCCAATGTATTTGG - Intergenic
1048852281 8:138656600-138656622 CTGAGCCTTCACCCTGTCTTGGG - Intronic
1052849652 9:33369254-33369276 ACGGGGTTTCACCATGTGTTAGG + Intronic
1055689998 9:78819703-78819725 CTGTGGCTTCATCTTGTCTTAGG + Intergenic
1057925636 9:99145546-99145568 CTGAGGATCTACCATGTATTAGG - Intronic
1059209803 9:112502973-112502995 ATGGGTATTCACCATGTGTTAGG + Intronic
1060791189 9:126486765-126486787 CTGGGTCTCCACCTTGTCTTTGG - Intronic
1188522288 X:31052227-31052249 CTGGGGCTCGATCATGTTTTTGG + Intergenic
1193853813 X:86573406-86573428 CTGGGGCTCTCCCATGCATTAGG + Intronic
1194006160 X:88495573-88495595 TTGGGTCTTCAGCATGAATTTGG + Intergenic
1195668046 X:107448525-107448547 CCGGAAATTCACCATGTATTTGG + Intergenic
1196099164 X:111829965-111829987 CTGTGGCTTCACCAGGTACATGG - Intronic
1196733210 X:118962253-118962275 CAGGGGGATCACCATCTATTTGG + Intergenic
1198777404 X:140194904-140194926 TGGGGGCAACACCATGTATTAGG + Intergenic
1198866602 X:141129811-141129833 CTGGGCCTTAACCATGCATTAGG + Intergenic
1199033857 X:143029925-143029947 CTGGGGCGTCGCCGTATATTTGG + Intronic
1200424232 Y:3004426-3004448 TTGGGGCTTCTCCATGTAGGAGG - Intergenic
1201858932 Y:18573955-18573977 CTGGGGCTTCTCCATGTAGGAGG + Intronic
1201874390 Y:18746426-18746448 CTGGGGCTTCTCCATGTAGGAGG - Intronic