ID: 1178790819

View in Genome Browser
Species Human (GRCh38)
Location 21:35698546-35698568
Sequence GCCCCCAAAATAATAAACTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 1, 2: 2, 3: 23, 4: 222}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178790818_1178790819 10 Left 1178790818 21:35698513-35698535 CCGGAGGACTGTCAATCTTCAGA 0: 1
1: 0
2: 0
3: 6
4: 116
Right 1178790819 21:35698546-35698568 GCCCCCAAAATAATAAACTTAGG 0: 1
1: 1
2: 2
3: 23
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178790819 Original CRISPR GCCCCCAAAATAATAAACTT AGG Intronic
901210728 1:7524696-7524718 GCCCCTGAAATCAGAAACTTTGG + Intronic
902608907 1:17585652-17585674 GCCCCCAAAATATTATGCTCTGG + Intronic
904512339 1:31022632-31022654 GGACCCAAAATAATAATTTTGGG - Intronic
907500632 1:54877168-54877190 GCCCCCAAATTACTAAACTAAGG - Intronic
907993093 1:59601684-59601706 TCCCCCTAGATTATAAACTTCGG + Intronic
909053310 1:70793970-70793992 CTCCCCAAAATAATATACCTAGG + Intergenic
909819052 1:80035833-80035855 CCCCCCAAAATAAAATACTTAGG - Intergenic
912130968 1:106599756-106599778 GTCTCCAAAATAATAACGTTGGG - Intergenic
912660811 1:111528750-111528772 ATCCCCAAAATAAAATACTTAGG - Intronic
913141620 1:115946875-115946897 GACCCCAAACTATTAAACTTTGG - Intergenic
919235102 1:194830787-194830809 GCCACAAAAGTAATAAACTATGG + Intergenic
919920963 1:202166213-202166235 GCCTCAAAGATAATGAACTTGGG - Intergenic
920055815 1:203190643-203190665 GACACCAAAATAATAAGCCTTGG - Intergenic
920986280 1:210892670-210892692 GACCCCAAAAAACTAAAGTTTGG + Intronic
921820810 1:219614747-219614769 TCCCCAAAAATTAAAAACTTAGG + Intergenic
923023085 1:230180840-230180862 ACTCCCAAAATGAAAAACTTAGG - Intronic
923692996 1:236214603-236214625 GCCCCCAAAATTCTTATCTTTGG + Intronic
923718663 1:236448552-236448574 CCCCCCAAAATAAAAGACTTAGG + Intronic
1063393927 10:5669062-5669084 GCCTCCAAAATAAATAGCTTGGG + Intergenic
1063503044 10:6571883-6571905 GCCACCTAACTAACAAACTTTGG + Intronic
1064246757 10:13674254-13674276 GCCACCACAACAATAAACTCAGG + Intronic
1064261500 10:13790184-13790206 GCCCCCAAAACCAGAGACTTGGG - Intronic
1064388098 10:14916676-14916698 TCCCCCAAAATGAAATACTTAGG + Intronic
1065913740 10:30334062-30334084 TCCCACTATATAATAAACTTGGG - Intronic
1069258799 10:66367685-66367707 GACCCCAAAATTTTAAAATTCGG - Intronic
1070852481 10:79577472-79577494 ACCCCCAAAATAAAATACTAGGG + Intergenic
1071919890 10:90337693-90337715 GCACACATAATAATAAATTTGGG - Intergenic
1073334441 10:102695354-102695376 ACCCCCAAAATGAAACACTTAGG - Intronic
1073836306 10:107447340-107447362 GCACACAAAAACATAAACTTGGG + Intergenic
1074155769 10:110797928-110797950 GCACCCAAAATAAAAATCTATGG + Intronic
1078173203 11:8946096-8946118 ACCCCCAAAATAAAATACTTAGG - Intergenic
1079087263 11:17455471-17455493 GCCCCCAACAAAATAACCTAGGG + Intronic
1079524899 11:21374379-21374401 GCCCACAAAATGAAAAACTGAGG - Intronic
1080801208 11:35611950-35611972 GCCCCCAAGTTAATCAACTCTGG - Intergenic
1080829845 11:35881816-35881838 ATCCCCAAAATAAAATACTTAGG - Intergenic
1081166821 11:39817866-39817888 GCCTCCAATATAATGAACTCTGG - Intergenic
1083543890 11:63535034-63535056 ACCCTCAAAATGATAAACATAGG + Intergenic
1088650230 11:111951572-111951594 GGCCCCAAAATCATATAGTTTGG + Intronic
1088806158 11:113354199-113354221 GCCACCAAAAGAAAATACTTAGG - Intronic
1093540374 12:20276109-20276131 ACATGCAAAATAATAAACTTGGG - Intergenic
1094432195 12:30381463-30381485 CCCCCAAAAATAAAATACTTAGG + Intergenic
1095332529 12:40984979-40985001 TCCCCCAAAATAATGAGCATTGG - Intronic
1098475688 12:70899931-70899953 GACCCAAAAATAAAATACTTAGG + Intronic
1101815917 12:108146208-108146230 TCCCCCAAGATAATTATCTTTGG + Intronic
1103835899 12:123820838-123820860 GCCACCATAATAATGAGCTTGGG + Intronic
1104525298 12:129515507-129515529 TCCCCCAAAATATGGAACTTTGG + Intronic
1105670189 13:22604982-22605004 ATCCCCAAAATAAAATACTTAGG + Intergenic
1105770279 13:23604262-23604284 CCCCCCAAAATAAAATACCTAGG + Intronic
1106103260 13:26712407-26712429 CTCCCCAAAATAAAACACTTAGG - Intergenic
1106823758 13:33494916-33494938 GCCCCCAAAAGACTCTACTTAGG + Intergenic
1107456677 13:40561998-40562020 GCCCCCAAATTAATAAGACTTGG + Intronic
1108349093 13:49574108-49574130 ACCCCCAAAAAAAGAAATTTGGG - Intronic
1109129384 13:58562276-58562298 GCCCCCAAAATATTAATATTTGG - Intergenic
1109536831 13:63732743-63732765 TGCCCCAGAATAAAAAACTTAGG + Intergenic
1111065245 13:83082577-83082599 GACCCAAAAATATTAAAATTAGG - Intergenic
1111461665 13:88552303-88552325 GACCCCTAAATAATATATTTTGG - Intergenic
1112472581 13:99702308-99702330 ACCCCCAAAATAAGTAAATTAGG - Intronic
1113309354 13:109115564-109115586 GCCACCAAAATGAAAAACGTAGG + Intronic
1116250769 14:42480695-42480717 GCCCCCAAAATAATAATTACTGG + Intergenic
1118954063 14:70463509-70463531 GCCAGCCAAATTATAAACTTGGG + Intergenic
1119796297 14:77400837-77400859 ACCCCCAAAATGAAATACTTAGG + Intronic
1121805475 14:96816488-96816510 TCCCCCAAATTACTAAACTGAGG + Intronic
1121965459 14:98299595-98299617 GCCACTAAAATAAAACACTTTGG + Intergenic
1127857301 15:62962972-62962994 GCCCCCAAATTAATCAGGTTCGG - Intergenic
1128137125 15:65272114-65272136 GCCCCCAAAAGTGAAAACTTGGG - Intronic
1129193194 15:73949471-73949493 GACTCCAAAACAATATACTTTGG - Exonic
1130792925 15:87175226-87175248 GCATCAAAAATAATATACTTAGG + Intergenic
1134405706 16:13956756-13956778 TCCCCCACAATACTAAATTTTGG - Intergenic
1137466294 16:48712852-48712874 CCCCCCACAAAAAAAAACTTAGG - Intergenic
1138585860 16:57970144-57970166 GCCTCCCAAAAAATGAACTTGGG + Intronic
1139070615 16:63377150-63377172 GCCCTAAAAATAATGAATTTAGG + Intergenic
1139081115 16:63522585-63522607 GCCCCCAGAACATTAGACTTAGG - Intergenic
1141237851 16:82236036-82236058 GCCCCCAAAATGAAATACTTAGG + Intergenic
1141268748 16:82520261-82520283 CTCCCCAACATGATAAACTTGGG + Intergenic
1142088229 16:88195934-88195956 GCTCCCAAGATGATTAACTTGGG + Intergenic
1143763273 17:9120394-9120416 GCCCCCAAAATCCTTAACGTGGG - Intronic
1146402044 17:32507413-32507435 CCCCCAAAAACAAAAAACTTGGG + Intronic
1147486273 17:40817800-40817822 ACCCCCAAAATAATAATAATTGG - Intergenic
1149382931 17:56111617-56111639 ACCCCCAAAATAAGCATCTTAGG + Intronic
1153678713 18:7479859-7479881 ACCCCCAAAAGGATACACTTTGG - Intergenic
1154232207 18:12567228-12567250 CCCCCCAAAATAAAATACTTAGG + Intronic
1155052271 18:22158754-22158776 GAACCCAAAATAATAAAATTAGG - Intergenic
1155282586 18:24255380-24255402 GCCCCCAAATTACTAAACTAAGG + Intronic
1155667689 18:28331213-28331235 ACCCCCAAAATGAAATACTTTGG - Intergenic
1155850278 18:30766028-30766050 GCCCCCATAATAATGGTCTTGGG + Intergenic
1156067401 18:33160971-33160993 GTCCCCAAAATATGTAACTTTGG + Intronic
1156950815 18:42895493-42895515 GCCCCCAAAACATTCAAATTTGG - Intronic
1157899410 18:51499955-51499977 GCCCCCCAAATGAAATACTTAGG + Intergenic
1158930641 18:62322548-62322570 GCCACCAAAATAATAAAACAAGG + Intergenic
1159335473 18:67059059-67059081 TCTCCCAAAATGATAGACTTGGG - Intergenic
1161721621 19:5905720-5905742 GCCTCAAAAATAATAAATTTAGG - Intronic
1162416208 19:10539449-10539471 GTCTCGAAAATAATACACTTGGG + Intergenic
1166720708 19:44994361-44994383 CCCCCCAAAACAGTAAACCTGGG - Intergenic
1167701760 19:51052280-51052302 GCCCCCAAACCAATACTCTTGGG + Intergenic
925121751 2:1423674-1423696 TCCTACAAAATAATAAGCTTGGG - Intronic
925396791 2:3539388-3539410 GCCCCCAAATTAAGATTCTTTGG - Intronic
929438471 2:41947240-41947262 ACCCCAAAAATATTAAACATGGG + Intronic
932247826 2:70211304-70211326 CACCCCAAAATAATAAAATCGGG + Exonic
933784205 2:85825670-85825692 GCCATCAGAATAAAAAACTTTGG - Intergenic
933896829 2:86818693-86818715 GCCACAAAAATATTAAAATTAGG + Intronic
934516324 2:94990000-94990022 TCCCCCAAAATGAAATACTTAGG + Intergenic
935287086 2:101574624-101574646 ACCTCCAAAATAAGGAACTTTGG + Intergenic
935813225 2:106820513-106820535 GACCCCAAAATAATAAAGGCTGG + Intronic
936774789 2:115960031-115960053 ACCCCTAAAATAAAATACTTAGG - Intergenic
936827499 2:116600160-116600182 GGCACCCAAATAATACACTTTGG - Intergenic
939329293 2:140737051-140737073 TCCCCCAAAAAAATAAACAAGGG + Intronic
939588918 2:144039512-144039534 TCCTCCAAAATAAACAACTTTGG + Intronic
941058747 2:160820456-160820478 GCCCGCAAAATGAAATACTTAGG - Intergenic
941272123 2:163443127-163443149 GCCAACCAAATAATAAACTTGGG - Intergenic
942866787 2:180686107-180686129 AACCCCAAAATAAGAAACATAGG + Intergenic
943085266 2:183303379-183303401 TACCCCAAAATAAGACACTTTGG + Intergenic
943194842 2:184732754-184732776 TCCCCCAAAACAAAATACTTAGG - Intronic
944167198 2:196735370-196735392 CCCCCCAGAATAATTAACCTTGG + Intronic
945153805 2:206816285-206816307 ACCCCCAAAATCAAATACTTAGG - Intergenic
945166019 2:206946865-206946887 CCCCTCAAAATAAAATACTTAGG + Intronic
945201333 2:207284787-207284809 GCCCCCAAATTCATAAACGCTGG - Intergenic
945327844 2:208503514-208503536 CCCCCAAAAATAAAATACTTAGG - Intronic
945411096 2:209508212-209508234 GCCCTCACAGCAATAAACTTGGG + Intronic
945448721 2:209969098-209969120 GGCCCCAAAATAAACAGCTTGGG - Intronic
945789579 2:214288247-214288269 GCCATAAAAATAATAAAATTAGG - Intronic
946338207 2:219052327-219052349 GCCCTCAAAAGAACAAATTTGGG - Intergenic
946661413 2:222004110-222004132 GCCCCCAAAACATTAATTTTAGG - Intergenic
947042242 2:225936366-225936388 TCCTCCAAAATAATACAATTTGG + Intergenic
947343727 2:229168822-229168844 AACCCCACAATAATTAACTTGGG - Intronic
1170878584 20:20274040-20274062 GGCCCCAAAATATAAGACTTTGG + Intronic
1177441074 21:21124456-21124478 GCCTCTAAAATAGTAAACTTAGG + Intronic
1178220785 21:30657277-30657299 GCCATAAAAATAATAAAATTCGG - Intergenic
1178790819 21:35698546-35698568 GCCCCCAAAATAATAAACTTAGG + Intronic
1179447217 21:41440755-41440777 TCCCCCAAAAGAAGTAACTTTGG - Intronic
1183889871 22:40918369-40918391 GTCTCCAAAATAAAAAAGTTAGG + Intronic
1185161787 22:49234383-49234405 TCCCCCAAGAGAAGAAACTTGGG - Intergenic
949185714 3:1189187-1189209 GCACCAACAATTATAAACTTGGG - Intronic
949272466 3:2234965-2234987 TTCCCCAAAAAAATAAACTCAGG - Intronic
952361449 3:32634121-32634143 CCCCCCAAAATGAAATACTTAGG - Intergenic
955842542 3:63127579-63127601 GCCACTAAAATAATCAAATTAGG - Intergenic
956610385 3:71116452-71116474 GCCCCCAAATGAATAAACACAGG + Intronic
957217334 3:77337354-77337376 GCCCCCAAAATATTAAACTTGGG + Intronic
959562003 3:107793218-107793240 GCCCCCAAAAGCAGAAAATTAGG - Intronic
963676606 3:148319289-148319311 GCCCACAAGATAAGAAACTGAGG - Intergenic
963999639 3:151754299-151754321 GCTCTCAAAAGTATAAACTTAGG + Intronic
965125555 3:164624532-164624554 TCCCCCAAAAAAATCAATTTAGG + Intergenic
966340569 3:178921225-178921247 ACCCCCAAAATAATAAAACCAGG + Intergenic
968422647 4:498461-498483 GCCCCAAAATTACTAAACTAAGG - Intronic
968683562 4:1939424-1939446 GCCCCCAAAAACATCAACCTGGG - Intronic
972064910 4:34929604-34929626 GCCACTAAAATAAAATACTTAGG + Intergenic
973629716 4:52808657-52808679 ACTCCCAAAATAAAACACTTAGG + Intergenic
976502154 4:85803663-85803685 GCCCCCTAACTAATTAACCTGGG - Intronic
977308799 4:95358409-95358431 TCCTTCAAAATAATAAATTTTGG - Intronic
977461509 4:97331770-97331792 GCCCTCCAAATAATAAGCATTGG - Intronic
977964644 4:103130426-103130448 CCCCCCAAAATAAAATACATAGG + Intronic
978055408 4:104257708-104257730 TCCCCCAAAATTAAATACTTGGG + Intergenic
979071260 4:116209701-116209723 GCCCCCAAAATAAAATACTTAGG + Intergenic
979129345 4:117021440-117021462 GTCCACAAAATAATAGATTTTGG + Intergenic
979702123 4:123681728-123681750 GCCCCCAAAACACTGAACATAGG - Intergenic
981119609 4:141034675-141034697 GACCCAAAAATATTAAAATTAGG - Intronic
981690841 4:147507192-147507214 CCCCTCAAAATAAGGAACTTTGG - Intronic
984100408 4:175477677-175477699 GCCCCAAAATTACTAAACTAAGG + Intergenic
984334223 4:178367580-178367602 GCACCAAAAATATTAAACATAGG + Intergenic
984399422 4:179242826-179242848 GTCCCCAAAAGAATAGACTGTGG - Intergenic
984441988 4:179782854-179782876 TCCCCCAAAATAAAATTCTTAGG - Intergenic
986687376 5:10286603-10286625 GCTCCCAAAAGAAGAAACCTTGG - Intronic
987201064 5:15578797-15578819 CCCTCCAAAATAAAAAAGTTTGG + Intronic
988418196 5:30972870-30972892 TCTCCCAAAATAAGATACTTTGG + Intergenic
988647711 5:33112443-33112465 CCTCCCAAAATAAAATACTTAGG - Intergenic
988666753 5:33337466-33337488 GGGCCAAAAATAATAAACCTGGG - Intergenic
989995616 5:50826185-50826207 GCACACAAAATAATAAGTTTTGG - Intronic
991657164 5:68915664-68915686 CCCTGCAAAATAATAGACTTGGG - Intergenic
992520855 5:77549527-77549549 ACCCCCAAAAAAACAAACCTAGG + Intronic
992590713 5:78293715-78293737 CCCCCCAAAACAAACAACTTGGG + Intronic
992617541 5:78559207-78559229 GGCCACAAAATAATATAATTTGG - Intronic
992861080 5:80910816-80910838 TGCCCCAAAATAAAATACTTCGG + Intergenic
994593414 5:101801573-101801595 TCCCCCAAAATAAAATGCTTAGG - Intergenic
994913394 5:105942957-105942979 GCCACAAAAATAATGAGCTTTGG + Intergenic
995501631 5:112813375-112813397 GCCCTCATAAAAATTAACTTTGG + Intronic
995646199 5:114315067-114315089 GCTCCCAATATAAGAAACCTAGG - Intergenic
995965155 5:117897484-117897506 GCCCCCAAAATGAAATACTTAGG + Intergenic
996185428 5:120467480-120467502 GCACCAACAATATTAAACTTTGG + Intronic
996592883 5:125167622-125167644 CCTCCCAAAATAACATACTTTGG + Intergenic
998931154 5:147182933-147182955 GCCACCAAAAATATAAAATTTGG - Intergenic
1000032144 5:157411791-157411813 GCCACAAAAATAAAATACTTAGG + Intronic
1000301073 5:159956364-159956386 GCCAACAAAAAAATAAAATTTGG - Intronic
1000354686 5:160382822-160382844 GGCACCAAGAAAATAAACTTAGG + Intergenic
1001739288 5:174037042-174037064 TTCCCCAAAATAAAAAACCTTGG - Intergenic
1002782485 6:378186-378208 CCCCCCAAAAGTATAAAATTCGG + Intergenic
1002877376 6:1223154-1223176 GCCTCAAAAAGAAGAAACTTGGG - Intergenic
1004033425 6:11896439-11896461 CCCCCCAAAATAAAAGGCTTGGG - Intergenic
1004588230 6:17024032-17024054 TCCCCCAAAATGAAATACTTAGG - Intergenic
1008073834 6:47125291-47125313 ACCCTCAAAATAAAATACTTAGG - Intergenic
1008785835 6:55166863-55166885 GCCACAAAAATAATAAAGTACGG + Intronic
1011257692 6:85440393-85440415 GCCCTAAAAATAAAATACTTAGG - Intergenic
1013939708 6:115646146-115646168 GTCACCAAAATAAAAGACTTTGG + Intergenic
1014354187 6:120383531-120383553 ACCCCCAAAAATATAAACCTAGG - Intergenic
1014426765 6:121316343-121316365 GCCCCCAGAGTCATAAAATTGGG + Intronic
1014784635 6:125604296-125604318 CCCCCCAAAATGAAATACTTAGG + Intergenic
1014793773 6:125703894-125703916 GCCCTCAAAATCACAAACTATGG - Intergenic
1014833722 6:126133109-126133131 ACCCACAAAATAATTAAGTTCGG + Intergenic
1015312562 6:131781594-131781616 GCCCCCGAAATAATTCATTTTGG + Intergenic
1016289610 6:142514329-142514351 ACCCCCAAAAAACAAAACTTTGG - Intergenic
1016322726 6:142864726-142864748 TCCTCCAAAATAATAAACACAGG + Intronic
1021043933 7:15898750-15898772 ACCCCCAAAATGAAAAACTTAGG + Intergenic
1021671940 7:23043423-23043445 GCCCCCAAAATAAAAATCATAGG - Intergenic
1022915048 7:34940461-34940483 AGCCCCAAAATAATAATCTTTGG + Intronic
1023597046 7:41841064-41841086 ACCCCAAAAATAAAACACTTAGG - Intergenic
1023658812 7:42452783-42452805 ACCCACAAACTAATAAACTTGGG - Intergenic
1024439361 7:49398181-49398203 GCCCATAAAATGATGAACTTGGG + Intergenic
1025798420 7:64761062-64761084 GCCCTCAGACAAATAAACTTTGG - Intergenic
1026570339 7:71523816-71523838 GCCCCCAGATTAAGAAACTCTGG + Intronic
1026599464 7:71764643-71764665 CCCCCCAAAATAATATACTTAGG - Intergenic
1026673439 7:72408977-72408999 GCCCCAAAAAAAGTATACTTGGG - Intronic
1027797500 7:82712857-82712879 GCCCCCTAAATTTTAAATTTAGG - Intergenic
1036423638 8:8622063-8622085 CCCCCCAAAATGAAATACTTTGG + Intergenic
1039156184 8:34560623-34560645 GCCACCAACAAAATAAAGTTAGG + Intergenic
1040449345 8:47528521-47528543 GCCCCTAACATATTAATCTTAGG - Intronic
1041587632 8:59540112-59540134 TCCCACAAAATAATAAGCCTGGG + Intergenic
1042383317 8:68144421-68144443 CTCCCCAAAATAAAATACTTAGG - Intronic
1043183818 8:77119750-77119772 GCTCCCAACTTAATAAACATGGG + Intergenic
1043320418 8:78977963-78977985 TCCCCCAAAATGAAATACTTAGG - Intergenic
1045766914 8:105683150-105683172 GCCCCCAAAGTAATAGTATTAGG - Intronic
1046008425 8:108514742-108514764 GACCCCAAAACCATAAACATTGG + Intergenic
1046243117 8:111525570-111525592 CCCCCCAAAAAAATACAGTTAGG - Intergenic
1046293149 8:112188739-112188761 GCACTCAAATTAATAATCTTAGG - Intergenic
1046434793 8:114173487-114173509 GCATCAAAAATAATATACTTAGG + Intergenic
1046457717 8:114489107-114489129 ACCCAAAAAATAATAAAATTAGG + Intergenic
1047803614 8:128335584-128335606 GACCCCTAAATAATACATTTTGG - Intergenic
1050174830 9:2858933-2858955 GACCCCAAGTTAATAACCTTTGG + Intergenic
1050809720 9:9728927-9728949 GCCTCCAAAATAGAAGACTTGGG - Intronic
1050813036 9:9774280-9774302 GCCCCCAAAATTCTAAATTTAGG - Intronic
1052089332 9:24308477-24308499 GCCCCCAAAATAATAATTGTCGG + Intergenic
1054896323 9:70316357-70316379 GCCCCCAAATGAATCATCTTAGG - Intronic
1054986500 9:71268078-71268100 GGCCATTAAATAATAAACTTGGG + Intronic
1055161978 9:73141688-73141710 GCCCCCAAATTACTAAGCTAAGG + Intergenic
1059110218 9:111550580-111550602 GCTCCCAAAATAATCACTTTAGG + Intronic
1059714102 9:116897118-116897140 GCTCCCAAAAAAATAACCTCAGG + Intronic
1059881727 9:118697735-118697757 ACCCCCAAAATGAAATACTTAGG + Intergenic
1061837571 9:133339668-133339690 GCCCTCAAAATAAAAAGCTTGGG + Exonic
1185524362 X:765556-765578 ACACACAAAATAAAAAACTTTGG + Intergenic
1186043630 X:5509196-5509218 GGCCCCAAAATTATAACCTGAGG + Intergenic
1187619376 X:21033045-21033067 GCCCTGAAAATAATAAGTTTTGG + Intergenic
1187800510 X:23057158-23057180 CCCCCCAAAATGAAATACTTAGG - Intergenic
1190113769 X:47612344-47612366 GCCCGCCAAATAATAAAGTCAGG + Intronic
1190242725 X:48670161-48670183 GGCTCCAAAATAACAAATTTAGG - Intergenic
1195571080 X:106399350-106399372 GCCCCCAAAGTAAGGAACTTTGG - Intergenic
1195587330 X:106579776-106579798 CCCCCCAAAATGAAATACTTAGG + Intergenic
1195764684 X:108283573-108283595 CCCCCCCAAAAAAAAAACTTAGG - Intronic
1195840442 X:109170719-109170741 GTCCCCAAAATTACACACTTAGG - Intergenic
1196155675 X:112426609-112426631 ACCCCCAAAATAAAATACTTAGG - Intergenic
1199251721 X:145670783-145670805 GCTCAAAAAATAAAAAACTTAGG - Intergenic
1200361308 X:155610230-155610252 GCCACAACATTAATAAACTTTGG + Intronic
1201222090 Y:11781762-11781784 GCTCCCAAAGGAATAAAGTTTGG + Intergenic