ID: 1178787959

View in Genome Browser
Species Human (GRCh38)
Location 21:35671947-35671969
Sequence ATGTACTTATAGGTACTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 110}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178787953_1178787959 5 Left 1178787953 21:35671919-35671941 CCTATAGGTACCATCAACCTATA 0: 1
1: 0
2: 1
3: 3
4: 66
Right 1178787959 21:35671947-35671969 ATGTACTTATAGGTACTACAGGG 0: 1
1: 0
2: 1
3: 8
4: 110
1178787955_1178787959 -5 Left 1178787955 21:35671929-35671951 CCATCAACCTATAGGTACATGTA 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1178787959 21:35671947-35671969 ATGTACTTATAGGTACTACAGGG 0: 1
1: 0
2: 1
3: 8
4: 110
1178787952_1178787959 16 Left 1178787952 21:35671908-35671930 CCATTCTTCAACCTATAGGTACC 0: 1
1: 0
2: 0
3: 14
4: 88
Right 1178787959 21:35671947-35671969 ATGTACTTATAGGTACTACAGGG 0: 1
1: 0
2: 1
3: 8
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178787959 Original CRISPR ATGTACTTATAGGTACTACA GGG Intronic
901165205 1:7215917-7215939 ATCTACTAATAGGTAATTCAAGG + Intronic
903896752 1:26611418-26611440 ATATACTTATTTATACTACATGG - Intergenic
906464625 1:46065779-46065801 ATGTGTATATAGGCACTACAGGG - Intronic
909652013 1:77986266-77986288 ATGTAGTAATATTTACTACATGG - Intronic
917951058 1:180037198-180037220 ATTTATTTATAGGTGCTATATGG - Intronic
919215794 1:194552540-194552562 ATGTACTTTTACGTACTGGAAGG + Intergenic
921442970 1:215210710-215210732 ATGTACTAATAATCACTACAGGG + Intronic
1063356825 10:5408473-5408495 GTGTACTTATAGGCACAATAGGG - Intergenic
1065201672 10:23318352-23318374 ATCTACATGTAGGTACTACTGGG - Exonic
1069137349 10:64782506-64782528 ATGTACATAGATGTCCTACAGGG - Intergenic
1069168365 10:65192983-65193005 ATGCAATAATAGTTACTACAGGG + Intergenic
1069267754 10:66484048-66484070 ATATACTTATAGCAACCACAAGG - Intronic
1069812034 10:71168583-71168605 AGGTACTTATGGGAACTTCAAGG - Intergenic
1070427018 10:76298684-76298706 ATGTAGTTAAAGGAACAACATGG + Intronic
1070839857 10:79477188-79477210 ATTTACTTTCTGGTACTACAAGG - Intergenic
1077634814 11:3835204-3835226 ATTTACTGACAGCTACTACATGG - Intronic
1079565490 11:21877053-21877075 ATATAGCTATTGGTACTACAGGG - Intergenic
1079680087 11:23285172-23285194 ATGTACTTATAGCAAATACATGG - Intergenic
1080121455 11:28682699-28682721 ATGTCCTGATAGAAACTACAAGG + Intergenic
1082168606 11:48973988-48974010 ATATTCATATAGGTATTACAGGG + Intergenic
1082234835 11:49811986-49812008 ATATTCATATAGGTATTACAGGG - Intergenic
1083240969 11:61388280-61388302 ATGTTCTTATATATAGTACAGGG + Intergenic
1086360768 11:86056851-86056873 AAGTACTGATATGTGCTACAAGG + Intronic
1089138043 11:116265155-116265177 ATGTTTTTCTAGGTACTTCAAGG - Intergenic
1090326579 11:125891799-125891821 ATGTACTTTTTAGTACTACAGGG + Intronic
1091574348 12:1719461-1719483 ATGTTCATATAGTTACTAAATGG - Intronic
1092577783 12:9808011-9808033 TTGTATTTATAGGAACTAAAAGG + Intergenic
1094413252 12:30190479-30190501 ATGTACTTATATGTTCATCATGG - Intergenic
1098044327 12:66384449-66384471 GTGTACTAAAAGGTACTGCAAGG + Intronic
1098123431 12:67266473-67266495 ATCTGCTGATAGGTACTTCATGG - Intergenic
1105564175 13:21527000-21527022 ATTTACTTATAGTTAAAACATGG - Intronic
1106738238 13:32610209-32610231 AGGTACGTATAGGTAATACTTGG + Intronic
1110487334 13:76061882-76061904 ATGTTCTTATAGGTTCTTCCAGG + Intergenic
1110781694 13:79473517-79473539 AAGAACTTACAGGGACTACAGGG + Intergenic
1110965607 13:81690893-81690915 ATGTACTTAGCTGTACTATAAGG + Intergenic
1112763037 13:102711954-102711976 ATGTAGCTATAAGTACTAGAAGG + Intergenic
1116051531 14:39809551-39809573 AAGTACTGATATGTGCTACAAGG + Intergenic
1118618287 14:67591167-67591189 AAATACTGATAGGTAATACAAGG + Intronic
1119155559 14:72406779-72406801 ATGTATTTATAGGTACCAGTAGG + Intronic
1119999965 14:79291674-79291696 ATATACTTATAGGTAATATAAGG - Intronic
1124385973 15:29208268-29208290 ATCTACTTATAGGTAGGACAGGG - Intronic
1125981886 15:44009743-44009765 GTGTACTTCTAGGTACTAAGAGG + Intronic
1127886817 15:63208830-63208852 TTCTACTTATAGGAACAACATGG - Intronic
1131986687 15:98049226-98049248 ATGTAATTAAAGTTCCTACAAGG - Intergenic
1135787610 16:25364379-25364401 ATGTTCTTATAGGTTCCAGAGGG + Intergenic
1143258713 17:5583008-5583030 ATGTTCTTATAGATACTGCTAGG + Intronic
1149446105 17:56714509-56714531 CTGTACTTGTAGGTGCTCCAAGG - Intergenic
1151026296 17:70681128-70681150 AGGTACTTATAGCTACTGAAAGG + Intergenic
1164900514 19:31917278-31917300 ATGTATTGATAGAGACTACAAGG - Intergenic
929989780 2:46777032-46777054 ATCTAATTTTAGGTTCTACAAGG - Intergenic
931044212 2:58331952-58331974 ATGTACATATAAATACTACTTGG + Intergenic
933184244 2:79260932-79260954 ATGTCCTTATAGGCATTACAAGG - Intronic
936031082 2:109071042-109071064 ATTTATTTATAGCTACTACAAGG + Intergenic
939393660 2:141601338-141601360 TGGTACTTATAGGTACAGCATGG - Intronic
941230553 2:162906759-162906781 ATCTGCTTATAGATACTAAATGG + Intergenic
941941383 2:171042040-171042062 ATGAAGTGATGGGTACTACATGG - Intronic
943771100 2:191718025-191718047 TTGTACTGATAGGTATGACATGG + Intergenic
1170645102 20:18190859-18190881 TTGTAGTGATAGGTACAACAAGG + Intergenic
1171304155 20:24090511-24090533 ATTTACTTTCTGGTACTACAAGG + Intergenic
1178545399 21:33489510-33489532 ATGAATTTATAAGTACAACAAGG + Intronic
1178787959 21:35671947-35671969 ATGTACTTATAGGTACTACAGGG + Intronic
949137936 3:593556-593578 TTGTAGTTATAGGTACTAATTGG + Intergenic
949217545 3:1587822-1587844 TTGTACTTATAGGTACAACAGGG - Intergenic
950973390 3:17213259-17213281 GTGTACTTATACAAACTACATGG - Intronic
953136213 3:40183991-40184013 TTCTACTAATAGGTACTAAAAGG - Intronic
953290587 3:41657322-41657344 ATGTTCTAATAGTTATTACATGG + Intronic
957103284 3:75854213-75854235 ATGTACATATAAATTCTACATGG + Intergenic
957873773 3:86118441-86118463 ATGTAATTATAGATACTTTATGG + Intergenic
959547852 3:107618645-107618667 ACGTACTTATAGATAATCCATGG - Intronic
960210839 3:114963973-114963995 ATGGACTTAAAGAAACTACATGG - Intronic
962953980 3:140247433-140247455 ATGTACTTCTGGGCACTATAAGG - Intronic
965942488 3:174201457-174201479 ATTTACTTAGAGGTACTGCTGGG + Intronic
968532632 4:1101963-1101985 ATATACTTCTAGGTAACACATGG + Intronic
975797304 4:78020978-78021000 ATGTATTTATTGGTAAAACAGGG + Intergenic
978850178 4:113326106-113326128 ACGTACTTTTATGTACCACAGGG - Intronic
979653747 4:123167160-123167182 ATATACTTATATATACTATAAGG - Intronic
980611157 4:135165507-135165529 AGCTACTTATCTGTACTACACGG - Intergenic
981894203 4:149778015-149778037 ATGTACTTCTAGGTAATCTATGG + Intergenic
987302898 5:16612386-16612408 ATGTGCTTACAAGTACAACATGG + Intronic
989654703 5:43733951-43733973 TTGTATTTATAGGTAGAACATGG + Intergenic
989774343 5:45184779-45184801 ATGTCCTTATAAGTACTGCTTGG + Intergenic
991988623 5:72316050-72316072 AAGTACTGATACATACTACATGG + Intronic
992988725 5:82260967-82260989 ATGTACCTATAGAAAATACATGG - Intronic
993821939 5:92630988-92631010 ATGTATTTATGGGTACAACATGG + Intergenic
993928617 5:93905722-93905744 ATGGATTTTTAGGTACTACTAGG - Intronic
994183904 5:96797991-96798013 AAGCTCTTTTAGGTACTACAGGG - Intronic
996267006 5:121553518-121553540 ATGTACTTCTAAGTATTCCACGG + Intergenic
997760133 5:136438436-136438458 GTGTGCTTGTTGGTACTACAAGG + Intergenic
1008417767 6:51263277-51263299 ATGGATTTATAGGAAATACAAGG - Intergenic
1011887639 6:92117247-92117269 ATGTAGCTATATGTACCACAGGG + Intergenic
1015106510 6:129542873-129542895 ATTTACAGATAGGTACTAGAAGG - Intergenic
1015307522 6:131726351-131726373 AGGTTGTTATAGGTGCTACACGG + Intronic
1015720053 6:136231916-136231938 ATGGGATTATAGGCACTACAGGG + Intronic
1016428390 6:143957826-143957848 ATGTAGTTATCTGTACTTCAAGG - Intronic
1020666636 7:11052175-11052197 CTGTACTTATAAATAATACATGG + Intronic
1021006322 7:15398416-15398438 AGGTACTCATAGGCACTACCAGG - Intronic
1021301024 7:18973418-18973440 ATGTACTTATAGATGGTATATGG + Intronic
1022930309 7:35104971-35104993 ATGTAGTTAAATGTAATACAAGG - Intergenic
1029826198 7:103197518-103197540 ATGTAGTTAAATGTAATACAAGG - Intergenic
1030815596 7:114032890-114032912 ATGTACTTCCAGGTACTTCCAGG + Intronic
1033247344 7:139728850-139728872 ATGAACTTATAGGTCCTTTAAGG - Intronic
1033816212 7:145076545-145076567 CGGTATATATAGGTACTACATGG + Intergenic
1034011905 7:147537881-147537903 ATGCATTTTTAGGTACTATAAGG - Intronic
1044711796 8:95065455-95065477 ATGTACTTATATGTATGCCAAGG - Intronic
1044928206 8:97227079-97227101 ATGTACTCATCTGTACTTCATGG - Intergenic
1045852602 8:106720693-106720715 GTGTACTCAGAGATACTACAAGG + Intronic
1045962637 8:107986680-107986702 ATGTACTTATATGGACAATAGGG - Intronic
1046260544 8:111761777-111761799 ATGTACTTCTAAGTAGCACATGG + Intergenic
1048441664 8:134463749-134463771 ATGTGCTTATTGATACTCCAGGG - Intergenic
1050000623 9:1073634-1073656 ATGTCCTTATATGTAAAACAAGG - Intergenic
1050403135 9:5278219-5278241 ATATACTTCTAAGTAATACATGG + Intergenic
1051033039 9:12706192-12706214 ATGCACTTCTGGGAACTACATGG + Intronic
1052248343 9:26366117-26366139 ATTAACTTATAGGTACAAAAAGG - Intergenic
1052587339 9:30446298-30446320 ATGAAATTATATGTAGTACAAGG - Intergenic
1052912183 9:33893375-33893397 AAGTACTGATACATACTACAAGG - Intronic
1055097441 9:72427917-72427939 ATATTGTTATAGGTACTTCATGG - Intergenic
1057636200 9:96770239-96770261 ATGTACTGATACGTACAACATGG + Intronic
1060169264 9:121447542-121447564 ATCTGCTAATAGGTACTTCATGG - Intergenic
1186648010 X:11527895-11527917 ATCTACTTATAAATACCACATGG + Intronic
1188283712 X:28302286-28302308 ATTTACTTATAAGTAGTAGAAGG - Intergenic