ID: 1178788011

View in Genome Browser
Species Human (GRCh38)
Location 21:35672464-35672486
Sequence CTGTAGTTATACTGGCAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 126}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178788011_1178788018 30 Left 1178788011 21:35672464-35672486 CCATTTTGCCAGTATAACTACAG 0: 1
1: 0
2: 1
3: 10
4: 126
Right 1178788018 21:35672517-35672539 ACCATGCTGCAACCTACCCATGG 0: 1
1: 0
2: 0
3: 4
4: 109
1178788011_1178788013 -10 Left 1178788011 21:35672464-35672486 CCATTTTGCCAGTATAACTACAG 0: 1
1: 0
2: 1
3: 10
4: 126
Right 1178788013 21:35672477-35672499 ATAACTACAGAGATCCCTGCTGG 0: 1
1: 0
2: 0
3: 15
4: 131
1178788011_1178788014 -1 Left 1178788011 21:35672464-35672486 CCATTTTGCCAGTATAACTACAG 0: 1
1: 0
2: 1
3: 10
4: 126
Right 1178788014 21:35672486-35672508 GAGATCCCTGCTGGCCTTGCAGG 0: 1
1: 0
2: 0
3: 21
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178788011 Original CRISPR CTGTAGTTATACTGGCAAAA TGG (reversed) Intronic
906924238 1:50097335-50097357 CTGTAATAATGCTGGCTAAAGGG - Intronic
908166031 1:61459750-61459772 CTGTAGTTACAGTGGCATAAAGG + Intronic
908621560 1:65986942-65986964 ATGCAGATATACTGGGAAAAAGG + Intronic
909112416 1:71495785-71495807 TGGTAGTGATACTGGCAAGAAGG + Intronic
916657006 1:166885199-166885221 TTGTGGTTATTGTGGCAAAATGG - Intergenic
920601617 1:207330418-207330440 TTTTAGTTATACTGTAAAAAGGG - Intronic
922779790 1:228242818-228242840 CTTAAGTAACACTGGCAAAATGG - Intronic
923570576 1:235109898-235109920 TTGTAGTGATGCTGGCCAAATGG - Exonic
1070208937 10:74294665-74294687 GTTTAGTTATACTGGTAAACTGG + Intronic
1071961788 10:90814340-90814362 CTGTGGTTATAGGGGCTAAAGGG + Intronic
1072392884 10:95006866-95006888 CTGTGTTTATACAGGCATAATGG - Intergenic
1072684825 10:97529939-97529961 CTGGAGTTAGCCAGGCAAAAGGG - Intronic
1074767941 10:116714356-116714378 TGGTGGTTTTACTGGCAAAAGGG - Intronic
1077004506 11:346614-346636 CTGCAGTATTACTGCCAAAAAGG - Intergenic
1078939926 11:15991204-15991226 CTGTGGGTATCGTGGCAAAAAGG - Intronic
1080047476 11:27824184-27824206 CTGTAGTTAAACATGCAACATGG + Intergenic
1080992314 11:37552396-37552418 CTGTGGTAATACTGCAAAAAAGG - Intergenic
1082181716 11:49127970-49127992 CTGTAGTTGTATGGGCAAAAGGG - Intergenic
1083126265 11:60569111-60569133 GTGTAGTTATACTTGTAATATGG - Intergenic
1085545777 11:77316870-77316892 TTGTAGTGATGCTGGCCAAATGG + Intergenic
1085907169 11:80777466-80777488 CTGTGGTTGTAGTGGGAAAATGG - Intergenic
1085942857 11:81226276-81226298 CTGTAGTAATAATGCCATAATGG + Intergenic
1086683783 11:89706890-89706912 CTGTGGTTGTATGGGCAAAAGGG + Intergenic
1088775044 11:113074531-113074553 CTGTATTTATGCTGCCAATATGG + Intronic
1089252667 11:117176319-117176341 TTGTAGTTATGCTGGGCAAATGG - Intronic
1093567793 12:20629092-20629114 CTGCAGTTAAAATGGAAAAAAGG - Intronic
1094770717 12:33655394-33655416 CTGTGATTATTCTGGCATAATGG - Intergenic
1096310856 12:50519215-50519237 CAGTAGTTATACTGGTATGAAGG - Intronic
1097646763 12:62244501-62244523 CATTATTTATTCTGGCAAAATGG - Intronic
1098381412 12:69873619-69873641 GTGTGGATATACTGGAAAAAGGG + Intronic
1098514425 12:71357905-71357927 CTGTAGTTCCACTTCCAAAATGG - Intronic
1098555891 12:71818300-71818322 CTGTGGAGATACTGGCCAAAGGG + Intergenic
1098661944 12:73105899-73105921 CTGTATTTACAATGGCAAAGAGG - Intergenic
1099778791 12:87167296-87167318 CAGTAGTTCTACTGGGGAAATGG - Intergenic
1101169466 12:102075039-102075061 CACTGGTTATCCTGGCAAAATGG - Exonic
1103020762 12:117532055-117532077 CTGTAATCATTCTGCCAAAAGGG - Intronic
1105969176 13:25412656-25412678 ATCTAGTTATAATGGTAAAAAGG + Intronic
1106711817 13:32344219-32344241 CTCTAGGTTTACTGGCAATAAGG - Intronic
1108782976 13:53859024-53859046 CTTTAAGTACACTGGCAAAAAGG - Intergenic
1114948942 14:27722587-27722609 TTGTGGTTATACAGGCAGAATGG - Intergenic
1115261463 14:31458583-31458605 CAGTAGTTATAATGACATAAAGG - Intergenic
1118375401 14:65172576-65172598 CTGTGGTTTTCCTGCCAAAAAGG + Intergenic
1118804412 14:69222802-69222824 TTGTAGTTTTACTAGCAACATGG + Intronic
1123830776 15:24134735-24134757 CTCTAGGTAAACTGGTAAAATGG - Intergenic
1123835858 15:24192100-24192122 CTCTAGGTAAACTGGTAAAATGG - Intergenic
1126115467 15:45203592-45203614 CTCTAGGTACACTGACAAAATGG + Intergenic
1126270527 15:46812173-46812195 CTCTAGTTATACATGCAACAAGG + Intergenic
1127818468 15:62633733-62633755 CTGTATTTAGCCTGGCTAAATGG + Intronic
1130675935 15:85952047-85952069 TTGTAGTTCTACTTGGAAAAGGG - Intergenic
1133574990 16:7080387-7080409 CTGTCTTTATCCTGGCAGAACGG + Intronic
1144527714 17:16004624-16004646 CTCTATTTATACCAGCAAAATGG - Intronic
1148385601 17:47232467-47232489 CTGTGGTTATGTTGGCAAAGAGG + Intergenic
1149524043 17:57340320-57340342 CTTTGGCTGTACTGGCAAAAGGG - Intronic
1150109577 17:62486591-62486613 CTGTACTTAAACTGTCAAAAGGG - Intronic
1156601134 18:38608489-38608511 CTGTAGATATTTTGCCAAAAAGG - Intergenic
1157434103 18:47654009-47654031 CAGAAGAAATACTGGCAAAATGG + Intergenic
925771248 2:7285027-7285049 CTGAACTTATTCTGACAAAAGGG + Intergenic
933674118 2:85038328-85038350 CTTTATTTATATTGGCAAAATGG + Intronic
934106480 2:88699609-88699631 CGGTAGTTATACTGCTAATAAGG - Intronic
934611481 2:95740226-95740248 CTGTAATTATACTCTCTAAAGGG + Intergenic
936244246 2:110812915-110812937 CTGTGGTTACACTGGCAGGAGGG + Intronic
937315010 2:120926537-120926559 AAGTAGTTATACTGGGAAAAGGG - Intronic
939057788 2:137384355-137384377 CTGAAGTTATAATGGCAGACAGG - Intronic
940430009 2:153578685-153578707 CTGCAATTCTACAGGCAAAATGG - Intergenic
940962474 2:159800637-159800659 CTGTAGTTAGGAGGGCAAAAGGG - Intronic
941511758 2:166419334-166419356 CTGTATTTATACTGGAAATGTGG + Intronic
942346713 2:175010627-175010649 CTTTTGATATACTGTCAAAATGG + Intergenic
942946035 2:181674780-181674802 ATGAAGTTGTATTGGCAAAATGG + Intronic
1170501523 20:16979423-16979445 CTATAGTTATACAGGGTAAAAGG - Intergenic
1172881442 20:38202453-38202475 ATGTAGTTATACTGAGAAAAGGG - Intergenic
1174750104 20:53103628-53103650 CTGAAATTATAGTGGCAGAATGG - Intronic
1174922099 20:54714843-54714865 CTGTATTTTTACTTGCAAAATGG - Intergenic
1177897286 21:26868833-26868855 TTCTTGTTATACTGGTAAAATGG + Intergenic
1178704325 21:34860981-34861003 CTTTAGTTATAAAGGCACAATGG - Intronic
1178788011 21:35672464-35672486 CTGTAGTTATACTGGCAAAATGG - Intronic
1183044137 22:35206290-35206312 CTTTTGATTTACTGGCAAAAGGG - Intergenic
1183424187 22:37729600-37729622 CTGAAATTATCCTGGAAAAAAGG - Intronic
951088202 3:18539559-18539581 CTGTAGTAACACTGGAAGAAGGG - Intergenic
952609838 3:35195065-35195087 CTGGAGTTATGTTAGCAAAAAGG + Intergenic
955919889 3:63944475-63944497 GTGTAGATATACTGGACAAAGGG + Intronic
957500177 3:81045634-81045656 CTGAAATTTTACTGGCAAGAGGG + Intergenic
960655012 3:119993820-119993842 CTCTAGTTCTACTGGCTAAGGGG + Intronic
961127465 3:124433119-124433141 CTCTAGTAACACTGTCAAAATGG - Intronic
963105330 3:141642258-141642280 ATGTGTTCATACTGGCAAAATGG - Intergenic
972927006 4:44021743-44021765 CTGTAGCAAAACTGGTAAAAGGG - Intergenic
972945185 4:44244980-44245002 GTGCAGTTGTAGTGGCAAAAGGG - Intronic
974112325 4:57539511-57539533 TTATAGTTTTACTTGCAAAAGGG + Intergenic
976605325 4:86977271-86977293 GTGTAGATATACTGGACAAAGGG + Intronic
978333971 4:107646270-107646292 CTGTAGTTCTAGTGGTCAAAAGG - Intronic
979780117 4:124640945-124640967 CTGTAGGTAAACTACCAAAATGG + Intergenic
981919603 4:150073056-150073078 CTGTACCTAGACTGGAAAAAAGG - Intergenic
982470893 4:155788692-155788714 CTTTATTTCTTCTGGCAAAATGG - Intronic
984542320 4:181055197-181055219 TTGTAGTTATACTCTCAAAGTGG - Intergenic
990520676 5:56577342-56577364 CTATATTTATAATAGCAAAAAGG + Intronic
995828459 5:116328346-116328368 CTGTCTTTATACTGGAAAAAGGG - Intronic
995992351 5:118256154-118256176 CTTTAGTTATAATGGCAAGTAGG - Intergenic
998740588 5:145196293-145196315 CTCTGTTTATTCTGGCAAAATGG - Intergenic
999182137 5:149677219-149677241 CTGTTGTTATTCTGACAATAAGG - Intergenic
1000693340 5:164349391-164349413 CTGGAGAAATACTGACAAAATGG - Intergenic
1005646505 6:27844170-27844192 CTGTAATTATACTAGAGAAAAGG + Intronic
1009711401 6:67326503-67326525 CTGGAGTTATGCTGTCACAAGGG - Intergenic
1009853147 6:69224006-69224028 ATATAGTTACACTGGAAAAATGG + Intronic
1010087404 6:71937054-71937076 CAATAGTTACACTGGCTAAAAGG - Intronic
1010984571 6:82409060-82409082 ATGTAAATATACTGGAAAAAAGG + Intergenic
1012308132 6:97685277-97685299 CTGTAGAAATACTTTCAAAAGGG + Intergenic
1013598139 6:111679567-111679589 CTGTGGTTATTCAGCCAAAAAGG - Intronic
1013667480 6:112363064-112363086 AGGTAATTATACTGGCAAACAGG + Intergenic
1016796609 6:148124712-148124734 CAGTAGTGATACTGGCAATTCGG + Intergenic
1018692118 6:166354872-166354894 CTGCAGGTAGACCGGCAAAAGGG + Intergenic
1027821583 7:83052459-83052481 CTACAGTTACACTGGTAAAAAGG + Intronic
1027935986 7:84603364-84603386 CTGTATCTATACTCTCAAAATGG - Intergenic
1031983000 7:128141434-128141456 GTGTAATGAAACTGGCAAAAAGG + Intergenic
1032038610 7:128539122-128539144 CTGTACTTAAACTGTCAAAAGGG - Intergenic
1032862337 7:135892336-135892358 TTGTATTTATTGTGGCAAAAGGG - Intergenic
1036564793 8:9929535-9929557 CTGTATCCCTACTGGCAAAAGGG + Intergenic
1039206953 8:35167031-35167053 CTGATGTGATACAGGCAAAAGGG - Intergenic
1041067436 8:54095662-54095684 CTATAGTGTTACTGTCAAAAAGG + Intronic
1041871232 8:62636995-62637017 CTGTAGTTATACATGTGAAATGG - Intronic
1042016111 8:64314110-64314132 CTCTAATTAAACTGGCCAAAAGG + Intergenic
1044878922 8:96702058-96702080 CTGAAGTTGTGCTGGCAAGATGG + Intronic
1046035781 8:108839771-108839793 CTGTAGTCACACTGGAAAACTGG - Intergenic
1048823646 8:138402079-138402101 CTGAAGTTCCACGGGCAAAAGGG + Intronic
1050779073 9:9307564-9307586 CAGTAGTTAGAATGGAAAAAAGG - Intronic
1050826504 9:9952669-9952691 GAATAGTTATCCTGGCAAAATGG - Intronic
1051111772 9:13646894-13646916 CAGTAGTTATACTGGCAAGAAGG - Intergenic
1056859831 9:90170618-90170640 CTGTGGTTATACTGACAGAATGG - Intergenic
1187089178 X:16076463-16076485 TTGTAATCATACTGACAAAATGG - Intergenic
1187747815 X:22428903-22428925 TTTTAGTTATTCAGGCAAAATGG - Intergenic
1188849628 X:35115877-35115899 GTGTAGATATGCTGGAAAAAGGG - Intergenic
1190124625 X:47692917-47692939 CTGCAGTTATAATGTAAAAACGG - Intergenic
1191946891 X:66544334-66544356 CTGTGGTGATGGTGGCAAAAGGG - Intergenic
1192245843 X:69370850-69370872 CTGTAGTCATACTGATTAAATGG - Intergenic
1192865885 X:75131878-75131900 CTGTAGCTGTAATGGCAGAAGGG - Intronic
1193431735 X:81414880-81414902 CTGAAGACACACTGGCAAAAGGG + Intergenic
1193813826 X:86082637-86082659 CTGTAGCAATATGGGCAAAAAGG - Intergenic
1195800219 X:108700585-108700607 CTGTATGTATACTGGAAAAGAGG + Intergenic
1199053576 X:143265983-143266005 CTGGAGTTATCTTGACAAAAAGG - Intergenic
1199395860 X:147336655-147336677 CATTACTTATAATGGCAAAAAGG + Intergenic