ID: 1178794149

View in Genome Browser
Species Human (GRCh38)
Location 21:35728106-35728128
Sequence GCAGAGATGGAGGAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2052
Summary {0: 2, 1: 18, 2: 90, 3: 323, 4: 1619}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178794149_1178794155 5 Left 1178794149 21:35728106-35728128 CCTTCCACCTCCTCCATCTCTGC 0: 2
1: 18
2: 90
3: 323
4: 1619
Right 1178794155 21:35728134-35728156 CTGCCCCTCTTGAGACAGCAAGG 0: 1
1: 0
2: 10
3: 38
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178794149 Original CRISPR GCAGAGATGGAGGAGGTGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr