ID: 1178790459

View in Genome Browser
Species Human (GRCh38)
Location 21:35694855-35694877
Sequence TTGTAACAGCAAAAGCAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 0, 2: 1, 3: 46, 4: 322}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178790452_1178790459 25 Left 1178790452 21:35694807-35694829 CCCCAAACCAAGTTGCATGACTG 0: 1
1: 0
2: 0
3: 8
4: 106
Right 1178790459 21:35694855-35694877 TTGTAACAGCAAAAGCAGAGGGG 0: 1
1: 0
2: 1
3: 46
4: 322
1178790455_1178790459 18 Left 1178790455 21:35694814-35694836 CCAAGTTGCATGACTGACAAAGG 0: 1
1: 0
2: 2
3: 11
4: 110
Right 1178790459 21:35694855-35694877 TTGTAACAGCAAAAGCAGAGGGG 0: 1
1: 0
2: 1
3: 46
4: 322
1178790453_1178790459 24 Left 1178790453 21:35694808-35694830 CCCAAACCAAGTTGCATGACTGA 0: 1
1: 0
2: 0
3: 15
4: 149
Right 1178790459 21:35694855-35694877 TTGTAACAGCAAAAGCAGAGGGG 0: 1
1: 0
2: 1
3: 46
4: 322
1178790451_1178790459 30 Left 1178790451 21:35694802-35694824 CCAAACCCCAAACCAAGTTGCAT 0: 1
1: 0
2: 1
3: 21
4: 174
Right 1178790459 21:35694855-35694877 TTGTAACAGCAAAAGCAGAGGGG 0: 1
1: 0
2: 1
3: 46
4: 322
1178790454_1178790459 23 Left 1178790454 21:35694809-35694831 CCAAACCAAGTTGCATGACTGAC 0: 1
1: 0
2: 1
3: 3
4: 112
Right 1178790459 21:35694855-35694877 TTGTAACAGCAAAAGCAGAGGGG 0: 1
1: 0
2: 1
3: 46
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178790459 Original CRISPR TTGTAACAGCAAAAGCAGAG GGG Intronic
901000766 1:6147819-6147841 TGGTGACAGCAAAGGCCGAGAGG + Intronic
901523281 1:9802192-9802214 TTGTCACTGCAAGAGCATAGTGG - Intronic
904224354 1:29002879-29002901 TTCTAAATGCTAAAGCAGAGAGG + Intronic
904386663 1:30146992-30147014 TTGTAATAACAAAAACAGTGAGG + Intergenic
904672738 1:32178535-32178557 TTGTTACAGCATTAGCAGTGAGG - Intergenic
904992511 1:34604564-34604586 TTGTCACAGCAAAGGAAGAGAGG - Intergenic
905036931 1:34924767-34924789 CTGAAACAGCAAAAGGGGAGAGG + Intronic
906897400 1:49790698-49790720 TTATATAAGCAAAAACAGAGGGG + Intronic
907809187 1:57851597-57851619 TTGCAGGAGCAAAGGCAGAGGGG - Intronic
908081795 1:60588732-60588754 TTGCAACTTCAGAAGCAGAGAGG + Intergenic
908193921 1:61729989-61730011 TTGTAAGGGTTAAAGCAGAGGGG + Intergenic
908725470 1:67171564-67171586 TTGTAATGGTTAAAGCAGAGGGG + Intronic
909464901 1:75962293-75962315 TTGTAAGATCAAAAGCAGTTGGG + Intergenic
909958820 1:81810998-81811020 TTGTAGTAGAAAAAGCAAAGTGG - Intronic
910171479 1:84382379-84382401 TAGTAAGAGTTAAAGCAGAGGGG - Intronic
910483602 1:87685390-87685412 TTCAAACAGGAAAAGCAGAAGGG + Intergenic
910879163 1:91906723-91906745 TAATAACAGCTAAAGAAGAGAGG - Intergenic
911729297 1:101276300-101276322 TAGTAACAGCAAAAGAAGTGGGG + Intergenic
912721128 1:112020948-112020970 TTTTAACAGGAAAATGAGAGGGG - Intergenic
913219808 1:116650377-116650399 TTGTAAAAGGAAATGCAGAAGGG - Intronic
913553943 1:119945058-119945080 TTATAACAACAATAGAAGAGAGG + Intronic
916898581 1:169194496-169194518 TTGTAAAGGTTAAAGCAGAGAGG - Intronic
916935393 1:169622999-169623021 TTTTAAAAGCAAAAGAAGATTGG - Intronic
917530284 1:175829056-175829078 TTGTAAAGGTTAAAGCAGAGGGG + Intergenic
917719142 1:177769379-177769401 TGGAAAAAGAAAAAGCAGAGTGG - Intergenic
917911690 1:179654453-179654475 TTGTAATACTAAAAGCAGTGGGG - Intronic
919726293 1:200886906-200886928 TTGTAAAGGTTAAAGCAGAGGGG - Intergenic
920296473 1:204960378-204960400 CTGTTACAGCATAGGCAGAGTGG - Intronic
920960826 1:210662681-210662703 TTCTGACAGCACAAGCAGAAGGG - Intronic
922135733 1:222824421-222824443 GTGTATAAGCAAAAGCAGAAGGG - Intergenic
922556612 1:226537354-226537376 CTGTAATAGCAAAAGTGGAGGGG + Intergenic
923033669 1:230268986-230269008 AAGGAAAAGCAAAAGCAGAGTGG - Intronic
923392642 1:233529545-233529567 TTGCTCCAGCAAGAGCAGAGAGG + Intergenic
923889909 1:238202320-238202342 TTGTAAAGGCTAAAGCAGAGGGG - Intergenic
923926629 1:238635972-238635994 TAGTCAAAGCAAAAGCAGACTGG + Intergenic
1063149870 10:3326635-3326657 TTGTAACAGCAAAAAAAAACTGG - Intergenic
1063513022 10:6665162-6665184 TTGTAATAACAAAAGCATACTGG - Intergenic
1064129831 10:12699294-12699316 GAGTCACAGCAAAAGCAGACCGG - Intronic
1064240343 10:13621747-13621769 TTGTAATAGCAAAAGCTTAACGG - Intronic
1064771641 10:18729545-18729567 TTGTAAAAGTTAAAGCAGAGGGG + Intergenic
1067285238 10:44903058-44903080 TTCTCACAGCAAGAGCAGAGGGG + Intergenic
1069185430 10:65416998-65417020 GTGGAACAGCATATGCAGAGAGG - Intergenic
1070931304 10:80262770-80262792 TAGTCACAGCAAAAGCAGACAGG - Intergenic
1070941440 10:80351662-80351684 TTGTATCAGCAACAACAGTGTGG + Intronic
1070941863 10:80355725-80355747 TTGTATTAGCAACAGCAGTGGGG + Intronic
1072118883 10:92388779-92388801 TTGTTACACCACAAGCAGAGGGG + Intergenic
1072143579 10:92613046-92613068 TTGTAACAGAGAAAACTGAGTGG - Exonic
1072715438 10:97749417-97749439 TCGTAACAGCAGAAGGAGACGGG - Intronic
1072845987 10:98831055-98831077 TTGTATAAGGAAATGCAGAGGGG - Intronic
1073618037 10:105017860-105017882 TTGTATCAGCCAAAGCACAATGG + Intronic
1073676746 10:105655782-105655804 CTGCAACAGCAAAAGCAGAATGG + Intergenic
1074008590 10:109454318-109454340 GTCCAACAGCCAAAGCAGAGTGG - Intergenic
1075887854 10:125917256-125917278 TTGTAATAGTTAAAGCAGAGGGG - Intronic
1076288593 10:129326117-129326139 ATGTGACAGGAAAAGCATAGAGG - Intergenic
1079564402 11:21864585-21864607 TTGGAATAGCAGAAGAAGAGAGG - Intergenic
1080358679 11:31486232-31486254 TTGTAACTGCCAAAGTAGATAGG + Intronic
1081139604 11:39482494-39482516 TGTTAACAACAAAATCAGAGTGG + Intergenic
1081226884 11:40534885-40534907 TAGTAACAGTAAAAACAAAGAGG + Intronic
1082000516 11:47391512-47391534 GTTTGCCAGCAAAAGCAGAGTGG - Intergenic
1084553224 11:69861392-69861414 TTGTCAAAGTAAAAGCAGAAAGG - Intergenic
1084929266 11:72541390-72541412 TTGTATTAGCAAAAGCCCAGAGG - Intergenic
1085099095 11:73785465-73785487 TTGTAGGAGCAAAGGCAGGGAGG + Intergenic
1085450711 11:76630416-76630438 CAGGAACAGCAAATGCAGAGAGG - Intergenic
1086592565 11:88533447-88533469 TGGTAACAGAAAGAGTAGAGTGG - Intronic
1087330914 11:96778727-96778749 TTCTAACAGAAAAAGCAGACAGG + Intergenic
1089183267 11:116597350-116597372 TAATAACAGCACAAGCAGACAGG + Intergenic
1089588571 11:119525397-119525419 TTGTAAAGGTTAAAGCAGAGGGG + Intergenic
1090164699 11:124534829-124534851 TTTTATCACTAAAAGCAGAGAGG + Intergenic
1090200542 11:124852041-124852063 TTGTAAAGGTGAAAGCAGAGGGG - Intergenic
1090246624 11:125220735-125220757 TTCTGACTACAAAAGCAGAGGGG + Intronic
1090329630 11:125920844-125920866 TTGGCACAGCAGGAGCAGAGAGG + Intronic
1091650321 12:2304500-2304522 GTGGCACAGCAAAAGCACAGGGG - Intronic
1092586147 12:9903376-9903398 TTATAACAGCAAAAGAAGTAAGG + Intronic
1092855556 12:12670106-12670128 GGGTAACAGGAAAATCAGAGAGG + Intronic
1093312049 12:17601211-17601233 TGGTACCAGAAAAGGCAGAGAGG - Intergenic
1093351646 12:18109673-18109695 TAGCAAGAGAAAAAGCAGAGGGG + Intronic
1093509524 12:19909910-19909932 TTGTAAAAGTTAAAGCAGAGGGG - Intergenic
1093767777 12:22984558-22984580 GTGTCACAGCAAATGCAGAAAGG - Intergenic
1093899035 12:24608484-24608506 TTGTGAAAGCAAAAGAAGAAGGG - Intergenic
1095760741 12:45832641-45832663 TAGTACCAGGAAAAGAAGAGGGG - Intronic
1096320444 12:50607651-50607673 TATAATCAGCAAAAGCAGAGTGG + Intronic
1098631604 12:72729576-72729598 TTGTAAGGGTAAAAGCACAGGGG - Intergenic
1098948454 12:76614280-76614302 TTGTAACAAGAAAAGCAGCCAGG - Intergenic
1099877476 12:88427047-88427069 TTGTTGCAGCATATGCAGAGAGG - Intergenic
1100089630 12:90954375-90954397 GAGCAGCAGCAAAAGCAGAGAGG + Exonic
1100111654 12:91251372-91251394 TTGTAATAGCGAATGCAAAGTGG - Intergenic
1102172018 12:110849453-110849475 TTCTAAAAGCAGAAGGAGAGAGG + Intronic
1102591033 12:113956989-113957011 TAGTAACAACACAGGCAGAGGGG - Intronic
1102819885 12:115899045-115899067 TTAGACCAGCAAAAGGAGAGAGG + Intergenic
1104158795 12:126158945-126158967 ATGTGGCACCAAAAGCAGAGAGG - Intergenic
1104547057 12:129722116-129722138 TAGTGACAGGAAAAGCAGCGTGG - Intronic
1105626334 13:22116520-22116542 TTTACACATCAAAAGCAGAGGGG - Intergenic
1108022138 13:46138493-46138515 TGGAGACAGCAACAGCAGAGTGG + Intronic
1108479545 13:50854486-50854508 GTTTGACAGCAAAAGCAGAGAGG - Intergenic
1108522059 13:51255505-51255527 TTGTAGCAGCAAAAGCAAAATGG + Intronic
1108644201 13:52409977-52409999 TTTTAAAAGCAAAAGCTCAGTGG + Intergenic
1109122177 13:58471207-58471229 AAGGAACAGCAACAGCAGAGGGG + Intergenic
1110614238 13:77523266-77523288 TTGGAAAAGGAAAGGCAGAGAGG + Intergenic
1110969109 13:81739371-81739393 TGGGAACTGCAAAAGCATAGAGG - Intergenic
1111151714 13:84262300-84262322 TTTTAAGAGTTAAAGCAGAGAGG - Intergenic
1111161864 13:84405439-84405461 ATGTAACTGCTAAAGGAGAGGGG - Intergenic
1111323887 13:86665808-86665830 TTGGAAGGGCACAAGCAGAGGGG - Intergenic
1114510432 14:23255110-23255132 TTGTAAAGGGTAAAGCAGAGGGG - Intronic
1115389544 14:32839208-32839230 TTGTAACAGCAAAACTAGCTGGG - Intergenic
1115615800 14:35093515-35093537 TAGTAACAACAAAAGAAAAGAGG - Intronic
1116097457 14:40388936-40388958 TTTTAAAAGAAAAAGCACAGTGG - Intergenic
1119020783 14:71111068-71111090 AAGTAACAGAAAAAGAAGAGGGG - Exonic
1120039890 14:79740279-79740301 ATGGAGCAGCTAAAGCAGAGTGG - Intronic
1120188495 14:81418738-81418760 TTGTGGAAACAAAAGCAGAGAGG - Intronic
1202870293 14_GL000225v1_random:156808-156830 TTGTAATGGTTAAAGCAGAGGGG + Intergenic
1123724322 15:23087038-23087060 TTGTAATAGTAAAAGAGGAGAGG + Intergenic
1124354748 15:28986472-28986494 TTTTAAAAAGAAAAGCAGAGTGG - Intronic
1125059260 15:35399447-35399469 TTCTAAAAGCAAAGTCAGAGGGG + Intronic
1125098733 15:35885347-35885369 ATGTAACAGCATAAACAGAGGGG - Intergenic
1125835923 15:42751271-42751293 TTGTAACATCAACAGCTGAAAGG + Intronic
1127032798 15:54882278-54882300 TTGTAACAACAAAAGGAGGGAGG + Intergenic
1127341280 15:58047007-58047029 TTGCAACAGGAAAACAAGAGAGG + Intronic
1127909304 15:63402849-63402871 TTGTCACAGACAAAGCAAAGTGG - Intergenic
1128835939 15:70809306-70809328 TGGGAACAGCAACTGCAGAGAGG + Intergenic
1129093110 15:73172845-73172867 TTGTAAGGGTCAAAGCAGAGGGG + Intronic
1130541248 15:84822175-84822197 GTGCAACAACAAGAGCAGAGAGG + Intronic
1134872782 16:17666877-17666899 GTGTAACAACAGAAGGAGAGGGG - Intergenic
1137432676 16:48431189-48431211 TTGTAAAGGTTAAAGCAGAGGGG - Intronic
1138232617 16:55350057-55350079 TTCTGGCAGCAAAACCAGAGAGG - Intergenic
1139282820 16:65784804-65784826 CTGTAAAGGCAGAAGCAGAGTGG + Intergenic
1140537761 16:75726388-75726410 TTGTAAGAGAAAAAGCTGATGGG + Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1143098715 17:4492864-4492886 TGGCAACAGCAAGAGCAGAGAGG + Intergenic
1143277681 17:5723948-5723970 TTTTAAAAGCAAAAGCAGAAAGG + Intergenic
1143277682 17:5723972-5723994 TTTTAAAAGCAAAAGCAGAAAGG + Intergenic
1143844007 17:9758452-9758474 TTTTAACAGAAAAAGCAGCCGGG + Intergenic
1144336871 17:14279287-14279309 TTGAGACACCAAAAGCAGATAGG + Intergenic
1145016516 17:19402244-19402266 TTGTAAAAGTTAAAGCAGAGGGG + Intergenic
1146254937 17:31386425-31386447 TTCTGTGAGCAAAAGCAGAGAGG - Intergenic
1146623507 17:34418786-34418808 TTGCCACAGAAAAAGCAGAAAGG - Intergenic
1147754311 17:42758316-42758338 TTTTAATAGCAAAAGCAGAAAGG + Intergenic
1147838315 17:43351038-43351060 TTGTGGTAGCCAAAGCAGAGAGG + Intergenic
1148385995 17:47235561-47235583 TTGAAACAGCATAAGCACAGGGG - Intergenic
1148668326 17:49391138-49391160 TTCCAACAGCAAAAGCTGACTGG + Intronic
1149541119 17:57468897-57468919 TTATAAGAACAAAAGCAGAAGGG - Intronic
1151376299 17:73691242-73691264 TGGTCAGAGCAAAGGCAGAGAGG - Intergenic
1151843501 17:76634559-76634581 TTGGAAAAGAAAAAGCAGAATGG - Intronic
1203160163 17_GL000205v2_random:41956-41978 TTTTAATAACAAAAACAGAGGGG + Intergenic
1153010245 18:532172-532194 TTGGCACAGCAGAAGCAGCGTGG + Intergenic
1153424269 18:4945294-4945316 TTGCAACTGCAATGGCAGAGTGG - Intergenic
1154932430 18:21013745-21013767 TCTTAACAGCAAAGGCTGAGTGG - Intronic
1155579673 18:27288786-27288808 TTGGAACTGCCATAGCAGAGTGG - Intergenic
1156968023 18:43119647-43119669 TTTTACCAGATAAAGCAGAGGGG + Intergenic
1159134564 18:64321969-64321991 CTGTCATAGCAAAAGCACAGGGG - Intergenic
1159363449 18:67434905-67434927 TTGTAAGAATTAAAGCAGAGGGG - Intergenic
1159567902 18:70075657-70075679 GTGTAAGGACAAAAGCAGAGTGG - Intronic
1162108618 19:8387331-8387353 TTGTAAAGGTTAAAGCAGAGAGG - Intronic
1162698582 19:12496333-12496355 TGGTAAAAGTTAAAGCAGAGGGG - Intronic
1163888771 19:19992573-19992595 TTGTAATAACAAAAACAGAGGGG + Intergenic
1163935180 19:20436024-20436046 TTGTAATAACAAAAACAGAGGGG - Intergenic
1163949388 19:20569916-20569938 CTGTAATAACAAAAACAGAGGGG - Intronic
1163968688 19:20771987-20772009 CTGTAATAACAAAAACAGAGGGG + Intronic
1165340467 19:35208188-35208210 TAGTAAGAGCAGAATCAGAGAGG + Intergenic
1166206312 19:41271816-41271838 TTGTAAGAACTAAGGCAGAGAGG + Intronic
1166278347 19:41772000-41772022 TTGTAAAAGTTAAAGTAGAGGGG - Exonic
1168384940 19:55955274-55955296 CTGAAACAGCAAATGGAGAGAGG + Exonic
1168451524 19:56470205-56470227 TTGTAACCTCAACAGCAGTGAGG - Intronic
928627423 2:33154609-33154631 TGATAACAGCAAAAGTAGAAAGG - Intronic
930302333 2:49632370-49632392 TAGTGAAAGCAAAAGCACAGTGG + Intergenic
930344449 2:50161525-50161547 TACTAACAGCTAAAGCAGACTGG + Intronic
931719940 2:65060204-65060226 TTGTAGCAGCCAAAGCAAAGAGG + Intronic
933043991 2:77509962-77509984 CTGTAAAAGTAATAGCAGAGAGG - Intronic
933889194 2:86750843-86750865 TTTCAACAGCAGAAGCAAAGTGG - Intronic
934089072 2:88535369-88535391 TTGTAACAGAAAATGCATAATGG - Intergenic
936836840 2:116719930-116719952 CTGTAATAACAAAAGCGGAGGGG - Intergenic
936908475 2:117565396-117565418 CTGTAACATCAAAATCAGAATGG - Intergenic
937661245 2:124432112-124432134 ATGTGATAGCAAAAACAGAGGGG + Intronic
937958296 2:127436062-127436084 AAATAACATCAAAAGCAGAGAGG + Intergenic
938371216 2:130769483-130769505 TTGTAAGGGCTGAAGCAGAGGGG + Intergenic
939198749 2:139007116-139007138 CAGTAAAAGCAAAAGCAGACTGG + Intergenic
939984818 2:148819401-148819423 TAGTCAAAGCAAAAGCAGACAGG + Intergenic
941238414 2:163005584-163005606 TGGTAAAAGCAAAAGCATACCGG - Intergenic
941543524 2:166816582-166816604 TAATATCATCAAAAGCAGAGAGG - Intergenic
943477197 2:188372080-188372102 TGGTTACAGCAAACACAGAGAGG + Intronic
943662125 2:190570481-190570503 ATGTAAGAGCAAAAGCTGAAAGG - Intergenic
944351769 2:198736232-198736254 TTGTAAAATAAAAAGCAGAGTGG - Intergenic
944758599 2:202789981-202790003 TTGTAAGGGTTAAAGCAGAGGGG - Intronic
947210853 2:227707265-227707287 TTCTACCAGCAAAAGAAGAAAGG - Intronic
947453978 2:230236242-230236264 CTGTAACTGCAAAAGGAGGGTGG - Intronic
947485712 2:230546865-230546887 TTGTAGTAGGAAAAGCAAAGTGG + Intergenic
948352142 2:237349900-237349922 TTGTATCAGGAAAAACACAGGGG + Intronic
948877407 2:240837012-240837034 TGGGAGCAGCAAAAGCAGAGGGG - Intergenic
1168783282 20:513659-513681 TTGAAACAGCAGAAGAAGACTGG - Intronic
1169006141 20:2208526-2208548 TTGTAAAGGTTAAAGCAGAGAGG - Intergenic
1171377612 20:24704075-24704097 TTGTAACTGTCAAAGCAGTGAGG - Intergenic
1171504304 20:25621255-25621277 GTGTGATAGAAAAAGCAGAGAGG - Intronic
1172883538 20:38216981-38217003 TTGTAACAGGAAAAAAACAGAGG - Intronic
1173878295 20:46390820-46390842 TTGTAATAGTAAAAGAGGAGAGG - Intronic
1178030010 21:28514290-28514312 TTGTAACACAAAAAGCAGATGGG + Intergenic
1178271589 21:31194728-31194750 TTGTAAGGGTTAAAGCAGAGGGG - Intronic
1178790459 21:35694855-35694877 TTGTAACAGCAAAAGCAGAGGGG + Intronic
1180821103 22:18828421-18828443 TTGTAAAAGGAAATGCAGAAGGG - Intergenic
1181191875 22:21147624-21147646 TTGTAAAAGGAAATGCAGAAGGG + Intergenic
1181207321 22:21262886-21262908 TTGTAAAAGGAAATGCAGAAGGG - Intergenic
1182691600 22:32167845-32167867 TTGTAAGGGTTAAAGCAGAGAGG + Intergenic
1183502100 22:38186720-38186742 TTTTAAGAGGAAAAGCAAAGAGG + Intronic
1185306102 22:50117611-50117633 TTGGAACTGCCAGAGCAGAGTGG - Intronic
1203219597 22_KI270731v1_random:32530-32552 TTGTAAAAGGAAATGCAGAAGGG + Intergenic
1203271228 22_KI270734v1_random:54297-54319 TTGTAAAAGGAAATGCAGAAGGG - Intergenic
950373115 3:12547934-12547956 TTGTTACAGTGAAGGCAGAGAGG + Intronic
950786769 3:15443573-15443595 TTGTCATGGCAAAGGCAGAGAGG + Intronic
951449425 3:22819498-22819520 TTTTAATAGCCAAAACAGAGGGG - Intergenic
953094493 3:39761613-39761635 TTGTAACGGGTAAAGCAGAGCGG + Intergenic
953363936 3:42325633-42325655 TTGTAGAAGCAAAAGGAGAGAGG - Intergenic
954482673 3:50815951-50815973 TTGTAAGGGTTAAAGCAGAGAGG + Intronic
956091278 3:65669553-65669575 TAGTCAAAGCAAAAGCAGACTGG - Intronic
957288777 3:78250040-78250062 TTGTAAGGGTTAAAGCAGAGAGG + Intergenic
958613375 3:96457202-96457224 ATGTAACAGCAAAGGAAGACAGG + Intergenic
958852294 3:99343235-99343257 ATGTAGCAGAAAAAGAAGAGAGG - Intergenic
959240421 3:103784954-103784976 TTCTAACAGCAAGGGCAAAGAGG - Intergenic
961121060 3:124370549-124370571 CTGTCAAAGCAAAAGCAGACTGG - Intronic
961928967 3:130513599-130513621 TAGTCAAAGCAAAAGCAGACAGG + Intergenic
963284342 3:143418484-143418506 TTGTAACAGGAGAAGGAGATGGG + Intronic
963546672 3:146668209-146668231 TGGTAACTCCAAAAGGAGAGAGG - Intergenic
964342826 3:155726652-155726674 TTGCTACAGAAAAAGAAGAGAGG - Intronic
966225706 3:177595658-177595680 TTATAACCACAAAAACAGAGGGG - Intergenic
966577037 3:181513421-181513443 TTGCAACAACTAAAGCAGAAAGG + Intergenic
967723722 3:192842115-192842137 TTGTAAAACCAGAGGCAGAGAGG + Intronic
969910823 4:10444048-10444070 TAGGAAAACCAAAAGCAGAGTGG - Exonic
970013228 4:11483376-11483398 TTGTACCAGAAAAGGCAGAAGGG + Intergenic
970035211 4:11726083-11726105 CTGTGACAGCAAAACCAGACAGG + Intergenic
970982513 4:22117247-22117269 GTGTAACTGTAATAGCAGAGGGG + Intergenic
972597648 4:40544291-40544313 TTGTAAAAACAAAAACAAAGGGG + Intronic
972792523 4:42386852-42386874 TGGTAAGGTCAAAAGCAGAGTGG + Intergenic
973685615 4:53366594-53366616 TTGTGACAGCAAAAATGGAGAGG - Intergenic
973769586 4:54194061-54194083 TTGTAAGGGTTAAAGCAGAGGGG + Intronic
975869711 4:78766583-78766605 TTGATACAGGGAAAGCAGAGGGG + Intergenic
976701613 4:87975567-87975589 TTTTAACCACAAAACCAGAGGGG + Intergenic
976875316 4:89847569-89847591 TTATAAAAGTTAAAGCAGAGGGG + Intergenic
977753179 4:100633877-100633899 ATGTCACAGCTGAAGCAGAGAGG + Intronic
978458645 4:108925281-108925303 TGGTAACTGCTAAAGCAAAGAGG + Intronic
978502558 4:109424632-109424654 TTGTGATAGCTGAAGCAGAGAGG - Intergenic
978727578 4:111987599-111987621 TTGTTACAGAATAAGCATAGAGG + Intergenic
978973617 4:114841504-114841526 TTGAAAAAGCAAGCGCAGAGAGG + Intronic
979081077 4:116342462-116342484 TTGTAAGAGTTAAGGCAGAGAGG - Intergenic
979473979 4:121133344-121133366 TGGTAACAGAAAAAGCAAATAGG + Intronic
980253326 4:130346367-130346389 TTATAATAGCTAAAGCACAGAGG - Intergenic
981230906 4:142354395-142354417 TTTTCACAGGAAAAGCAGAGTGG + Intronic
981959269 4:150515844-150515866 TTTTAACAAGAAAGGCAGAGAGG + Intronic
983249981 4:165332430-165332452 TTGTAGCAGCAAAAACAAAGAGG - Intronic
983590952 4:169410768-169410790 TTGTTAAAGCAAATGCAAAGTGG - Intronic
984061752 4:174997282-174997304 CTGTCAAAGCAAAAGCAGATTGG - Intergenic
984576352 4:181452789-181452811 ATTTAACAGAAAAAGCAAAGAGG + Intergenic
985091449 4:186366627-186366649 TTGTAAGAGTTAAAGCAGAAGGG + Intergenic
987002421 5:13673283-13673305 TTGAAAGAGCAAAACCAGAGTGG + Intergenic
987369191 5:17177609-17177631 TTCAAACTGCAAAGGCAGAGTGG + Intronic
987562799 5:19545997-19546019 TGGTGACAGCCAAAGGAGAGAGG + Intronic
987964475 5:24853914-24853936 TTTTAAAAACAAAAGAAGAGTGG - Intergenic
987995560 5:25273230-25273252 TTATAACAGCAAAACCAGATTGG + Intergenic
988194696 5:27988718-27988740 TTGTAACATCAAGGGCAGAATGG + Intergenic
988681145 5:33485351-33485373 TTGTCTCATCAAAAGCAGTGTGG + Intergenic
988855323 5:35222684-35222706 TTCTAACACCAACAGGAGAGTGG + Intronic
989716357 5:44468039-44468061 TTGTAACAGCAGTGGCAGTGTGG + Intergenic
989747387 5:44846313-44846335 TTGTGAAAACAAAAGGAGAGGGG - Intergenic
990160129 5:52928838-52928860 TTGTAAAAGTGAAAGCAGAGGGG + Intronic
990288912 5:54329009-54329031 ATGTGACAGCAGAGGCAGAGTGG - Intergenic
991599839 5:68341253-68341275 TTGTAAAGGTTAAAGCAGAGGGG - Intergenic
992157989 5:73973440-73973462 ATGTGACAACAAAAGCAGAGAGG + Intergenic
992923232 5:81549994-81550016 GTGTAACAAAAAAAGGAGAGAGG - Intronic
993673555 5:90791264-90791286 TTGTTACCGAAAATGCAGAGAGG + Exonic
994985304 5:106925809-106925831 TTGTGATATTAAAAGCAGAGAGG - Intergenic
995355909 5:111237654-111237676 TTCTAAAAGCAAAACTAGAGGGG - Intronic
996091372 5:119355369-119355391 TTTGCACAGCAAAAGCAGACGGG - Intronic
996239378 5:121176379-121176401 GTGTAATTGCAAAAGCAAAGGGG + Intergenic
996694261 5:126376528-126376550 TTGTAACAGCAGGAGAAGTGGGG - Intronic
997287273 5:132689484-132689506 TCCTATCAGCAAAAGCACAGTGG + Intergenic
997662295 5:135598917-135598939 TCAAAACAGCAAAAGTAGAGGGG + Intergenic
998555814 5:143122696-143122718 TTGTAAAAGTTAAAGCAGAGGGG + Intronic
998835516 5:146199579-146199601 TAGTCAAAGCAAAAGCAGACTGG + Intergenic
999615370 5:153417322-153417344 TAGGAACAGCATAAGCATAGTGG - Intergenic
999641713 5:153679443-153679465 ATGAAACAGCAAATCCAGAGTGG + Intronic
1000157388 5:158564941-158564963 TTGTCACAGCAAGGGAAGAGAGG + Intergenic
1000770880 5:165352105-165352127 TTGTAAAGGTTAAAGCAGAGGGG - Intergenic
1001179939 5:169510893-169510915 TTGTCACAGCTGAGGCAGAGGGG - Intergenic
1001955285 5:175844546-175844568 TTGTATAAGCAAAGTCAGAGAGG + Intronic
1002398556 5:178976970-178976992 TCCTAACAGAAACAGCAGAGAGG - Intergenic
1003277359 6:4664124-4664146 ATGGAACTGCAAAAGCAGACTGG + Intergenic
1005319337 6:24637155-24637177 CAGTCAAAGCAAAAGCAGAGTGG + Intronic
1005332065 6:24760316-24760338 TTGTAAAGGTTAAAGCAGAGGGG - Intergenic
1005576504 6:27194715-27194737 TTGTGGTAGCCAAAGCAGAGAGG + Intergenic
1008289109 6:49691240-49691262 TTGTAACTGCAAGAGCACTGAGG - Intergenic
1010688929 6:78886081-78886103 TTGTAACAAGAAACGAAGAGTGG + Intronic
1011190665 6:84725006-84725028 TCGTAAGAGCAAAAGCTGACAGG + Intronic
1011251099 6:85372895-85372917 TTGTAAGAGTTAAAGCAGAGGGG - Intergenic
1011595535 6:89012532-89012554 TTGTAAAAGTTAAAGCAGAGGGG - Intergenic
1011898157 6:92258064-92258086 GAATAACAGCAAAAGGAGAGGGG - Intergenic
1013533537 6:111041958-111041980 TTGTAAAGGCTAAAGGAGAGGGG + Intergenic
1013542450 6:111123899-111123921 TTTTAAAAGGAAAAGAAGAGGGG - Intronic
1013822970 6:114177438-114177460 TTGCATTAGCAAAAGCAGGGTGG - Intronic
1014685985 6:124501032-124501054 TTGTACAATAAAAAGCAGAGCGG + Intronic
1014936349 6:127389373-127389395 TTGAACTTGCAAAAGCAGAGTGG - Intergenic
1015268713 6:131316919-131316941 TGGTGACAGCCACAGCAGAGTGG + Intergenic
1015582525 6:134741390-134741412 GTGTGACAGCAAAAGCAGATGGG + Intergenic
1017752027 6:157496928-157496950 TGTTCACAGGAAAAGCAGAGAGG - Intronic
1018885145 6:167928843-167928865 GTGTAAGAGCAAATGCAAAGAGG - Intronic
1019968129 7:4517630-4517652 TTGTGACAGCAACAACAGAAAGG + Intergenic
1020478102 7:8623013-8623035 CAGAAAGAGCAAAAGCAGAGTGG + Intronic
1021603102 7:22384052-22384074 CTGTAGAAGCAAAAGCAGTGAGG + Intergenic
1022052059 7:26685595-26685617 TTCTAACAGCATAAGCACAATGG + Intronic
1022513513 7:30959700-30959722 CTGTCAAAGCAAAAGCAGACCGG + Intronic
1023999867 7:45183140-45183162 TAGTACCTGCAAAAGCAGAGGGG - Exonic
1024895337 7:54253989-54254011 TTGTAAGAGCTAAAGCAGAGGGG + Intergenic
1026441239 7:70446197-70446219 TTTTAACAGCAAATGCTGCGTGG + Intronic
1027978181 7:85185421-85185443 TTGCACAAGCAAAAGAAGAGGGG - Intronic
1028353910 7:89883182-89883204 ATGTCACAGCCAAAGCAGTGAGG - Intergenic
1028513595 7:91651734-91651756 TCCTAAGAACAAAAGCAGAGAGG - Intergenic
1028889185 7:95967779-95967801 TTGTAACAGGAAAAGAAGAAGGG + Intronic
1029064551 7:97836421-97836443 TTGTAAGGGTTAAAGCAGAGGGG - Intergenic
1030184505 7:106747905-106747927 TTGTAAATGTTAAAGCAGAGGGG - Intergenic
1030642178 7:112018501-112018523 TTGGAAGAGCAGAAGAAGAGAGG - Intronic
1031312375 7:120215086-120215108 TGGTTAAAGCAAATGCAGAGAGG + Intergenic
1031923450 7:127617858-127617880 TTGTAGCTGCAAAGGCAGAGTGG + Intergenic
1032787929 7:135215574-135215596 TTGTACCAGGAAAAGCGGAGTGG - Intergenic
1032962126 7:137047825-137047847 TTGTAACAGGAAAAATAAAGAGG + Intergenic
1033540971 7:142355786-142355808 TTCTAAAAGCAAGAACAGAGAGG - Intergenic
1033552199 7:142457721-142457743 TTCTAAGAACAAAAGTAGAGGGG - Intergenic
1034481791 7:151326994-151327016 CAGTCACAGCAAAAGCAGACTGG - Intergenic
1035376198 7:158407871-158407893 TGGAAACAGCAAAAGCAAAAAGG + Intronic
1036046488 8:5147107-5147129 TTGTAAAAGCAAAAACACATAGG + Intergenic
1037410882 8:18595603-18595625 TGGTAACAAAAAGAGCAGAGGGG + Intronic
1037655209 8:20877191-20877213 TGGTACCAGCAGAAGCAGAAGGG - Intergenic
1037847052 8:22292772-22292794 TTGTAAAGGTTAAAGCAGAGGGG + Intronic
1038040698 8:23721953-23721975 TTGTAAGGGTTAAAGCAGAGGGG + Intergenic
1038306676 8:26409818-26409840 CTTCAACAGCAAAAGCAGAAGGG - Intronic
1038997340 8:32939116-32939138 TGGGAACAGTGAAAGCAGAGAGG + Intergenic
1039027500 8:33273513-33273535 TTGTAAAAGCAAAATGAGAAAGG + Intergenic
1039436360 8:37562051-37562073 TTGGAACAGGATAAGGAGAGAGG + Intergenic
1040005684 8:42618972-42618994 ATGTAACATCAAAAGGGGAGGGG - Intergenic
1040365620 8:46711986-46712008 TTGTAAGGGTTAAAGCAGAGGGG + Intergenic
1042957066 8:74262214-74262236 TGTTAACAGCAAACTCAGAGTGG - Intronic
1043641510 8:82456776-82456798 TTGTAACAACAAAAACATAAAGG + Intergenic
1044486020 8:92755699-92755721 TAGTAACAACAAAAGAAGGGAGG + Intergenic
1045319127 8:101068377-101068399 ATGTAAGATCAAGAGCAGAGGGG + Intergenic
1046639163 8:116706461-116706483 TTGAAACATGAAAAACAGAGTGG - Intronic
1047898453 8:129393340-129393362 TTTTAAAAGTAAAATCAGAGGGG + Intergenic
1048750612 8:137669774-137669796 TTGTACCAGCAAATGCTGAGTGG + Intergenic
1050544210 9:6695960-6695982 TTGTAAGAGTTAAAGTAGAGAGG + Intergenic
1052984810 9:34479110-34479132 TGGTAACAGCAAAGGTGGAGAGG + Intronic
1053540326 9:38967145-38967167 TTATAACAGTCAAAGCAAAGGGG - Intergenic
1053804670 9:41789303-41789325 TTATAACAGTCAAAGCAAAGGGG - Intergenic
1054140612 9:61526160-61526182 TTATAACAGTCAAAGCAAAGGGG + Intergenic
1054625816 9:67396778-67396800 TTATAACAGTCAAAGCAAAGGGG + Intergenic
1056065528 9:82929741-82929763 TTGTAACGGGAATAGCAGAAAGG - Intergenic
1056066980 9:82946338-82946360 TAGTAATAGCTAAAGCAGAGTGG - Intergenic
1056394187 9:86166583-86166605 TTGGAAGAGTTAAAGCAGAGAGG + Intergenic
1056750242 9:89345385-89345407 TTGAATGAGCCAAAGCAGAGCGG + Intronic
1057625211 9:96670526-96670548 TGGGAAGAGCAAAAGCTGAGTGG - Intergenic
1058833793 9:108842763-108842785 CTGTAACAAGAAGAGCAGAGGGG + Intergenic
1060284903 9:122241848-122241870 CTGTAGCAGCAAAAGCAAATTGG - Exonic
1203734161 Un_GL000216v2:119773-119795 TTGTAATGGTTAAAGCAGAGGGG - Intergenic
1185582240 X:1218534-1218556 TTGTCACAGCAAGAGCTGGGAGG - Intergenic
1186269984 X:7876608-7876630 TTGTAACCCAATAAGCAGAGGGG - Intergenic
1187564070 X:20431133-20431155 TTGTCACATGAAAAGCAGGGAGG + Intergenic
1188673888 X:32914552-32914574 CTGCAACATCAAAAACAGAGAGG + Intronic
1188808389 X:34620394-34620416 TTGTAAGATCCAAAGCAGAATGG + Intergenic
1190470848 X:50777743-50777765 TTGTAAGAGCAAAAACACTGTGG - Intronic
1192188688 X:68977220-68977242 TCATGACAGCAAAAGCTGAGTGG - Intergenic
1194807661 X:98349220-98349242 TTGTAAGGGTTAAAGCAGAGAGG + Intergenic
1195603396 X:106774076-106774098 TTGTGACCGTAAAATCAGAGTGG + Intronic
1196188156 X:112766401-112766423 TTGTAAAGGTTAAAGCAGAGGGG - Intergenic
1196758030 X:119174990-119175012 TTGTAAAGGTTAAAGCAGAGGGG + Intergenic
1197148791 X:123197045-123197067 TTGTAAGAGCAATAGGAGGGTGG + Intronic
1199230409 X:145430779-145430801 TCCAATCAGCAAAAGCAGAGAGG + Intergenic
1201780925 Y:17722027-17722049 TTTTAACAGCAAGAACACAGTGG + Intergenic
1201820628 Y:18183963-18183985 TTTTAACAGCAAGAACACAGTGG - Intergenic