ID: 1178802559

View in Genome Browser
Species Human (GRCh38)
Location 21:35809693-35809715
Sequence CCTTCTGGTCTCAAGTTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 3, 3: 7, 4: 166}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178802559_1178802563 1 Left 1178802559 21:35809693-35809715 CCTTGTAACTTGAGACCAGAAGG 0: 1
1: 0
2: 3
3: 7
4: 166
Right 1178802563 21:35809717-35809739 CAAAATGCAGTGAGGTGTGAAGG 0: 1
1: 0
2: 1
3: 49
4: 795
1178802559_1178802564 5 Left 1178802559 21:35809693-35809715 CCTTGTAACTTGAGACCAGAAGG 0: 1
1: 0
2: 3
3: 7
4: 166
Right 1178802564 21:35809721-35809743 ATGCAGTGAGGTGTGAAGGAAGG 0: 1
1: 1
2: 0
3: 38
4: 378
1178802559_1178802565 6 Left 1178802559 21:35809693-35809715 CCTTGTAACTTGAGACCAGAAGG 0: 1
1: 0
2: 3
3: 7
4: 166
Right 1178802565 21:35809722-35809744 TGCAGTGAGGTGTGAAGGAAGGG 0: 1
1: 1
2: 0
3: 50
4: 442
1178802559_1178802562 -7 Left 1178802559 21:35809693-35809715 CCTTGTAACTTGAGACCAGAAGG 0: 1
1: 0
2: 3
3: 7
4: 166
Right 1178802562 21:35809709-35809731 CAGAAGGACAAAATGCAGTGAGG 0: 1
1: 0
2: 6
3: 35
4: 424

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178802559 Original CRISPR CCTTCTGGTCTCAAGTTACA AGG (reversed) Intronic
904174107 1:28613805-28613827 CCTTCTGCTTTCTACTTACATGG - Intronic
905228314 1:36494303-36494325 CCTGCTGGCCTCCAGTTACTTGG + Intergenic
908862982 1:68511111-68511133 CCTTATGCTATTAAGTTACAGGG - Intergenic
910813469 1:91263279-91263301 CCTTCAGGTGTCAACTTAAATGG - Intronic
912645966 1:111391894-111391916 ACTTTTGGTCTCTAGGTACATGG + Intergenic
913417034 1:118619932-118619954 CAGTCTGGTCTCAAATTCCAGGG + Intergenic
915704798 1:157833488-157833510 CCTACTAGTCTCAAGTCAAAGGG + Exonic
922048038 1:221965960-221965982 CCATCTGGGCACAAGTCACAGGG - Intergenic
1063084601 10:2804984-2805006 CATTCTGGTCCCAGGTTTCATGG + Intergenic
1064298199 10:14097733-14097755 CATTCTGGTCTAAATTTATAGGG + Intronic
1068834787 10:61542100-61542122 CCCTCTGGTTTCAAGTTACTTGG + Intergenic
1069430345 10:68329526-68329548 CCTCCTGGGTTCAAGTTACATGG - Intronic
1071614931 10:87066606-87066628 CCTTCTGGTCTGCACTTAGACGG - Intronic
1072052946 10:91724603-91724625 CCTTCTGTTCTTAATTTAAATGG + Intergenic
1073513142 10:104054999-104055021 CTTTCTGGTTTCAGGTGACATGG - Exonic
1074518792 10:114198183-114198205 CCATCTGGTCTCTAGTGACACGG + Intronic
1075446089 10:122514122-122514144 CCTCCTGGTCTGACTTTACATGG - Intronic
1075474228 10:122719426-122719448 CTATCTGGTCTCAGGTTGCAGGG - Intergenic
1078115281 11:8442637-8442659 ACATCTGGTCTGTAGTTACATGG - Intronic
1078302326 11:10144742-10144764 CTTTATGGTCTCATGGTACAAGG + Intronic
1080930419 11:36804461-36804483 ACTTCTGGTTTAAAATTACAAGG - Intergenic
1081685514 11:45040302-45040324 CCTTCTGGTCTAATGTAAAAGGG - Intergenic
1085109367 11:73874102-73874124 CCTGCTGGTCTCAAATTCCTGGG - Intronic
1086414495 11:86575268-86575290 GCTTCTGGTTCCAAGTTACTAGG + Intronic
1088591854 11:111410313-111410335 CATGCTGGTCTCAAATTACTGGG + Intronic
1089890048 11:121871733-121871755 CCTTCAGGTCTCATGTTAAATGG - Intergenic
1091278060 11:134365537-134365559 CCTTATGGTGTCAACTCACAGGG + Intronic
1094484979 12:30917925-30917947 CCTTCAGGCCTCCATTTACATGG + Intergenic
1098207086 12:68122418-68122440 CATTCAGGTCTCAGTTTACATGG - Intergenic
1100101637 12:91113981-91114003 CTTGCTGGTCTCAGGTAACAGGG - Intergenic
1100157100 12:91812883-91812905 CCTTCTGATCTCAAGTATGAAGG - Intergenic
1101402048 12:104396985-104397007 CCTCCTGGTCTAAAACTACAGGG - Intergenic
1101733295 12:107444116-107444138 CCTTCTTATCTCAAATTCCAGGG - Intronic
1102398697 12:112610174-112610196 CCTTCTGGTTTCAGCTTAAATGG + Intronic
1104444439 12:128822487-128822509 CCTTCTGGTCTGAACTTACAGGG + Intronic
1105697304 13:22901007-22901029 CCTTGTGCTGTTAAGTTACAGGG + Intergenic
1105937563 13:25116345-25116367 GCTTCTGTTCTCAAGATACTGGG - Intergenic
1106471183 13:30055895-30055917 CCTTGTGCTGTTAAGTTACAGGG + Intergenic
1106848273 13:33761209-33761231 TCCTCTGGCCTCCAGTTACAGGG + Intergenic
1107072795 13:36290059-36290081 CCTTGTGCTATGAAGTTACAGGG + Intronic
1107687413 13:42917346-42917368 CCTTCTGGTCAAAACTTTCATGG - Intronic
1108846950 13:54690301-54690323 CCTTGTGGTGTTAAATTACAGGG + Intergenic
1111359168 13:87151686-87151708 CATTCTGGTTTCAAGATTCAAGG - Intergenic
1111615865 13:90660977-90660999 CATTCTGTTCTGAAGATACATGG + Intergenic
1111868163 13:93795957-93795979 ACTCCTGGTCTCAAGTGACCTGG - Intronic
1113670548 13:112172744-112172766 CATCCTGGGCTCAAGTTGCAGGG + Intergenic
1114480152 14:23028199-23028221 CCTCCTGGGCTCAAGTGACTGGG - Intronic
1117093613 14:52274442-52274464 CCTGCTGGGCTCAAGTTTCTAGG - Intronic
1117103595 14:52376467-52376489 CCTTTTGGTGTCCATTTACATGG + Intergenic
1120296773 14:82651577-82651599 CCTTATGCTTTAAAGTTACATGG + Intergenic
1122418510 14:101561392-101561414 CCCTCCGGGCTCAAGTTGCAAGG + Exonic
1124449018 15:29767817-29767839 CCTTCTGGTCTCAAAGACCAAGG + Intronic
1125558164 15:40603544-40603566 CAGGCTGGTCTCAAGTTACTGGG - Intronic
1126575582 15:50193191-50193213 CTTTCAGGTCTCAGTTTACAGGG + Intronic
1128067395 15:64773884-64773906 CCTTTTGGCATCAAGGTACAAGG + Intronic
1129613587 15:77081275-77081297 CCTTCTCCCCTCAGGTTACAGGG - Intronic
1130767931 15:86891695-86891717 CCTTCTCTACTCAAGTGACATGG + Intronic
1132057163 15:98661054-98661076 CCTTCAGATCTCAAGATACTAGG + Intronic
1135753451 16:25076070-25076092 CCTTCTGCCGTTAAGTTACAGGG + Intergenic
1137334849 16:47538117-47538139 ACTTCTGGGCTCAAGTTAACTGG + Intronic
1139121193 16:64019552-64019574 TCCTCTGGCTTCAAGTTACATGG - Intergenic
1140267702 16:73434731-73434753 CCTTCTGTTCTCCAGTTGCTGGG + Intergenic
1141507966 16:84491933-84491955 CCTTTTGCTGTTAAGTTACAGGG + Intronic
1141771180 16:86090527-86090549 CATTCTGGGGTCAAGTTAGAAGG - Intergenic
1142033618 16:87850681-87850703 CCTGCTGGACTCAAGCAACAGGG + Intronic
1145046046 17:19617117-19617139 CCTTGTGAACTCAAGTCACATGG - Intergenic
1148631025 17:49109362-49109384 CCTTCTGGAATCCATTTACATGG + Intergenic
1155599987 18:27534022-27534044 TCTTCTGTTTTCAAGTAACATGG - Intergenic
1156125767 18:33903449-33903471 CCTTGTGCTGTTAAGTTACAGGG + Intronic
1160486320 18:79296304-79296326 CCTTCTGGGCTGCAGTAACATGG - Intronic
1162190013 19:8937636-8937658 CCCTCTGGTCACTAGTTCCAGGG - Exonic
1163423795 19:17229753-17229775 GCTTCTGGTCTGCTGTTACATGG - Intergenic
1165687055 19:37830943-37830965 GCTTCTTGTCTCCAGTAACAGGG - Intergenic
1166502203 19:43350107-43350129 CATGCTGGTCTCAAGTTCCTGGG - Intergenic
1166725134 19:45022277-45022299 CCCTCTGCTCTAAAGTTTCATGG - Intronic
928305048 2:30162628-30162650 CCTTCTGGTTTCAAGTTACTTGG - Intergenic
933813929 2:86050879-86050901 ACTTCTGGGCTCAAGGTCCAAGG - Intronic
938012396 2:127839378-127839400 ACTCCTGGTCTCAAGTGATACGG - Intergenic
938176170 2:129132420-129132442 CCTTGTGCTGTTAAGTTACAGGG + Intergenic
938777305 2:134553345-134553367 CCTTGTGCCCTCCAGTTACAAGG + Intronic
938851509 2:135265672-135265694 TCTTGTAGGCTCAAGTTACAGGG - Exonic
938906865 2:135845484-135845506 CCTACTGGTCTAAAGTTCCCAGG + Intronic
940914363 2:159238357-159238379 CCTGCTGGTCTCAAGCTCCTGGG + Intronic
941279644 2:163534232-163534254 CCTTTCGGTCTCAAGTCACCTGG - Intergenic
942528732 2:176885384-176885406 CCTTCTGGGCTCAGATTTCATGG - Intergenic
943644361 2:190393028-190393050 CAGGCTGGTCTCAAATTACAGGG + Intergenic
943762987 2:191630111-191630133 CCTTCTGGTTTCATATTAAAAGG + Intergenic
944259899 2:197665594-197665616 ACTTCTGGTTTCCATTTACATGG + Intronic
947484269 2:230533490-230533512 CCTTGTGCTGTTAAGTTACAGGG + Intronic
1168844064 20:930447-930469 CCTTGTGCTGTTAAGTTACAGGG - Intergenic
1168993829 20:2117332-2117354 CATTCTGGTTTCAAGTTCAAAGG - Exonic
1169213849 20:3782810-3782832 CCTTCTGGTCTCCAACTCCAGGG + Intergenic
1172641835 20:36445044-36445066 ACTCCTGGGCTCAAGTTACTGGG + Intronic
1178802559 21:35809693-35809715 CCTTCTGGTCTCAAGTTACAAGG - Intronic
1185254210 22:49823246-49823268 CCTTCTGGGCACACGTCACATGG + Exonic
949414613 3:3800745-3800767 CCTTCTGGGCTCAAGGCTCACGG - Intronic
949472409 3:4410316-4410338 CCTTCTGTTCCTAAGTTATAAGG + Intronic
952570823 3:34713440-34713462 CCTTCTGGTCTCAAATTAAATGG + Intergenic
955511793 3:59688514-59688536 CCTTCAGGTCTCAGATTAAAGGG - Intergenic
960305682 3:116057775-116057797 CCTTGTGTTTTCCAGTTACATGG + Intronic
960756659 3:121021082-121021104 GCTTCTGGTGTCCAGTTGCATGG - Intronic
961087042 3:124077052-124077074 GCTTCTGGTCCAAGGTTACAGGG + Intergenic
963687219 3:148451386-148451408 CCTTCTGTTCTTAAGTTTAAAGG - Intergenic
963701641 3:148633518-148633540 CTTTTTGGTCTCCACTTACATGG - Intergenic
967253722 3:187569017-187569039 TCTAATTGTCTCAAGTTACAGGG - Intergenic
967861115 3:194152610-194152632 CTTTCAGGTCTCAAATTAGATGG + Intergenic
970376853 4:15467492-15467514 CTCTCTGGTCTCAAGTTCCCAGG - Intergenic
970693387 4:18645409-18645431 GCTTCTGTTCTCAAGATATAGGG + Intergenic
974524817 4:63036160-63036182 CCTAGTGGTCTCATGTGACATGG - Intergenic
977270152 4:94908166-94908188 TCTTCTTGTCTCCTGTTACAGGG - Intronic
977706900 4:100081614-100081636 CCTTCAAGTCTCAACTTAAATGG - Intergenic
980165266 4:129218653-129218675 TCTTCTGCTCTCAAATGACAGGG + Intergenic
980410808 4:132415345-132415367 CCTTATGCTGTTAAGTTACAGGG - Intergenic
980875902 4:138661835-138661857 GCTTCTGTTCTCAAGATACCAGG + Intergenic
982025536 4:151250930-151250952 CATTCCAGTCTCAAGTTTCACGG + Intronic
984979538 4:185266166-185266188 GTTTCTAATCTCAAGTTACAAGG + Intronic
987152530 5:15056977-15056999 GGTTCTGGTCTCCAGTTGCAGGG + Intergenic
987432425 5:17852462-17852484 CCATATGGTCTCAATTTCCATGG + Intergenic
987965015 5:24861213-24861235 CCTTCTGTTTTCAAATTAGATGG - Intergenic
988011319 5:25489898-25489920 CCTTGTGCTCTTTAGTTACAGGG - Intergenic
988489674 5:31695788-31695810 CATTCTGCTCTCAAGATAGAAGG - Intronic
993754004 5:91704728-91704750 TCTTCAAGTCTCAACTTACATGG - Intergenic
994157604 5:96521343-96521365 CCTTCTGGCCTCACCTTACCAGG + Intergenic
996681624 5:126233726-126233748 CCTTCTGTTCTCAAGGTATTTGG - Intergenic
997336799 5:133114339-133114361 CTTTCTGGCCTCAAGTGCCATGG + Intergenic
997430702 5:133838635-133838657 CCATGTGGTAGCAAGTTACAGGG - Intergenic
997532566 5:134591300-134591322 CCAGCTGGCCTCAAGTTAAAGGG - Intergenic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
999412503 5:151364730-151364752 CCTTGTGCTTTCCAGTTACATGG - Intergenic
1000780799 5:165478381-165478403 CCTTGTGCTCTTAAATTACAGGG - Intergenic
1000850591 5:166335296-166335318 CCTGGTGGTCTTCAGTTACAGGG - Intergenic
1002040867 5:176513159-176513181 CCTCCTGGTGTCAAGATTCATGG - Intergenic
1003658324 6:8035551-8035573 CTTTTTGGTCTCCAGTTGCATGG - Intronic
1003932646 6:10940913-10940935 CCATCTGGCCTCAAATAACACGG - Intronic
1004975855 6:20965298-20965320 TCTTCTCTTCTCAAGATACAGGG - Intronic
1006021817 6:31121764-31121786 CCTGCTGGTCTGAACTTAAAGGG - Intronic
1006058028 6:31400173-31400195 GCTTCTGGTCTCCAGCTGCAGGG - Intronic
1011286140 6:85725283-85725305 CCTTGTGGTGATAAGTTACAGGG - Intergenic
1013105705 6:107025187-107025209 CCTTCTGGTCTCAAACTCCTGGG + Intergenic
1014821798 6:125997581-125997603 CATTTTAGTCTCAAGTTCCAGGG + Intronic
1015462278 6:133505068-133505090 CCATCTGGTCTCAAATTTTAAGG + Intronic
1015568868 6:134601596-134601618 CCTTCTAGTCTCCTGTTCCATGG + Intergenic
1016158642 6:140846761-140846783 TCTTCTTGTCTGAGGTTACATGG + Intergenic
1016225250 6:141727047-141727069 CCTTCTGTTTTCTAGTTACTGGG + Intergenic
1021120752 7:16792850-16792872 TCTTCTGGTTTCAAGTCTCAAGG + Exonic
1021230386 7:18080231-18080253 TCTTTTGGTTTCAAGTTGCATGG + Intergenic
1022458570 7:30581698-30581720 CCTTGTGCCATCAAGTTACAGGG + Intergenic
1023723517 7:43119096-43119118 TCTTCTGGTCTCAGGCTGCATGG - Intronic
1027453513 7:78359410-78359432 CATTCTGGTCACAAAATACAGGG - Intronic
1028471007 7:91206309-91206331 CCTTCATGTCTCCAGCTACAGGG - Intronic
1028709676 7:93892644-93892666 CATTCTGATGTCATGTTACAAGG + Intronic
1031160249 7:118158217-118158239 CCTTGTGCTGTCAAGTTACAGGG - Intergenic
1034965473 7:155388093-155388115 CCTTTTGGTCTCAGGTTCCTGGG + Intronic
1038331942 8:26616114-26616136 ACTTCTTGTCTAAAGTCACATGG + Intronic
1039465646 8:37783437-37783459 CCTTCTGTGCTCAAGTTTCTGGG + Intergenic
1041245836 8:55887832-55887854 ACTTCTGGCCTCAAGTTATCCGG + Intronic
1042117873 8:65451989-65452011 CTTGCTGGTCTCAACTTACCTGG + Intergenic
1042241364 8:66667326-66667348 CCTTCTGGACTCAAGATCCTAGG - Intergenic
1045223924 8:100226205-100226227 CATGCTGGTCTCAAATTCCAGGG + Intronic
1046063201 8:109163951-109163973 CCTTCAGATCTAAAGCTACATGG + Intergenic
1051961813 9:22774596-22774618 CCCTCTGGGTTCAAGCTACATGG + Intergenic
1052127607 9:24797198-24797220 CCTTCTGTTCTCAAGTAATATGG - Intergenic
1053419057 9:37965357-37965379 ACCTCTGGTCTCAACTTCCAGGG - Intronic
1057597500 9:96427528-96427550 ACTTCTGGTCCCAAGCTACCTGG - Intergenic
1062455616 9:136636145-136636167 CCTTCCGCTCCCAAGTAACAGGG - Intergenic
1186161669 X:6783149-6783171 GCTTCTGTTCTCAAGATATAGGG - Intergenic
1187453985 X:19424855-19424877 CAGTCTGGTCTCAAGCTACTGGG + Intronic
1195059905 X:101184052-101184074 CCTTCCAGTCTCATGTTCCATGG + Intergenic
1196663748 X:118294919-118294941 CCTTCCAGTCTCATGTTCCATGG + Intergenic
1197565652 X:128081699-128081721 CCTTGTGCTGTCAAGTTACAGGG - Intergenic
1198250449 X:134874753-134874775 CTTTCTGTTCTCAAGTTTGATGG - Intergenic
1198267142 X:135020565-135020587 AGTTCTGGCCTCAAGTTACCAGG - Exonic
1199321466 X:146444486-146444508 CCTTGTGCCATCAAGTTACAGGG - Intergenic
1199447206 X:147939227-147939249 ACTTCTTGTCACAAGTTATAGGG - Intronic
1199788958 X:151131660-151131682 CCTTGTGCTGTTAAGTTACAGGG - Intergenic
1201850228 Y:18472281-18472303 CTTCCTGGTCTGAAGATACATGG + Intergenic
1201883090 Y:18848096-18848118 CTTCCTGGTCTGAAGATACATGG - Intergenic