ID: 1178788631

View in Genome Browser
Species Human (GRCh38)
Location 21:35677409-35677431
Sequence ACGGGTAAACAAATGCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 87}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178788631_1178788637 12 Left 1178788631 21:35677409-35677431 CCCTGCAGCATTTGTTTACCCGT 0: 1
1: 0
2: 0
3: 6
4: 87
Right 1178788637 21:35677444-35677466 GCCTGACTATCATCTACAGCTGG 0: 1
1: 0
2: 0
3: 2
4: 63
1178788631_1178788639 13 Left 1178788631 21:35677409-35677431 CCCTGCAGCATTTGTTTACCCGT 0: 1
1: 0
2: 0
3: 6
4: 87
Right 1178788639 21:35677445-35677467 CCTGACTATCATCTACAGCTGGG 0: 1
1: 0
2: 0
3: 5
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178788631 Original CRISPR ACGGGTAAACAAATGCTGCA GGG (reversed) Intronic
905190194 1:36227850-36227872 ACAAGTAAACATATTCTGCATGG + Intronic
905220859 1:36446322-36446344 CCAGTTAAATAAATGCTGCAGGG - Intronic
906442609 1:45861930-45861952 ACTGCTGAACAAATGCTGCCTGG - Intronic
907019096 1:51047685-51047707 ACAGGAAACCAAATACTGCATGG - Intergenic
914529536 1:148509527-148509549 ACGTGTAAAAATATGCAGCAAGG - Intergenic
918645291 1:186897112-186897134 AAGGGTAAACAAATTCTTCAAGG + Intronic
919382318 1:196874466-196874488 ATGGGTAGACAAATGCAGCCAGG + Intronic
919549721 1:198969715-198969737 ACAGAAAACCAAATGCTGCATGG + Intergenic
922882296 1:228990067-228990089 ACGGGTAAACAAGTGAGGGAGGG + Intergenic
923296767 1:232602055-232602077 CCTAGTAAACAAATGCTACAAGG + Intergenic
924177433 1:241406513-241406535 AAGGGAAAACAAATACTGCTGGG - Intergenic
1065965397 10:30766464-30766486 ACAGGTAAACAAATGATCCCAGG - Intergenic
1067857952 10:49813233-49813255 ACTGATAAACAATTGCAGCAGGG - Intergenic
1069118783 10:64541699-64541721 ACAGAGAAACAAATACTGCATGG + Intergenic
1069245043 10:66193864-66193886 ACGGGCACAGAAGTGCTGCAAGG + Intronic
1069507084 10:69009424-69009446 ACTGGCAAACAAATGCTAGAAGG - Intronic
1077861248 11:6182224-6182246 ATGGCTAAAGAAATGCTGAAAGG + Intergenic
1081365620 11:42231538-42231560 ACAAGTAAACATATGCAGCAGGG - Intergenic
1082119812 11:48366728-48366750 ATGGGGAAAAAAATGCTGTAAGG - Intergenic
1088341233 11:108770260-108770282 AAGGATAAATAAATGCTTCAGGG - Intronic
1092014772 12:5149522-5149544 AAAGGGAAACAAATGCTGCCGGG + Intergenic
1093120819 12:15269010-15269032 ACAGGAAGACAAATGCTGAAAGG - Intronic
1095963497 12:47850924-47850946 ACATGTAAACAATTGCTGCAAGG - Intronic
1099941264 12:89191955-89191977 ACAGAAAAACAAATACTGCATGG + Intergenic
1101316979 12:103638209-103638231 ACAGGTGAGCAAATGATGCAGGG + Exonic
1103592000 12:121998391-121998413 ACTGGTAAACAACTTCAGCAAGG - Intronic
1106859482 13:33889802-33889824 ACAGGCAGACAAATACTGCATGG - Intronic
1107115549 13:36742173-36742195 AGGGGGAAACAAAGGCTGCAGGG - Intergenic
1108094125 13:46882385-46882407 ATGGGGAAACAAATGATGCTGGG + Intronic
1111590567 13:90342346-90342368 ACAGAAAAACAAATACTGCATGG + Intergenic
1113504154 13:110801670-110801692 ACTGAGAAACAAATGCAGCAAGG - Intergenic
1125974702 15:43940596-43940618 AGAGGTAAACAAATGCCACATGG + Intronic
1129188613 15:73925117-73925139 ATGGGTGAACAAATGCTGCCTGG + Intergenic
1134300583 16:12987071-12987093 ACAGGTAAATCAATGCTGAAGGG + Intronic
1137630917 16:49944111-49944133 ACACGTATAAAAATGCTGCATGG + Intergenic
1143982994 17:10886067-10886089 ACAGAAAAACAAATACTGCATGG - Intergenic
1153186832 18:2495401-2495423 AAGAGGAAAAAAATGCTGCAAGG - Intergenic
1156049202 18:32911652-32911674 CCAGGAATACAAATGCTGCAGGG - Intergenic
1158469089 18:57719132-57719154 ACTGGTAAACAAATTCTGTAAGG + Intronic
1158556815 18:58482114-58482136 AAGGGAAAACTAATGGTGCATGG + Intronic
1159558936 18:69974154-69974176 ACGGCTAAAGAAGTGCAGCATGG - Intergenic
1159871797 18:73766973-73766995 ACGTTTAAACAAAGGCTGAAAGG + Intergenic
1167372988 19:49095174-49095196 CCGGGTAAGCAAGTGCTCCAGGG + Intronic
926706226 2:15839667-15839689 CAGGATAAACAAATGGTGCATGG + Intergenic
930209319 2:48617961-48617983 AGGGGGAAACAAAAGGTGCAGGG - Intronic
933847844 2:86339660-86339682 ACGGGTAAAACAATGCTCCACGG + Intergenic
939276660 2:140006595-140006617 ACTGGTATAATAATGCTGCAGGG + Intergenic
943152464 2:184131946-184131968 ACAGGAAAACAAATACTACAGGG - Intergenic
943206063 2:184897460-184897482 ACAGGAAAAAAAATGCTGTATGG - Intronic
948652420 2:239456781-239456803 ACAGGTAAACAGAGGCTCCAGGG - Intergenic
1172651614 20:36506909-36506931 ACAGAAGAACAAATGCTGCATGG - Intronic
1177249999 21:18580620-18580642 CAGGGTGAACAAATACTGCAGGG - Intergenic
1178788631 21:35677409-35677431 ACGGGTAAACAAATGCTGCAGGG - Intronic
1180218810 21:46344781-46344803 AAGGGAAAAGAAAAGCTGCAGGG - Intronic
951162607 3:19443287-19443309 ATGGGTGAAAAAATGCTGAATGG + Intronic
960471131 3:118066601-118066623 ACAGGAAGATAAATGCTGCATGG + Intergenic
964659508 3:159104820-159104842 ACGGTTAAACATATTCTGAAGGG - Intronic
971223160 4:24727434-24727456 AAGGTTAAACACCTGCTGCAGGG + Intergenic
971913007 4:32821173-32821195 CCTGGGAAACAAAGGCTGCAGGG - Intergenic
974754181 4:66182502-66182524 ACAGTAAAACAAATACTGCATGG - Intergenic
980224283 4:129961070-129961092 ACAAGTAAACTAATGCTGTAGGG - Intergenic
980509881 4:133771730-133771752 CCAGGTAAACATTTGCTGCAGGG - Intergenic
981864110 4:149393938-149393960 ACCTCTAAACAAATGTTGCATGG + Intergenic
983745878 4:171199530-171199552 ACAGGAAACCAAATACTGCATGG - Intergenic
985772074 5:1817956-1817978 ACGTGTAAAGAAAAGCAGCATGG - Intergenic
989553111 5:42758714-42758736 ACTGGTAAATAAAAGATGCATGG - Intronic
993978185 5:94508645-94508667 AAAGGTAAACAATTGTTGCATGG + Intronic
994525978 5:100904756-100904778 TCGGGTATAAAAATGCTCCAAGG + Intergenic
1000836491 5:166161155-166161177 ACAGGTAAACACAGGCTCCAAGG - Intergenic
1003655810 6:8007012-8007034 AGGGGAAAACAATTGCTCCAAGG + Intronic
1006653965 6:35574442-35574464 ACGGGTAAACAGATTGAGCATGG - Exonic
1007656453 6:43454063-43454085 CCTGGAAAAGAAATGCTGCAGGG - Intronic
1009808113 6:68628574-68628596 ACTGGCAAACAAATGCTCTAAGG + Intergenic
1013548777 6:111186746-111186768 AGGGGTAAATAGATGCTACATGG - Intronic
1013612887 6:111811651-111811673 AGGGGTGAACAACTGATGCAAGG + Intronic
1020866525 7:13571019-13571041 ACTGGTAAATAAATTCAGCAAGG - Intergenic
1022811093 7:33869727-33869749 GCGGGTAGACAAATTCTACATGG + Intergenic
1031053974 7:116973878-116973900 ATAGGTAAATTAATGCTGCATGG + Intronic
1036220505 8:6917713-6917735 TCGAGTTAACAAATGCTTCAAGG - Intergenic
1036656842 8:10682326-10682348 CCTGGTAAACTAATACTGCACGG - Intronic
1039636240 8:39169008-39169030 ACTTGGAAACAAATGCTGGAAGG + Intronic
1040632196 8:49228184-49228206 ACTAATAAACAAATTCTGCAAGG + Intergenic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1045561219 8:103265548-103265570 ACTGGAAAACAAAAGCTCCATGG + Intergenic
1053370843 9:37560426-37560448 GGGGGAAAACAAATGCTGAAGGG - Intronic
1185477924 X:426026-426048 AGCTGTAAACAAATGCTGGAGGG - Intergenic
1185478514 X:429268-429290 AGCTGTAAACAAATGCTGGAGGG - Intergenic
1187229562 X:17407928-17407950 ATGGGGAAACAAATGCTCCCTGG - Intronic
1187528507 X:20075412-20075434 AAGGGGAAAAATATGCTGCATGG + Intronic
1188141757 X:26558965-26558987 ACAGGTGAACACATGCTGGAGGG - Intergenic
1192010324 X:67263197-67263219 ACAGTTAAAAAAATTCTGCATGG - Intergenic
1193333204 X:80258517-80258539 AAGGGTACACAAATGATCCATGG + Intergenic
1195313808 X:103658577-103658599 AGGGCTAAACAAATGGTGAATGG + Intergenic
1196021786 X:110998525-110998547 AAGTATAAACAAATGCTTCAAGG + Intronic