ID: 1178802684

View in Genome Browser
Species Human (GRCh38)
Location 21:35810840-35810862
Sequence CCTTCAGGCTGATTTGATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 151}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178802676_1178802684 25 Left 1178802676 21:35810792-35810814 CCCACATCATATTTTTCTCCCAC 0: 1
1: 0
2: 1
3: 24
4: 357
Right 1178802684 21:35810840-35810862 CCTTCAGGCTGATTTGATCTAGG 0: 1
1: 0
2: 0
3: 11
4: 151
1178802680_1178802684 6 Left 1178802680 21:35810811-35810833 CCACAGCATGACTTAAGGAGAAA 0: 1
1: 0
2: 2
3: 9
4: 181
Right 1178802684 21:35810840-35810862 CCTTCAGGCTGATTTGATCTAGG 0: 1
1: 0
2: 0
3: 11
4: 151
1178802677_1178802684 24 Left 1178802677 21:35810793-35810815 CCACATCATATTTTTCTCCCACA 0: 1
1: 0
2: 2
3: 37
4: 403
Right 1178802684 21:35810840-35810862 CCTTCAGGCTGATTTGATCTAGG 0: 1
1: 0
2: 0
3: 11
4: 151
1178802675_1178802684 28 Left 1178802675 21:35810789-35810811 CCACCCACATCATATTTTTCTCC 0: 1
1: 0
2: 2
3: 54
4: 390
Right 1178802684 21:35810840-35810862 CCTTCAGGCTGATTTGATCTAGG 0: 1
1: 0
2: 0
3: 11
4: 151
1178802679_1178802684 7 Left 1178802679 21:35810810-35810832 CCCACAGCATGACTTAAGGAGAA 0: 1
1: 0
2: 0
3: 23
4: 200
Right 1178802684 21:35810840-35810862 CCTTCAGGCTGATTTGATCTAGG 0: 1
1: 0
2: 0
3: 11
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178802684 Original CRISPR CCTTCAGGCTGATTTGATCT AGG Intronic
900216051 1:1482244-1482266 CCTTCAGGCGGATCTGCTCGCGG - Exonic
900223171 1:1520247-1520269 CCTTCAGGCGGATCTGCTCGCGG - Exonic
900491619 1:2952153-2952175 CGTCCAGGCAGGTTTGATCTTGG - Intergenic
900820872 1:4887184-4887206 CTTTGAGGCTGTTTTGCTCTGGG - Intergenic
900913781 1:5620341-5620363 TCTTCAGGCTGCTGTGGTCTGGG + Intergenic
901398686 1:9001188-9001210 TCTTCAGGCTCATTCGAGCTGGG + Intergenic
902822424 1:18951401-18951423 CCTCCAGGCTGACTTCAACTGGG + Intronic
906940386 1:50250678-50250700 CCTTCAGGAAGAGTTGATCTGGG - Intergenic
908300596 1:62757892-62757914 CTTTCAGTCTGATTTGGACTGGG - Intergenic
908950612 1:69558293-69558315 CCTTCAGTTTGCTCTGATCTTGG + Intergenic
911231273 1:95364005-95364027 CTCTAAGGCTGATTTGATTTGGG + Intergenic
912021482 1:105112649-105112671 CTTTTAGCCTGATTTGAACTGGG - Intergenic
914746620 1:150506037-150506059 CCTTAGGGCTGATTCCATCTAGG - Intronic
916324465 1:163541599-163541621 CTTTTAAGCTGATGTGATCTGGG - Intergenic
917086307 1:171308479-171308501 CCTTTAGCCTGATTTGGACTGGG - Intergenic
918338269 1:183543896-183543918 CCCTCAGTTTGATTTCATCTGGG - Intronic
919363009 1:196619079-196619101 TCTTCAGGCTGGAGTGATCTGGG - Intergenic
920170168 1:204067107-204067129 CCTTCAGGCTGACCTGAGGTGGG - Intergenic
922252247 1:223860160-223860182 CCTTCAGACTGAATAGCTCTCGG - Intergenic
923001085 1:230006898-230006920 CATCCAGGCTGATCTGAGCTTGG + Intergenic
923435146 1:233960958-233960980 CCATGAGGTTGTTTTGATCTGGG - Intronic
924332858 1:242957418-242957440 CCTTCAGCCTGTTTTTATGTTGG + Intergenic
924599634 1:245477383-245477405 CCTTCAGGCAGCTTAGATCCTGG + Intronic
1065302251 10:24333373-24333395 CCTACATGCTGAGTTTATCTGGG + Intronic
1066659355 10:37725524-37725546 CCTTCAGGAAGATGTGTTCTTGG - Intergenic
1068209445 10:53901182-53901204 TTTTCAGGGTGATTTCATCTTGG + Intronic
1070226795 10:74516261-74516283 TCTCCAGGCAGATCTGATCTAGG + Intronic
1070292785 10:75131110-75131132 CCTGCAGGGTGATTTCATGTGGG - Intronic
1070758694 10:79009571-79009593 CCTGCACTGTGATTTGATCTGGG + Intergenic
1075085040 10:119409283-119409305 CCCACAGCCTGATTTCATCTTGG + Intronic
1079149629 11:17885872-17885894 CCTAAAGGCTGAGGTGATCTGGG - Intronic
1081771878 11:45655308-45655330 GCTGCAGGATGATTTGTTCTAGG - Intronic
1085356278 11:75840586-75840608 AATTCAGACTGATTTGAACTTGG + Intronic
1085710973 11:78829051-78829073 CCCTCAGGCTGTCTTCATCTAGG - Intronic
1086149732 11:83595555-83595577 AATTCAGGCTGATTTGCTGTAGG + Intronic
1088526712 11:110763620-110763642 CCTGCAGCCTGATTTCAGCTGGG + Intergenic
1090792378 11:130102532-130102554 CCTGCAGCCAGATTTGATCCTGG + Intronic
1091357954 11:134952412-134952434 CCTTCAGGCTGTTTTCATCCTGG + Intergenic
1091410601 12:236918-236940 CCTCCAGGGTAATCTGATCTTGG - Intronic
1092536884 12:9396740-9396762 GCCTGAGGCAGATTTGATCTCGG + Intergenic
1092557795 12:9576570-9576592 GCCTGAGGCAGATTTGATCTCGG - Intergenic
1094513499 12:31111340-31111362 GCCTGAGGCAGATTTGATCTTGG + Intergenic
1100159296 12:91839203-91839225 ACTTCAGGATCATTTGGTCTGGG - Intergenic
1103230133 12:119322754-119322776 CTTTCAGGCAGATTTAATTTAGG - Intergenic
1108418994 13:50229428-50229450 CCTTCAGGCTTCTTTGAGTTGGG + Intronic
1108848801 13:54703857-54703879 CTTTTAGCCTGATTTGAACTGGG - Intergenic
1109467055 13:62748946-62748968 CCTGCAGACTCATTTGATATAGG + Intergenic
1110546268 13:76759329-76759351 CCTTCTGGCTGTTTTGATGTGGG - Intergenic
1110785962 13:79526343-79526365 ATTTCAGGCTTATTTGATGTGGG - Intronic
1113028931 13:105972594-105972616 CCTTTTGGCTGTTTTGCTCTTGG - Intergenic
1113662779 13:112118428-112118450 CCTTCAGGGTGACTTGGGCTGGG + Intergenic
1116735162 14:48680496-48680518 CATACAGGCTTATTTGATCATGG - Intergenic
1121364752 14:93299023-93299045 CCTTCAGGATGAACTGATTTGGG + Intronic
1126086365 15:45014184-45014206 CTTTTAGCCTGATTTGAACTGGG - Intergenic
1127052953 15:55103789-55103811 CCTTCAGGCTGAAGTATTCTAGG - Intergenic
1127706111 15:61548641-61548663 CCTCCAGGCTGCTATGCTCTTGG + Intergenic
1128006702 15:64249198-64249220 TCTTCAGGCTAATTTAATGTGGG - Intronic
1131742746 15:95412054-95412076 CCTTCAGGCAGAAATAATCTTGG + Intergenic
1137792500 16:51186768-51186790 CCTTCCCCCTGATTTGATCTGGG + Intergenic
1139026835 16:62828533-62828555 CCTTCACCATGATTTGTTCTAGG + Intergenic
1142879269 17:2871647-2871669 CCTTCATGCTGATTTCATTGGGG + Intronic
1143633377 17:8151214-8151236 CCTCCAGGCTAATTTTATCCGGG + Intronic
1149775607 17:59354558-59354580 CCAGCTGGCTGATTTGACCTAGG + Intronic
1151438672 17:74114445-74114467 CCTCCAGGCAGATCTGAACTGGG + Intergenic
1152714012 17:81889701-81889723 CCTTCAAGCTGGTCTGATATCGG - Intronic
1154496958 18:14968729-14968751 GCTTCAGGCTGTTTTCATCCGGG - Intergenic
1160568619 18:79801673-79801695 CCTTCAGGCTGATCTGAATGTGG + Intergenic
1162237248 19:9319096-9319118 CTTTTAGCCTGATTTGAACTGGG + Intergenic
1162294484 19:9803688-9803710 CCTACAGGCTGAATCGATTTTGG + Intergenic
1162716157 19:12635733-12635755 CATTAAGGTTGCTTTGATCTAGG + Intronic
925234442 2:2265838-2265860 CCTTGAGGCTGATGGGATCTGGG + Intronic
928209990 2:29316404-29316426 CCTGCAGTCTAATTTGCTCTGGG - Intronic
928249605 2:29663903-29663925 CCTTCAGGGTGGTTTCATCATGG - Intronic
929002296 2:37359603-37359625 GCTTCAGGCTGACTGGGTCTTGG + Exonic
929033317 2:37669066-37669088 CTTTCAGTCAGATTTTATCTAGG - Intronic
929368314 2:41189232-41189254 CCTTCAGGGTGACTTGATTTTGG - Intergenic
930510862 2:52343352-52343374 ACTTCAGGATTACTTGATCTGGG + Intergenic
930917399 2:56710018-56710040 CCTGGAGGCAGATTTCATCTTGG + Intergenic
933162333 2:79039258-79039280 CTTTCAGGCTGATTTAATTAAGG + Intergenic
933241672 2:79928638-79928660 GCTTCAGGCTGATTGGAAATTGG - Intronic
933293383 2:80462543-80462565 CATTTATGCTGATTTCATCTAGG + Intronic
934867319 2:97824703-97824725 CTTTTAGCCTGATTTGAACTGGG - Intronic
934988381 2:98903208-98903230 GCTTCAGGCTGTTTTGATCAAGG - Intronic
936036824 2:109120068-109120090 CCTTCAGGCTGCATAGTTCTTGG - Intergenic
936070613 2:109368897-109368919 CCCTTAGGCTGATCTGAGCTGGG + Intronic
940391072 2:153133198-153133220 ACTTCATGCTGATTTGACCGTGG + Intergenic
940457804 2:153923480-153923502 TCTTCATGTTGATTTGATTTTGG + Intronic
941060915 2:160845771-160845793 CTTTCAGGCTTTTTTGATGTAGG - Intergenic
943133938 2:183889052-183889074 CTTTTAGGCTGATTTGGACTGGG - Intergenic
943152818 2:184135864-184135886 CGTTCAGGATGATTTACTCTTGG + Intergenic
943339652 2:186664602-186664624 ACTGCAGGCTGATTTCATCGGGG + Exonic
946101083 2:217324126-217324148 CTCTCTGGCTGATTTTATCTTGG + Intronic
946682727 2:222233891-222233913 CCCTCAGGCTGATAGGACCTGGG + Intronic
946911894 2:224470522-224470544 CCTTCTGGCTAATTTGACATAGG + Exonic
947666846 2:231911289-231911311 CCTCCAGGCTGTTGTGATTTGGG + Intergenic
1172781149 20:37437690-37437712 CCGTCAGGCTGATGACATCTGGG - Intergenic
1173109014 20:40167940-40167962 CCTTGAGGGTAACTTGATCTTGG - Intergenic
1173200105 20:40948239-40948261 CCTTTAGGACGATTTCATCTTGG - Intergenic
1177838600 21:26212521-26212543 CCTTCAGGCTGTTTTATGCTTGG + Intergenic
1178802684 21:35810840-35810862 CCTTCAGGCTGATTTGATCTAGG + Intronic
1179923113 21:44517876-44517898 CTTTCAGTCTGATGAGATCTGGG + Intronic
1181552712 22:23649847-23649869 CCTTAAGACTGATTTGTCCTGGG - Intergenic
950328067 3:12131498-12131520 AAATCAGGCTGATTTGATATTGG - Intronic
950412396 3:12847600-12847622 CCTTCAGGCTGACCTGGGCTTGG + Intronic
952374023 3:32750158-32750180 CATCCAGGCTGGTGTGATCTCGG - Intronic
960877052 3:122307563-122307585 CCATCAAGCTGATCAGATCTTGG - Intergenic
962755348 3:138461831-138461853 CCTCCAGGCTACTTTGTTCTTGG - Intronic
964890719 3:161531522-161531544 CCTTCCAGCTGACTTGTTCTTGG + Intergenic
965882657 3:173405216-173405238 CCTTCTGAATGATTTGATCCTGG + Intronic
966067805 3:175837431-175837453 CCTTCAGACCCATTTGAGCTTGG + Intergenic
967101729 3:186221436-186221458 CCTTCAGGCTGATTTGGCGGAGG + Intronic
967675434 3:192293464-192293486 CCTCAAGGCTAATTTGATTTAGG + Intronic
968589237 4:1449499-1449521 CCTGCAGGCTGATCTGGGCTGGG + Intergenic
969073831 4:4561323-4561345 CCTTCAGGCTGTTTTAGCCTTGG + Intergenic
969315585 4:6379848-6379870 CCTTGAGTCTGACTTTATCTTGG - Intronic
974133684 4:57788290-57788312 CCTTGAGGCTGATTCTATATTGG - Intergenic
978001986 4:103567451-103567473 CTTTCAGACTGATTAGATGTGGG + Intergenic
978626864 4:110695264-110695286 CTTTCAGGCTGCTTTTATTTTGG + Intergenic
978628195 4:110711709-110711731 CTTTCAGGCACATTAGATCTTGG + Intergenic
979431052 4:120631488-120631510 CCATCAGGCTGTTTTAATATTGG + Intergenic
980484601 4:133439390-133439412 GCTTCAGGTTGCTTTGCTCTGGG + Intergenic
982837987 4:160146836-160146858 CCATCAGCCTCATTTCATCTTGG + Intergenic
983071839 4:163276958-163276980 CTTTCAGGTTGATATGATCGGGG + Intergenic
983308783 4:166028422-166028444 GCTTCAGGCTGATATGACCTTGG + Intronic
985222236 4:187719711-187719733 CCTACATGCTTATTTGATCATGG - Intergenic
985849467 5:2378224-2378246 CTCTCATGCTGCTTTGATCTTGG + Intergenic
993795217 5:92258496-92258518 CCTTGAGGTTGATTTTATTTTGG + Intergenic
997405502 5:133643486-133643508 CCTTCAGGCTGATGTGTGGTTGG + Intergenic
998943040 5:147305467-147305489 CCTTCAGGCTGTTTTAGACTTGG + Intronic
1001427253 5:171630756-171630778 CCTTCAGGGTGATTTACTCAGGG + Intergenic
1004827510 6:19439108-19439130 CCTTCAGTCTATTTTGATCTAGG - Intergenic
1005309806 6:24548538-24548560 CCTTCAGGCTGTTTTAGGCTTGG + Intronic
1008768298 6:54946855-54946877 CCTTCAGGATGAATTCATCAGGG - Intergenic
1009395242 6:63192494-63192516 CCTTCAGGCTGGTGTCACCTTGG - Intergenic
1012245202 6:96918379-96918401 CCTTCAGGCTGATATGGCTTGGG + Intergenic
1012571899 6:100739930-100739952 CCTTCAGTCAGCTCTGATCTTGG + Intronic
1015586271 6:134779528-134779550 ACTTCAGGCTGAGTTCAGCTGGG - Intergenic
1016742609 6:147543794-147543816 TCTTCAGGATGAGGTGATCTGGG + Intronic
1022538484 7:31113536-31113558 TCTGCAGGCTGATTTCCTCTTGG - Intergenic
1032059055 7:128708420-128708442 TCTTCAGGCTGATTTGACGAAGG - Intergenic
1036961670 8:13251027-13251049 CCTTCAGGGTACCTTGATCTTGG - Intronic
1037322167 8:17654430-17654452 CCTTCAGGCTGGGGTGTTCTTGG - Intronic
1038823535 8:30976118-30976140 CCTTCAAGCTGATTTGAGAGAGG + Intergenic
1041927482 8:63251617-63251639 AGTTCAGGCTGAGGTGATCTCGG + Intergenic
1042772070 8:72391568-72391590 CTTTTAGGCTGATTTGAACTGGG - Intergenic
1042919767 8:73909626-73909648 CTTTTAGCCTGATTTGAACTGGG - Intergenic
1045996216 8:108365214-108365236 TCGCCAGGCTGATGTGATCTCGG + Intronic
1048092537 8:131256805-131256827 CCTTGAGACTGGTTAGATCTGGG - Intergenic
1050126944 9:2367402-2367424 ACTCTAGGCAGATTTGATCTAGG - Intergenic
1050482019 9:6097309-6097331 CCTTCAGGCTGTTTTTGGCTTGG - Intergenic
1052242390 9:26290153-26290175 GCTTCAGGCAGCTCTGATCTTGG - Intergenic
1053512424 9:38699729-38699751 CCTTCAGGATCATTTGCTTTGGG - Intergenic
1060716679 9:125937285-125937307 CCTTCTGGCTGTTCTGAACTAGG + Intronic
1061248297 9:129412919-129412941 CCTTCAGGCCCATCTGATCCCGG + Intergenic
1061447750 9:130650849-130650871 TCTTCAGGCTGGAGTGATCTCGG - Intergenic
1061526341 9:131167079-131167101 CCTACACGTTGATTGGATCTAGG + Intronic
1192306122 X:69961416-69961438 TCTGCAGCCTGATTTGTTCTTGG - Intronic
1197516669 X:127440624-127440646 CCAAGAGGCTGAATTGATCTGGG + Intergenic
1201473038 Y:14354306-14354328 CTTTTAGCCTGATTTGAACTGGG + Intergenic
1201530690 Y:14987071-14987093 CTTTCAGGCTGATTTGGACTGGG - Intergenic
1201911220 Y:19135162-19135184 CTTTTAGCATGATTTGATCTGGG - Intergenic
1202391935 Y:24379952-24379974 CCTTCAGCCTGTTTTTATGTTGG - Intergenic
1202478850 Y:25290165-25290187 CCTTCAGCCTGTTTTTATGTTGG + Intergenic