ID: 1178803526

View in Genome Browser
Species Human (GRCh38)
Location 21:35818983-35819005
Sequence CTGAGCAGGACTGAACCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 186}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178803523_1178803526 7 Left 1178803523 21:35818953-35818975 CCTATACACCAGTTGGAATAGGC 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1178803526 21:35818983-35819005 CTGAGCAGGACTGAACCTGCAGG 0: 1
1: 0
2: 3
3: 15
4: 186
1178803521_1178803526 8 Left 1178803521 21:35818952-35818974 CCCTATACACCAGTTGGAATAGG 0: 1
1: 0
2: 0
3: 8
4: 73
Right 1178803526 21:35818983-35819005 CTGAGCAGGACTGAACCTGCAGG 0: 1
1: 0
2: 3
3: 15
4: 186
1178803524_1178803526 -1 Left 1178803524 21:35818961-35818983 CCAGTTGGAATAGGCTGAAGAAC 0: 1
1: 0
2: 0
3: 9
4: 113
Right 1178803526 21:35818983-35819005 CTGAGCAGGACTGAACCTGCAGG 0: 1
1: 0
2: 3
3: 15
4: 186
1178803519_1178803526 25 Left 1178803519 21:35818935-35818957 CCGGTGGAAATGGGCTGCCCTAT 0: 1
1: 0
2: 1
3: 12
4: 124
Right 1178803526 21:35818983-35819005 CTGAGCAGGACTGAACCTGCAGG 0: 1
1: 0
2: 3
3: 15
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178803526 Original CRISPR CTGAGCAGGACTGAACCTGC AGG Intronic
900337018 1:2169396-2169418 CTTTGCAAGACTGAACCTGCGGG + Intronic
900366582 1:2314244-2314266 CTGTGCAGGAGTGACCCTGGAGG - Intergenic
900416891 1:2539490-2539512 CAGTGCAGGCTTGAACCTGCAGG + Intergenic
900421825 1:2559077-2559099 CCAGGCAGGACTGCACCTGCGGG + Intronic
900617144 1:3570603-3570625 CTGAGCAGGGCTGGAGCAGCGGG - Intronic
901855481 1:12041822-12041844 TTGAGCAGGTCTTACCCTGCAGG - Intergenic
902176508 1:14654746-14654768 CTGTGCAAGACTGGACATGCTGG + Intronic
902337894 1:15764493-15764515 CAGAGCTGGCCTGAACCTCCAGG + Exonic
903405029 1:23088886-23088908 CTGAGGAGAACTGAGCCCGCTGG - Exonic
903650312 1:24917969-24917991 CTCAGCAGGAGGGAACCAGCAGG + Intronic
904081685 1:27876416-27876438 CTGAGGACGACTGAACCTGTGGG + Intronic
904152617 1:28454908-28454930 CTGAGCTGGTCTCAAACTGCTGG - Intronic
904210501 1:28884039-28884061 CTGAGAAGGCCTGGACCTCCAGG - Intergenic
904310273 1:29624904-29624926 CTGAGCTGGACTGTGCCTCCAGG - Intergenic
907312937 1:53550062-53550084 ATGAGCTGGGCTGAACCTGGTGG - Intronic
909387390 1:75074745-75074767 CTGAGCTGGAAGGAACCTGCTGG - Intergenic
910462849 1:87467141-87467163 CTGAGCAGGACTTCACCTTATGG + Intergenic
910859778 1:91732142-91732164 GAGAGCAGGAATGAACCTGGGGG + Intronic
911470576 1:98313111-98313133 CTGAGCAGAGCTGAACTTTCAGG + Intergenic
912511907 1:110195439-110195461 TCGTGCAGGACTGAGCCTGCTGG + Intronic
913162201 1:116154549-116154571 CTGAGCTGGACAGAAGCTGTGGG - Intergenic
916877687 1:168987385-168987407 CTGAGCAAGCCTGCACCTTCAGG - Intergenic
917703827 1:177611595-177611617 ATGAACAGGACTGAGCCTGTAGG + Intergenic
918666795 1:187161440-187161462 CTGAGGCTGATTGAACCTGCAGG - Intergenic
922191114 1:223319495-223319517 CTGAGAGGGACAGAGCCTGCTGG - Intronic
924060616 1:240170323-240170345 CTGAGCAGAGCTGATCCTGAGGG + Intronic
924163238 1:241255502-241255524 ATGAGCAGGCCTGAACTTGAGGG + Intronic
924592220 1:245414476-245414498 CTGAGCAGGGCTGAAGCCGTGGG + Intronic
1064261331 10:13788589-13788611 CTTAGCAGGACTGAATCTTAGGG + Intronic
1067703990 10:48593395-48593417 CTGAGGATGCCTGAAACTGCAGG + Intronic
1069557539 10:69407797-69407819 CGGAGCAGGAGTGTGCCTGCAGG - Intronic
1072622439 10:97089004-97089026 CTGCCCAGGAGTGCACCTGCAGG - Intronic
1072695754 10:97601634-97601656 CTGAGCAGTGCTTGACCTGCGGG + Intronic
1072797530 10:98367338-98367360 ATGAGAAAGACTCAACCTGCGGG - Intergenic
1073120580 10:101120215-101120237 TTGAGCAGGGCTGAACCAGAAGG + Intronic
1074006717 10:109433233-109433255 TAGAGCAGAACTGAATCTGCAGG - Intergenic
1076224941 10:128766596-128766618 CTGAGCAGGCCCAAACCTCCTGG + Intergenic
1077309689 11:1882838-1882860 TTGAGCAGGACTGAACCTGGAGG - Intronic
1078068677 11:8094408-8094430 CTGAGCAGGACTTCACTTCCTGG - Intronic
1078648631 11:13166455-13166477 CTGAGCAGGAGTGACCATCCAGG - Intergenic
1081622170 11:44625036-44625058 ATGAGCAGGACTGCAGCTGGGGG + Intergenic
1081771602 11:45653534-45653556 CAGAGCAGGCCTGCACTTGCAGG - Intronic
1082640763 11:55657880-55657902 CTGAGCAGGGCTGGAGCTGTGGG - Intergenic
1083443213 11:62690407-62690429 CTGGGCAGCTCTGAACCTGCTGG - Exonic
1083633308 11:64106742-64106764 CAGAACAGGACTGAGGCTGCGGG - Intronic
1085532383 11:77199598-77199620 CTGGGCAGGACTGACCCCGGCGG + Exonic
1085690930 11:78663148-78663170 CTGAGGAAGGCTGAGCCTGCTGG - Intronic
1087420367 11:97916871-97916893 CTGAGCAGCAATGTACATGCTGG + Intergenic
1088437241 11:109828078-109828100 CTGAGCAGAAATGAAACTTCAGG + Intergenic
1088707535 11:112477373-112477395 CTGAGCAGGACTCAGGCTGGTGG - Intergenic
1089402029 11:118169825-118169847 CTAAGCAGGACAGAGCCTACAGG + Intronic
1089638021 11:119828950-119828972 CTGAGCAGGACTCAACTTCTGGG + Intergenic
1090749269 11:129731656-129731678 CAGGGCAGTTCTGAACCTGCCGG + Intergenic
1090966965 11:131607239-131607261 CTCAGGAGGCCTGAAGCTGCTGG + Intronic
1091123959 11:133080190-133080212 CTGACCTGGAATCAACCTGCGGG + Intronic
1091590932 12:1842657-1842679 TTCACCAGGACTGAGCCTGCTGG - Intronic
1092405862 12:8221848-8221870 CTGAGGAGGAGGGAACCTGAAGG + Exonic
1100609721 12:96181316-96181338 CTGAACAGGACAGGAGCTGCAGG + Intergenic
1102146479 12:110658574-110658596 CTGAGCAGGAGTGAGCCCGATGG - Intronic
1102174330 12:110865082-110865104 GTAAGCAGGACTAAACCAGCTGG - Intronic
1106199917 13:27527662-27527684 CGGAGCTGGGCTGAACCAGCTGG - Intergenic
1106241080 13:27914157-27914179 TTAAGCAGGACTGTACCTGGGGG + Intergenic
1107608775 13:42090982-42091004 CTCACCAACACTGAACCTGCAGG + Intronic
1109213849 13:59565291-59565313 CTGAACAGGACTTTAACTGCAGG - Intergenic
1114188779 14:20424995-20425017 CTGGGTAGGACTGGACATGCAGG - Intergenic
1114615697 14:24067157-24067179 CTGAGAAGGACTAATACTGCAGG - Intronic
1122419519 14:101566664-101566686 CTGAGCAGGTCTGCACCTGTAGG + Intergenic
1125374159 15:39011264-39011286 CTTACCAGGACTGAAACTGGTGG - Intergenic
1125768823 15:42151974-42151996 CTGGGCAGGACTCATCCTGCAGG + Intronic
1125903763 15:43371426-43371448 CTGCGCCGGACAGTACCTGCAGG - Exonic
1126698991 15:51350980-51351002 CTGAGCAGGGTAGAACCTTCTGG + Intronic
1127879972 15:63148507-63148529 CTGAGCAGGGCTGAAGCTGAGGG + Exonic
1128306769 15:66603964-66603986 CTGGGCAGGACTAGACCTTCTGG - Intronic
1129366365 15:75057916-75057938 CTGAGCAGGACTGAACTGTGTGG + Intronic
1129386804 15:75200927-75200949 CAGAGCAGGCCTGAGGCTGCAGG - Intronic
1130256547 15:82328513-82328535 CTGGGCAGGACTGGGCCTGGTGG - Intergenic
1130598405 15:85261475-85261497 CTGGGCAGGACTGGGCCTGGTGG + Intergenic
1130664541 15:85858810-85858832 CTGAACAGGTCTGAACCCCCAGG + Intergenic
1131228893 15:90646391-90646413 CTGAGCAGGAGTGCTCCTCCAGG - Intergenic
1131423493 15:92326646-92326668 CAGAGCAGGGCCTAACCTGCAGG + Intergenic
1131974432 15:97929970-97929992 CTGGGTAGGACTGAAACTGCAGG + Intergenic
1132198202 15:99929567-99929589 CTGAGCTGAAATGAAGCTGCTGG - Intergenic
1133009704 16:2904426-2904448 CGGAGCGGGACTGAGGCTGCGGG - Intergenic
1134135980 16:11676537-11676559 CTGGGCAGGCCTGACCTTGCTGG + Exonic
1135688097 16:24514518-24514540 CTGCCCAGGACTGACCCTGAAGG - Intergenic
1137508088 16:49074025-49074047 CTGAGCTGGTCTGAAACTCCTGG - Intergenic
1137590015 16:49687726-49687748 CGCAGCAGGACGGAACCTGGTGG - Intronic
1137700536 16:50494771-50494793 CTGAGAATGACTTAACCTCCTGG - Intergenic
1139611850 16:68064763-68064785 ATGAGCAAGACAGGACCTGCTGG - Intronic
1139949842 16:70663467-70663489 CTGGCCAGGACGGAGCCTGCAGG - Exonic
1140479160 16:75253265-75253287 GAGAGCAGGTCTGAACCAGCGGG + Intronic
1143315928 17:6033470-6033492 CAGAGCAGAACTGAACCTGCAGG + Intronic
1143563085 17:7706506-7706528 CTGGGTAGGACAGAACCTTCGGG + Intronic
1144886296 17:18464894-18464916 CTCATCAGGACTGAGCCTGTGGG - Intergenic
1145145909 17:20479417-20479439 CTCATCAGGACTGAGCCTGTGGG + Intergenic
1145763161 17:27439320-27439342 CTCATCAGGACTGAGCCTGTGGG - Intergenic
1146009889 17:29185450-29185472 CTAAGCAAGACTGAAACTCCAGG + Intergenic
1146523974 17:33550109-33550131 CTGAGCTGGACTGGACCTCATGG - Intronic
1147150706 17:38511921-38511943 CTGAGCTGGGCTGTTCCTGCAGG + Exonic
1147327411 17:39676114-39676136 CACAACAGGACTGAACCTGGTGG + Intronic
1147553399 17:41460995-41461017 CTGAGCAGTACAGTCCCTGCAGG - Intronic
1147555819 17:41478450-41478472 CTGAGCTGGACACCACCTGCTGG + Exonic
1148274479 17:46291369-46291391 GTGAGCAGGACTAAAACTGCAGG + Intronic
1150408576 17:64923186-64923208 GTGAGCAGGACTAAAACTGCAGG - Intergenic
1150760211 17:67954589-67954611 GTGAGCAGGACTAAAACTGCAGG - Intronic
1151710158 17:75799907-75799929 CTGAGCAGGTCTCAAACTCCTGG - Intronic
1153652134 18:7250188-7250210 GTGAGCTGGATTGAATCTGCAGG - Intergenic
1153908850 18:9688573-9688595 CTCAGTGGGACTGAACCTCCCGG - Intergenic
1154045094 18:10896827-10896849 GTGAGCAGAACTGAACCAACAGG - Intronic
1157515061 18:48304945-48304967 CTGAACAGGCCTGACTCTGCAGG + Intronic
1158312816 18:56177130-56177152 CTGAGCAGGACGGCAGGTGCGGG + Intergenic
1160513035 18:79463168-79463190 CTGAGCACCACTGAAGGTGCAGG - Intronic
1161470967 19:4456634-4456656 CTGAGCAGGGCTGAGCCAGCTGG - Intronic
1162138204 19:8569284-8569306 CTGAATATGACTCAACCTGCTGG + Intronic
1163805366 19:19393532-19393554 GTGAGCAGGACTGACACAGCTGG + Intronic
1166496610 19:43307451-43307473 CTCACCAGGACTGAATCAGCTGG - Intergenic
1168406672 19:56114233-56114255 CTGGCCAGGACTGAGCCTGTCGG - Intronic
925367400 2:3320019-3320041 CAGAGCAATACTGCACCTGCGGG + Intronic
928283215 2:29966629-29966651 CTGGGCAGGAATGAACGGGCTGG - Intergenic
929127493 2:38535061-38535083 TTGAGCAGGACTGAATCTCTAGG - Intergenic
931769953 2:65488913-65488935 CCCAGCAGGAATGAACCTGAGGG - Intergenic
934780515 2:96966866-96966888 CTCACCAGGACCGACCCTGCTGG + Intronic
942888043 2:180952593-180952615 GTAAGCAGGACTGAATCTGAAGG - Intergenic
946154998 2:217801415-217801437 CAGCACGGGACTGAACCTGCTGG + Exonic
947009740 2:225552615-225552637 CTGACCAGAACTGACCATGCTGG + Intronic
947261006 2:228222277-228222299 CTGAGCAGAACTGAAGGTTCTGG - Intergenic
947357966 2:229316501-229316523 CTGCACAAGACTGAGCCTGCTGG + Intergenic
1173009844 20:39172045-39172067 CTGAGGAAGACTTCACCTGCAGG - Intergenic
1174712963 20:52726755-52726777 CTGAGCAGGACTGAAAATAGAGG + Intergenic
1174847100 20:53953262-53953284 TGGAGAAGGATTGAACCTGCTGG + Intronic
1176248939 20:64110928-64110950 CTTGGGAGGACTTAACCTGCAGG - Intergenic
1178803526 21:35818983-35819005 CTGAGCAGGACTGAACCTGCAGG + Intronic
1181169814 22:21001713-21001735 CTGAGGAGGCTTGAACCTGTGGG - Intronic
1182070305 22:27458762-27458784 CTGGGAAGGGCTGAGCCTGCAGG + Intergenic
1184351378 22:43946198-43946220 CTGAGCAGGACTGGCCCTGCTGG + Exonic
1185064060 22:48621861-48621883 CGGAGCAGGGCTGCATCTGCAGG + Intronic
954381557 3:50221623-50221645 TTGGGCAGGCCTGAACCAGCTGG + Intergenic
954629075 3:52038543-52038565 CAGAGCAGGCCTGGCCCTGCAGG + Intergenic
954794110 3:53152829-53152851 CTGAGCAGGCCTCTACCTGAGGG + Intergenic
955472286 3:59298166-59298188 CTGATGACGACTGACCCTGCAGG - Intergenic
959568243 3:107854679-107854701 ATCAGCAGGATTGAACCTGAAGG + Intergenic
959730657 3:109597829-109597851 CTGAACGGCACTGAACTTGCAGG + Intergenic
960637828 3:119801539-119801561 GGGAGCAGGACTGCAGCTGCTGG + Intronic
962135401 3:132726357-132726379 CTGAGCAGGACTAAACAGCCTGG - Intergenic
965398922 3:168194765-168194787 ATGAGCAGGACTGAAACTGGTGG - Intergenic
969217783 4:5735856-5735878 CAGAGCAGGAAGGACCCTGCTGG - Intronic
970022646 4:11586521-11586543 CTGGGCATGACTGAAAATGCTGG + Intergenic
971197477 4:24483179-24483201 CTGAGCAGGTCTGCACATGAGGG + Intergenic
976829130 4:89293665-89293687 CTGAGCAAGGGAGAACCTGCAGG - Intronic
984587567 4:181580842-181580864 CTGAGCAATTCTGAACCTACAGG - Intergenic
985475615 5:77235-77257 CTGAGCCAGACCCAACCTGCTGG - Intergenic
985553498 5:544805-544827 CTGAGCAGCACAGGACCTGGAGG - Intergenic
987450301 5:18075523-18075545 CTGGACAGCACTGAAGCTGCCGG - Intergenic
990680188 5:58233935-58233957 CTTACCAGAACTCAACCTGCTGG + Intergenic
992494876 5:77282315-77282337 CTGAGCTGCACTTATCCTGCTGG - Intronic
994232387 5:97322918-97322940 CTGAGGAGGAGTCTACCTGCAGG + Intergenic
995423868 5:111997463-111997485 CTGAGCATAACTAACCCTGCTGG + Intronic
1001079525 5:168656995-168657017 ATGAGGACAACTGAACCTGCTGG + Intergenic
1002087362 5:176784632-176784654 CTGAGCAGGACGATGCCTGCAGG + Intergenic
1002644192 5:180645229-180645251 TTGAGAAGGGCTGGACCTGCGGG + Intronic
1006654076 6:35575565-35575587 ATGAGCTGGACTTAAGCTGCTGG + Exonic
1007362427 6:41368583-41368605 CTGAACCGGTCTCAACCTGCAGG + Intergenic
1011263140 6:85489163-85489185 CTGTGCAGGAGTGACTCTGCAGG + Intronic
1012445996 6:99307599-99307621 CTAAGCAGGAGTGCACTTGCAGG + Intronic
1014415936 6:121184645-121184667 ATGACCAGCATTGAACCTGCTGG - Intronic
1019455108 7:1122878-1122900 CTGAGGAGGACAGAAGCGGCAGG + Intronic
1020406230 7:7838582-7838604 ATGACCAGGAATGAACTTGCTGG - Intronic
1021617451 7:22517520-22517542 CAGGGCAGGACTGAACCTCAGGG - Intronic
1022485595 7:30775183-30775205 ATGAGCGTGACTTAACCTGCAGG - Intronic
1022673367 7:32476546-32476568 CTGAGAAGTAATGCACCTGCAGG + Intergenic
1022927038 7:35066934-35066956 CAGGGCAGGACTGAACCTCAGGG - Intergenic
1028375223 7:90138589-90138611 CAGGGCAGGACTGAACCTCAGGG + Intergenic
1031140094 7:117932811-117932833 CTGAACAGAACTTACCCTGCTGG - Intergenic
1033669060 7:143472388-143472410 CTTATCAGGACTGAAACTGGTGG - Intergenic
1034161500 7:148997165-148997187 CTGAGCAGGACAGCTCCTCCAGG + Intergenic
1035360866 7:158313517-158313539 CTGAGCAAGACTGGAGATGCAGG + Intronic
1038361780 8:26886775-26886797 CTTAACAGGAATGAATCTGCTGG - Intergenic
1038708916 8:29922513-29922535 CTGAGCAGGACAGCACTGGCTGG - Intergenic
1041591653 8:59593611-59593633 CTGAGAGGGACGGAACCTGACGG - Intergenic
1043795796 8:84537258-84537280 CCAAGCAGGTCTGAAACTGCTGG - Intronic
1044327667 8:90877939-90877961 ATGAATAGGACTTAACCTGCTGG - Intronic
1045016057 8:98002944-98002966 CTGAGCATGACTGGACGTGCGGG - Intronic
1048219054 8:132524808-132524830 CTGAGCAGGAATAAAGCTGGAGG - Intergenic
1048354176 8:133640136-133640158 CTGAGAAGGACTCAACATGGAGG + Intergenic
1049089258 8:140501997-140502019 CTGAGCACCACTGGATCTGCAGG - Intergenic
1049303883 8:141887272-141887294 CTCACCAAGACTGAATCTGCTGG + Intergenic
1049527218 8:143133466-143133488 CTGGGCACCACTGAAACTGCGGG - Intergenic
1051149409 9:14064133-14064155 GTGAGCAGGACAGAACAAGCAGG + Intergenic
1051767015 9:20535672-20535694 CTGACCAGCCCTGAACCAGCAGG + Intronic
1052553930 9:29988252-29988274 ATGAGCCAGACTGAAGCTGCAGG - Intergenic
1056615275 9:88160203-88160225 CTGTGCAGGATGGAACCTGTAGG - Intergenic
1058583465 9:106483107-106483129 CTCAGCAAGTCTGTACCTGCAGG - Intergenic
1061476895 9:130873734-130873756 CTGTGCAGGACAGAGCCTGATGG + Intronic
1061837900 9:133341496-133341518 CTGAGCACGCCTGAGCCTCCGGG - Exonic
1062117313 9:134816458-134816480 CTGGGCAGGACTGGGCCTGGAGG + Intronic
1186384914 X:9100407-9100429 CTCAGCTGGGCTGAACCTGCAGG + Intronic
1186463265 X:9765309-9765331 CTGAGCAGGTCCCAACCCGCGGG + Intronic
1188105905 X:26146350-26146372 CTCAACATGACTGAACGTGCAGG - Intergenic
1190074890 X:47309759-47309781 CTGAGCTGGTCTGAAACTCCTGG + Intergenic
1191617605 X:63186260-63186282 CTGAGAATGACTTAACCTCCTGG - Intergenic
1192563452 X:72143009-72143031 CTGGGCAGGACTGAGGCTACAGG + Intergenic
1193094100 X:77527977-77527999 CTGAGCAGGACTTCCCATGCAGG + Intronic
1194871357 X:99136211-99136233 CTGAGCAGTACTGATTCTACTGG - Intergenic
1197871319 X:131065287-131065309 CTGAGCTGGAGTGAACCAGATGG + Intronic
1199065871 X:143417702-143417724 TTGTGCAAGACTGAACCTGGAGG + Intergenic